ID: 975608833

View in Genome Browser
Species Human (GRCh38)
Location 4:76183714-76183736
Sequence ACCCCCCAACCTCCCAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 1, 2: 9, 3: 74, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975608833_975608844 22 Left 975608833 4:76183714-76183736 CCCCTCCTGGGAGGTTGGGGGGT 0: 1
1: 1
2: 9
3: 74
4: 363
Right 975608844 4:76183759-76183781 TAATCCTGTCCTCTTCTTTCAGG 0: 1
1: 0
2: 3
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975608833 Original CRISPR ACCCCCCAACCTCCCAGGAG GGG (reversed) Intronic
900148493 1:1168313-1168335 CCCACCCAACCTCCCAGGCTGGG + Intergenic
900154476 1:1198466-1198488 AGCCCCCAACCTTCCTGCAGTGG + Intergenic
901801201 1:11709105-11709127 ATCCCCCAACCTCCCAAGAAGGG + Intronic
902024418 1:13372091-13372113 GTCTCCCAACCTCCAAGGAGCGG + Intergenic
902331129 1:15731725-15731747 GCCCCTCCAGCTCCCAGGAGAGG - Intronic
902572119 1:17353572-17353594 TCTCCCCTGCCTCCCAGGAGAGG - Intronic
903027934 1:20442848-20442870 ACCCACCACCCTCCTAGGAGGGG + Intergenic
903341430 1:22657150-22657172 ACCCCCCAACCTCTGGGGAGGGG - Intronic
904186879 1:28712398-28712420 CCCCCCGAACCTCCAAGGAGTGG - Intronic
904265668 1:29317304-29317326 ACCCCACACCCTCCAAGAAGCGG - Intronic
904831566 1:33309355-33309377 GCCCCCCCACCTCCCAGACGGGG + Intronic
904838766 1:33356879-33356901 GCCCCCCCACCTCCCAGACGGGG + Intronic
905311714 1:37053441-37053463 ACCTCCCATCTTCCCAGGACTGG - Intergenic
905357028 1:37391765-37391787 ACCCCCCAACCACCAAGAGGCGG + Intergenic
905922888 1:41730803-41730825 ACCCCCCAGCCTCCCACCTGTGG - Intronic
906846759 1:49200875-49200897 ACCCCCCAACCTCCAGGGAGGGG - Intronic
906962286 1:50425966-50425988 ACACCCTAACCTCCGGGGAGTGG - Intergenic
908474181 1:64471547-64471569 TCCCCCCATGCTCCCGGGAGGGG - Intronic
909447057 1:75759300-75759322 ACCCTACAACCTCCAGGGAGGGG - Intronic
910428640 1:87139703-87139725 ACCTCCCTGCCTCCCAGGACAGG - Intronic
910690419 1:89959821-89959843 ACCCCCCAACCTCTCAGGAAGGG - Intergenic
910715280 1:90223529-90223551 ACCACCCAACTTCCAGGGAGGGG - Intergenic
911435925 1:97857427-97857449 ATCCCCCAACTTCCAAGGATGGG + Intronic
911497025 1:98644284-98644306 ACCCTCTAACCTCTAAGGAGGGG - Intergenic
912665888 1:111579167-111579189 ACCCTCCAACCTCCAAGGAGGGG - Intronic
912819511 1:112855537-112855559 ACCCCTCAACCTCCACGAAGGGG + Intergenic
912913623 1:113789161-113789183 TACCCCCAACCTCCAGGGAGGGG + Intronic
913110442 1:115652815-115652837 ACCTCCCAAGCTGCCAGGAGTGG + Intronic
913293925 1:117300765-117300787 GCCCCCCCACCTCCCAGATGGGG + Intergenic
915575171 1:156771052-156771074 GCTCCCCAACCTCCCAAGACTGG - Intronic
916153951 1:161825820-161825842 ATCCCTCAACCTCCAAGTAGGGG - Intronic
916314014 1:163427520-163427542 CCTCCCCCTCCTCCCAGGAGAGG + Intergenic
916890034 1:169105889-169105911 ACCCCGCCAGCGCCCAGGAGGGG + Intronic
917153128 1:171965824-171965846 ACCCCCTAATCTCCAGGGAGGGG - Intronic
917304748 1:173613675-173613697 GCCCCCCAACCTCCCGGACGGGG - Intronic
918508149 1:185280627-185280649 ACCCCCTATCCTCTCAGAAGGGG + Intronic
918818911 1:189226056-189226078 CCCCCCCCACCTCCCAGACGGGG - Intergenic
919756721 1:201070615-201070637 AGCCCACAACCTTCCAGAAGTGG + Intronic
920065516 1:203266753-203266775 AGCCCCCCACCTCCCAGATGGGG + Intronic
920065535 1:203266794-203266816 GCCCCCCCATCTCCCAGAAGGGG + Intronic
920100122 1:203512128-203512150 ACCACCCCACCCCCCAGGGGTGG + Intergenic
920418221 1:205812813-205812835 GCCCCCCTTCCTCCCAGGCGAGG - Exonic
920854613 1:209652556-209652578 GCACCCCCACCTCCCAGGACGGG + Intergenic
922599473 1:226838639-226838661 ACTCCTCAACCTCCTGGGAGAGG - Intergenic
924154757 1:241164358-241164380 ACCCCTCAACTTCCAAGGAGGGG - Intronic
924624888 1:245689328-245689350 GGCCACCAACCTCACAGGAGGGG - Intronic
1063822656 10:9855588-9855610 GGCCCCCCACCTCCCAGAAGGGG + Intergenic
1065189838 10:23199034-23199056 CCCCCCCAGAGTCCCAGGAGCGG - Intergenic
1067041264 10:42954434-42954456 GGCACCCCACCTCCCAGGAGAGG + Intergenic
1067214017 10:44285520-44285542 ATCCCCCAACCTCCAGGGATGGG + Intergenic
1068134751 10:52940531-52940553 ACCTTCCAAGATCCCAGGAGAGG - Intergenic
1069602537 10:69717138-69717160 AAACCCAAACCTCCCAGCAGAGG - Intergenic
1069604672 10:69731850-69731872 AGCCCCCACCCTGCCAGGAATGG + Intergenic
1069634711 10:69918125-69918147 GCGCCCCCACCTCCCAGGTGGGG + Intronic
1070766798 10:79061513-79061535 TCCTCCCACCCTACCAGGAGGGG - Intergenic
1070984858 10:80679975-80679997 ACTCCCCAACCTCTAGGGAGGGG + Intergenic
1071310833 10:84342064-84342086 ATCCCCCAACCTCCAGGGGGGGG - Intronic
1071616671 10:87081225-87081247 GCCCCCTCACCTCCCAGAAGAGG - Intronic
1072480939 10:95809575-95809597 GCCCCCCCACCTCCCAGACGGGG + Intronic
1073108938 10:101049401-101049423 ACTCCTTTACCTCCCAGGAGAGG - Intergenic
1073998068 10:109339033-109339055 AGCCCCCTACCTCCCAGTAGGGG - Intergenic
1074095267 10:110305858-110305880 AACTCCCAACCTCCCAGGAAAGG - Intergenic
1074392769 10:113071844-113071866 TCCCCCCCACCCCCCATGAGTGG + Intronic
1074579443 10:114704681-114704703 ACCCCACAGCCTCCCAGGAAGGG - Intergenic
1075136985 10:119794806-119794828 ACCTCCCTCCCTCCCAGAAGGGG + Intronic
1075243425 10:120798756-120798778 GCCCCCCAACCTCCCAGACGGGG - Intergenic
1076618175 10:131770713-131770735 ACCCTTCCACCTCCCCGGAGGGG + Intergenic
1076915660 10:133422112-133422134 GCCCCCCAACATCCAAGGACAGG - Exonic
1077112898 11:869695-869717 ACTCCCCATCCTCCCATGAGGGG - Exonic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1077685062 11:4283379-4283401 ACCCACCTCCCTCCCAGGAGGGG - Intergenic
1077690126 11:4334551-4334573 ACCCACCTCCCTCCCAGGAGGGG + Intergenic
1078024260 11:7679769-7679791 ACTCTCCAACCTCCAGGGAGGGG + Intergenic
1078193172 11:9110382-9110404 ACCCCCCACCCACCCAGTGGAGG + Intronic
1078527399 11:12111101-12111123 ATCCCCAAACTTCCCAGGATTGG + Intronic
1079902437 11:26204138-26204160 ACTCCCCAAGCTCCCCAGAGGGG - Intergenic
1079951384 11:26809418-26809440 ACCCCCCACACTCCCATGACAGG + Intergenic
1080674334 11:34410970-34410992 CCCCACCAACCTCCAGGGAGGGG + Intergenic
1080680431 11:34470479-34470501 ACCCCCAAACCTCCAGGGATGGG - Intronic
1083120887 11:60510577-60510599 GCCCCCCAACCTCCCAGATGGGG - Intergenic
1083171875 11:60927941-60927963 ACCCCCGCGCTTCCCAGGAGTGG - Intronic
1083594544 11:63912611-63912633 TCTCCCCACCCTCCAAGGAGTGG - Intronic
1083707174 11:64524669-64524691 ACCTCCCAACCTCCAGGGAGCGG + Intergenic
1084505138 11:69561779-69561801 CCACCTCAGCCTCCCAGGAGTGG - Intergenic
1085355477 11:75832687-75832709 ACCCCCTGACCTCCAGGGAGGGG - Intronic
1085791415 11:79500227-79500249 GCCCCCCCACCTCCCAGAAGGGG - Intergenic
1087362504 11:97178453-97178475 ATCCCCTGACCTTCCAGGAGGGG - Intergenic
1089009028 11:115118076-115118098 ACCCCAGAGCCTCCCAGGAAAGG + Intergenic
1089042937 11:115471002-115471024 ACCCTCCAACATCAGAGGAGAGG + Intronic
1090387122 11:126363863-126363885 ACTCCCCACCCTCCCAGGCCCGG + Intronic
1090411220 11:126511358-126511380 ACCCCCCAGGCTGCCTGGAGAGG + Intronic
1092698968 12:11205602-11205624 ATCCCCCAACCTCCAGGGAGGGG - Intergenic
1092968557 12:13669576-13669598 ACCTCCCAGCCTCAGAGGAGAGG - Intronic
1093431681 12:19092189-19092211 AGCCCCCCACCTCCCAGATGGGG - Intergenic
1094443785 12:30507770-30507792 AACCCCCAGCCTCCTGGGAGGGG - Intergenic
1094596315 12:31869940-31869962 ACTCCTCAACCTCCTGGGAGGGG - Intergenic
1095113806 12:38330326-38330348 ACCCCCCCACCTCCCAGACGGGG + Intergenic
1096048726 12:48587060-48587082 ACTCCCCCACGGCCCAGGAGCGG + Intergenic
1096049260 12:48592800-48592822 ACCCCCCAACCTCCAGGGAGGGG + Intergenic
1096142600 12:49254740-49254762 ATCCCCCATCCTCCAGGGAGGGG - Intronic
1096700526 12:53380238-53380260 CCCCCCCAACCCCCCCGGACAGG + Exonic
1097013151 12:55967175-55967197 CCCCCCCAACCCCCCACGGGCGG + Intronic
1097013238 12:55967555-55967577 AGCCCCCAGCCTCCCCAGAGGGG - Intronic
1097138554 12:56879583-56879605 CCCCCCCAACCTCCCAGACGGGG - Intergenic
1097719685 12:63006621-63006643 ACCCCCCATCCTGTCAGCAGGGG + Intergenic
1098240723 12:68464198-68464220 ACCTCCCAACCTCCAGGGAGAGG - Intergenic
1098855208 12:75645010-75645032 ACACCCCAAACTCCCAGGACTGG + Intergenic
1101700678 12:107170782-107170804 TCCCTCTATCCTCCCAGGAGGGG + Intergenic
1103364055 12:120369448-120369470 ACCCCCCACCCACCCCGGCGCGG + Intergenic
1103379348 12:120481734-120481756 TTCCCCCAACCTCCAGGGAGGGG - Intronic
1103715938 12:122945368-122945390 GCTCCCCATCCTCCAAGGAGAGG + Intronic
1104081988 12:125437131-125437153 ACCCACCATCCACTCAGGAGGGG + Intronic
1104750746 12:131236586-131236608 ACCCCTCAGCCTCCCAAGAGAGG - Intergenic
1105327614 13:19384266-19384288 ACTCCCCAACCTCCAGAGAGGGG - Intergenic
1105608783 13:21949295-21949317 ACCACAGAACCTCCCAGGGGAGG - Intergenic
1105864289 13:24445412-24445434 ACTCCCCAACCTCCAGAGAGGGG + Intronic
1105940754 13:25146018-25146040 ATCCCCCAATCTCCAGGGAGGGG + Intergenic
1105992084 13:25632323-25632345 ACCCCTCAACCTCCAGGGAGGGG - Intronic
1106090143 13:26584038-26584060 CCTCCCCCACCTCCCTGGAGGGG + Intronic
1106580381 13:31012832-31012854 ATTGCCCTACCTCCCAGGAGGGG - Intergenic
1106612609 13:31298068-31298090 ACCCCCCAATCTCCTGGGAGGGG - Intronic
1106747603 13:32721309-32721331 AACCCCCCACCTCCCAGACGGGG + Intronic
1107042847 13:35967234-35967256 CGCCCCCAACCTCCCAGACGGGG - Intronic
1107404466 13:40099497-40099519 ATTCACCAGCCTCCCAGGAGAGG + Intergenic
1107568787 13:41634025-41634047 AGCCCTCAACCTCCCAAGACAGG - Intronic
1107697364 13:43013321-43013343 ACCCCCTAACCTTCAGGGAGGGG + Intergenic
1108082618 13:46752418-46752440 TCCCCCCATCTTCCCAAGAGTGG - Intronic
1108307360 13:49151726-49151748 TCCCCCCAACCTGCCATGACAGG + Intronic
1111706935 13:91761868-91761890 TCCCACCAACCTCCAGGGAGGGG - Intronic
1112505065 13:99970535-99970557 CCACCCCCACCTCCCAGGGGCGG - Exonic
1113004070 13:105679042-105679064 ACCCCCTAACCTCCAGGGAAAGG + Intergenic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1114237751 14:20836981-20837003 TCCCACCCACCTCCCAGCAGCGG - Intergenic
1114594254 14:23898307-23898329 GCCCCCCCACCTCCCAGACGGGG + Intergenic
1115493884 14:33984377-33984399 GCCCCCCGACCTCCCAGACGGGG + Intronic
1116729030 14:48598650-48598672 GCCCCCCCACCTCCCAGATGGGG - Intergenic
1117470512 14:56039777-56039799 ACCTCCCAACCTCTAGGGAGAGG - Intergenic
1117813725 14:59576465-59576487 TCTCCCCAGCCTCCAAGGAGCGG + Intronic
1118041947 14:61926791-61926813 ACCCCCCACCCTGCCAGTAGAGG + Intergenic
1118516015 14:66529905-66529927 ACCCCCATGCCTCCCAGCAGGGG - Intronic
1118955595 14:70477702-70477724 GCCCCCCCACCTCCCAGATGGGG - Intergenic
1119051808 14:71377199-71377221 GCCCCCCCACCTCCCAGATGGGG + Intronic
1119051828 14:71377240-71377262 GCCCCCCCACCTCCCAGACGGGG + Intronic
1119766989 14:77196383-77196405 AACCCACAACCTGCCAGGAAAGG + Intronic
1119852604 14:77876771-77876793 ACCCCCCGACCTCCCAAGTGTGG + Intronic
1120087192 14:80287025-80287047 GCCCCCCCACCTCCCAGACGGGG - Intronic
1120773773 14:88410834-88410856 ACCCCCATGCCTCCCAGCAGGGG - Intronic
1120945227 14:89988323-89988345 ACCCCCCATCCTCCAGGGATAGG - Intronic
1120957550 14:90096227-90096249 ACACCGCAACCTCCAGGGAGGGG - Intronic
1121538887 14:94710691-94710713 ACCCCCCACCCGCCCACCAGGGG + Intergenic
1121581304 14:95034076-95034098 ACCCGCCACCCCCTCAGGAGGGG - Intergenic
1122045214 14:99018026-99018048 ACCACCCCACCTCCCAGATGAGG - Intergenic
1122235891 14:100330452-100330474 AGCCCCACACCTCCCAGGACGGG - Intergenic
1122500683 14:102197106-102197128 ACTCCCCACCCTCCCTGTAGAGG - Intronic
1122561344 14:102616882-102616904 CCACCTCAACCTCCAAGGAGGGG - Intronic
1123198238 14:106637654-106637676 ACACCCAAACCTTCCTGGAGGGG - Intergenic
1124183808 15:27503060-27503082 ACTCCCCAACCTCTAGGGAGAGG - Intronic
1125817785 15:42601452-42601474 GCCCCCCAACCTCCCAGACGGGG + Intronic
1129067785 15:72921997-72922019 ACCCCACGACCTCCTGGGAGGGG - Intergenic
1130074162 15:80674448-80674470 ACCCACCAACCTCCAGGGAAGGG + Intergenic
1130583228 15:85157331-85157353 ACCCACCAACCTGCGGGGAGAGG - Intergenic
1130692463 15:86095316-86095338 ACCTCCCAACCTCCAGGGAAAGG - Intergenic
1131426055 15:92346352-92346374 ACCCCTCAACCTCCAGGGAGGGG + Intergenic
1132640276 16:975016-975038 ACCCCCCCACCCCCCACGTGAGG + Intronic
1132919695 16:2380334-2380356 ACCCCCAATCCTCCAGGGAGTGG - Intergenic
1135694267 16:24574072-24574094 ACCCCCCCACCTCCCGGACGGGG + Intergenic
1135838992 16:25856342-25856364 ACCCTCCAACCTTCAGGGAGGGG + Intronic
1137995279 16:53204160-53204182 CCACCCCAGCCTGCCAGGAGAGG + Intronic
1138405304 16:56788199-56788221 TTCCCCTACCCTCCCAGGAGAGG + Intronic
1139637638 16:68267810-68267832 TACCCCCAACCTCCGGGGAGGGG + Intronic
1141658878 16:85430912-85430934 TCCCACCCAGCTCCCAGGAGAGG + Intergenic
1141799231 16:86295876-86295898 AACTCCCAGCCTCCTAGGAGGGG - Intergenic
1143227379 17:5317819-5317841 ACCTCCCAACCTCCAGGGAGAGG + Intronic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1144263649 17:13547403-13547425 ACCCTACAACCTCCATGGAGGGG + Intronic
1144536756 17:16097421-16097443 ACCCCCAACCCTCCAGGGAGAGG + Intronic
1144671452 17:17134806-17134828 ACCCACCCACCTCCCAAGGGAGG - Intronic
1145007112 17:19344258-19344280 ACCCTCCAGCCTCCCTGGAAGGG + Intronic
1145414439 17:22703415-22703437 ACCCCGTCACCTCCCAGCAGAGG - Intergenic
1145895332 17:28454213-28454235 CACCCCCAACCTCTCAGGAGGGG - Intergenic
1146242828 17:31245858-31245880 ACTCCCCAACCTCCAAGGAGAGG - Intronic
1146295814 17:31649554-31649576 CCTCCCCAGCCTCCCTGGAGGGG + Intergenic
1146651273 17:34608034-34608056 ACTCCCTGACCTCCAAGGAGGGG - Intronic
1147968961 17:44209536-44209558 ACCAACCCACCTCCCAGGAACGG - Exonic
1148927105 17:51097016-51097038 CCCACACAACCTCCCAGGAGGGG + Intronic
1149608950 17:57945285-57945307 ACACCCCAATCTTCCAGCAGAGG + Intronic
1149698705 17:58637451-58637473 GCTCCCCAACCTCCGGGGAGGGG + Intronic
1149950163 17:60977026-60977048 GCCCCCCAACCTCCCAGACGGGG + Intronic
1150135565 17:62693131-62693153 ACACCCCAACCTCCCAGGGTGGG + Exonic
1151255317 17:72872169-72872191 ACCCAGCAAAGTCCCAGGAGTGG + Intronic
1151732171 17:75917968-75917990 ACCTCACCACCTCCCAGGAGCGG - Exonic
1151786047 17:76275629-76275651 ACCTACCCACCTCCCAGAAGGGG + Intronic
1151947320 17:77326775-77326797 ACCCCGCAACCTCCAGGTAGGGG + Intronic
1152179169 17:78807146-78807168 GCCCCCCAGACCCCCAGGAGTGG - Exonic
1152640637 17:81447870-81447892 ACCCCCCAGAGTCCCAGCAGTGG + Intronic
1152946602 17:83201028-83201050 GCTCCCCAACCAGCCAGGAGAGG - Intergenic
1153344336 18:4009779-4009801 ATCCACCACCCTCCCAGGAATGG + Intronic
1153803723 18:8694089-8694111 ACCTCCCAATCTCCGGGGAGCGG + Intergenic
1153960149 18:10133551-10133573 ATCCACCAACCTCCGAGAAGGGG - Intergenic
1155613997 18:27700733-27700755 ACCCACCAACCTCTGGGGAGGGG - Intergenic
1156273048 18:35554895-35554917 ACCCCTTTACCTCCAAGGAGGGG - Intergenic
1157599544 18:48885659-48885681 AACCCCCAGCCTCCCAAGATGGG + Intergenic
1157688347 18:49661052-49661074 ACCCCCCGACCTCCAGGGAGGGG + Intergenic
1157705285 18:49800205-49800227 ACCCCCCCACCTCCCGGACGGGG - Intronic
1157749227 18:50163332-50163354 ACCCTCCACTCTCCCAGGAGAGG + Intronic
1159782347 18:72674878-72674900 CTGCCCCAGCCTCCCAGGAGAGG + Intergenic
1160540271 18:79617256-79617278 GCCCCCCAAGCTCCCTGGAGAGG + Intergenic
1160991466 19:1862096-1862118 GCCCCCCACCCTCCCCGGAAGGG + Intronic
1161078834 19:2300483-2300505 ACCTCCCATCCTCCCAGGATGGG + Intronic
1161621053 19:5297225-5297247 ACCCCCCAACGTCCCAGCTGTGG - Intronic
1162439481 19:10683689-10683711 ACCCCCCAACCTTCGAGGGCGGG + Exonic
1162552577 19:11365716-11365738 ACCCCCCCACCACCCGGGGGAGG - Intergenic
1162602030 19:11676810-11676832 GCCCCCCCACCTCCCAGACGGGG + Intergenic
1163383763 19:16986284-16986306 ACCCACCAAACTGCCATGAGGGG - Intronic
1164633655 19:29777570-29777592 GAAACCCAACCTCCCAGGAGAGG - Intergenic
1165096818 19:33414062-33414084 ACCACCCACCCTGCCAGGAGGGG + Intronic
1166050363 19:40255550-40255572 GCCCCCCAACCCCCCAGGCTGGG - Intronic
1167359891 19:49024378-49024400 ACAGTCCAACCTCCCAGGAGGGG + Intronic
1167363670 19:49043781-49043803 ACAGTCCAACCTCCCAGGAGGGG - Intergenic
1167364827 19:49049146-49049168 ACAGTCCAACCTCCCAGGAGGGG + Intergenic
1167509233 19:49887618-49887640 TCCGCCCAACCTCCCAGGGCAGG - Intronic
1167850284 19:52195927-52195949 ACCCCACAACCTCCAGGGATCGG - Intronic
1168145669 19:54419046-54419068 ACCCCCCAGCCACGCAGGAAGGG + Intronic
1168211439 19:54893642-54893664 CCCCCGCCACCTCCCTGGAGAGG - Intergenic
1168213469 19:54908575-54908597 GCCCCCCCACCTCCCAGACGGGG + Intronic
1168213490 19:54908617-54908639 GCCCCCCAACCTCCCGGACGGGG + Intronic
926759859 2:16268807-16268829 ACCCCCCAACCACCAGGGAAGGG + Intergenic
928541973 2:32293723-32293745 ACCCCCCAACCTCCCGGACGGGG + Intronic
929836898 2:45410693-45410715 GACCCCCAACCTCCAGGGAGGGG + Intronic
930023278 2:47014285-47014307 ACATCCCAACCTGCCAGGAAGGG + Intronic
930799959 2:55433674-55433696 ATCCCCCAACCTCCGGTGAGGGG + Intergenic
931691767 2:64839704-64839726 ACCACCCAACTTCCCAGGTGTGG - Intergenic
932551574 2:72775224-72775246 TTCCCCCAACCTCCAGGGAGGGG - Intronic
933598366 2:84305214-84305236 ACCCCCTGACCTCCAGGGAGGGG + Intergenic
934025439 2:87998408-87998430 ACCCTCCAACCTCTAGGGAGGGG + Intergenic
934027188 2:88010792-88010814 GACCCCCAACCTCCAGGGAGGGG - Intergenic
935704195 2:105841613-105841635 ACCCTCCACCCTCCAAGAAGGGG - Intronic
936170442 2:110167350-110167372 ACCCTCCAACCTTCAAAGAGGGG + Intronic
938079646 2:128362898-128362920 ACCCCCCACCCTCCCAAGACAGG - Intergenic
938109169 2:128552677-128552699 ACCCCCCAGCAACCAAGGAGGGG - Intergenic
938682442 2:133705325-133705347 ATGCCTCAACCTCCCAGGAGGGG - Intergenic
939719817 2:145634743-145634765 ACCCTCTAACCTCCAGGGAGGGG - Intergenic
940190653 2:151037063-151037085 ACCCACCAACCTCCAAGAAGAGG + Intronic
941960026 2:171244385-171244407 ACCCTCCAACCTCCCGGGAGGGG + Intergenic
942108603 2:172658081-172658103 ACCCCACCACCTCCCAGGGAGGG + Intergenic
943731562 2:191308027-191308049 ACCTCCCCACCTCCAGGGAGGGG - Intronic
943863195 2:192894185-192894207 ACCTCCCAACCTCCCAGACGGGG - Intergenic
944479014 2:200135971-200135993 ACACCCCAACCTCCTGGGAGGGG - Intergenic
944570926 2:201042840-201042862 GCCCCCCCACCTCCCAGACGGGG - Intronic
946313799 2:218897001-218897023 ACCTCCCAACCCACCAGCAGGGG - Intronic
946939925 2:224760016-224760038 ATGCTCAAACCTCCCAGGAGTGG + Intergenic
947069740 2:226274973-226274995 GCCCCCCCACCCGCCAGGAGAGG + Intergenic
947593538 2:231397646-231397668 ACCACCCAGCCTCCCAAGGGGGG + Intronic
948740678 2:240043856-240043878 ACCCCCAGAGCTCCCAGGCGTGG - Intergenic
948965060 2:241372761-241372783 ACCACCCACCCACCCAGCAGAGG - Intronic
1169108744 20:3019034-3019056 ACCCCCCCACCTCCCGGACGGGG + Intronic
1169187372 20:3630025-3630047 ATCCCCCAACCTCCAAGAAGGGG - Intronic
1169410725 20:5367466-5367488 ACCCCACCACCACCCAGAAGTGG - Intergenic
1169914210 20:10671625-10671647 ACCACCCACCCTCCCAGCACAGG + Intronic
1170316244 20:15044100-15044122 ACCTTCCAACCTCCATGGAGGGG - Intronic
1170872541 20:20220116-20220138 ACCCCCCAGCCTCCGCGGAGAGG + Intronic
1171861446 20:30405515-30405537 ACCCCCCCACCTCCCGGACGGGG - Intergenic
1172131678 20:32660194-32660216 GCCCCCCAACCTCCCTGCAATGG - Intergenic
1172363362 20:34330549-34330571 CACCCCCAACCTCCAGGGAGGGG + Intergenic
1172881640 20:38203607-38203629 TCTCCCCCAGCTCCCAGGAGAGG - Intergenic
1173410908 20:42808730-42808752 ATTCCCCAGCCTCCCAGTAGTGG - Intronic
1173631538 20:44520015-44520037 ACCCCTGACCCTCCAAGGAGGGG + Intronic
1174418734 20:50385419-50385441 TCCCCCCACCCTCCGAGGAGGGG + Intergenic
1174687286 20:52468117-52468139 ACCTCTCAGCCTCCAAGGAGAGG - Intergenic
1175440033 20:58983853-58983875 ACTCCCCAATCTCCCATCAGTGG - Intronic
1175705341 20:61172458-61172480 AGTGCCCAACCTCCCAGGAAAGG - Intergenic
1176116602 20:63434319-63434341 AGCCTCCAACCTCCCAGGGCGGG + Intronic
1176188158 20:63792933-63792955 ACCCCACACCATCCAAGGAGGGG - Intronic
1176668729 21:9712077-9712099 ACCCATCAACCTCCTGGGAGGGG - Intergenic
1176963503 21:15186360-15186382 ACCCCCCTCCCTCCCTGAAGTGG + Intergenic
1179124851 21:38581572-38581594 ATTTCCCAACCTCTCAGGAGAGG + Intronic
1179149662 21:38799083-38799105 AGCTCCCACCCTCCCAGCAGAGG - Intergenic
1180090809 21:45533104-45533126 GCCCTGCACCCTCCCAGGAGGGG + Intronic
1180227183 21:46401364-46401386 ACCCAGCCACCTCCCAGCAGAGG - Intronic
1181538858 22:23562409-23562431 ACCCCCCTTCCTCCGAGAAGTGG + Intergenic
1181657900 22:24317442-24317464 ACCCCCCAACCTCCCGGACGGGG + Intronic
1181759907 22:25051123-25051145 ACCCACCTACCTCTGAGGAGAGG - Intronic
1182418820 22:30238709-30238731 CCTCCCCCACCGCCCAGGAGTGG - Intergenic
1182678824 22:32062316-32062338 TCCCACCAACCTTCCAGGATAGG + Intronic
1182681216 22:32081393-32081415 ACCCCACCCCCACCCAGGAGCGG - Intronic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
1184211238 22:43036757-43036779 GCCCTCTTACCTCCCAGGAGGGG - Intergenic
1184230087 22:43153989-43154011 ACCCCCGAACCTCGAAGGAAAGG + Intronic
950669595 3:14518141-14518163 GCTCCACAACCTCCCAGCAGTGG - Intronic
951290366 3:20866746-20866768 GCCCCCCCACCTCCCAGATGGGG + Intergenic
952218914 3:31304671-31304693 AACCCCTAACCTCCAGGGAGGGG - Intergenic
953187836 3:40654846-40654868 ACCCCCCAAACCCCCTGGACAGG + Intergenic
953440125 3:42909652-42909674 GCCCCCCCACCTCCCAGACGGGG + Intronic
954066501 3:48110949-48110971 ACTCCCCAACCTCCTGGGAGAGG + Intergenic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
954810126 3:53242417-53242439 AGGCCCCAAACTGCCAGGAGTGG - Intronic
954855845 3:53642773-53642795 ACCCCACAATCACCCAGGTGGGG - Intronic
956517770 3:70068510-70068532 ACCCCACCACCTCCCATAAGCGG - Intergenic
957837585 3:85617624-85617646 ACGCCCCAAACTCCGAGGAAAGG - Intronic
958611472 3:96432025-96432047 ACTCCCCAATCTCCAGGGAGGGG + Intergenic
960577528 3:119242773-119242795 GCCCCCCCACCTCCCGGGCGGGG - Intergenic
960738320 3:120804484-120804506 ACCATTCAACCTCCCAGGAGGGG - Intergenic
961348587 3:126282657-126282679 CACCCCCAACCTCCAAAGAGGGG + Intergenic
961489200 3:127240823-127240845 ACCCCCCAACCTCCTGGGTGGGG - Intergenic
961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG + Intergenic
964496502 3:157296440-157296462 ACCCCTCAAACTCCCTGTAGAGG + Intronic
965287606 3:166837348-166837370 ACTCCTCATCCTCCAAGGAGAGG + Intergenic
967715276 3:192755397-192755419 ACCCACCAAACTCACAGGATAGG - Intronic
967911501 3:194546058-194546080 ATCCCCCATCCTCTGAGGAGTGG - Intergenic
968744129 4:2350674-2350696 CACCCCCAACCTCCGGGGAGGGG + Intronic
968852686 4:3094503-3094525 GCCCCCCAACCTCCCAGACGGGG + Intronic
969015189 4:4099222-4099244 AGCCCCCAACTTACCAGGAAGGG - Intergenic
969199514 4:5591457-5591479 ACCACCCACCCACCCAAGAGGGG - Intronic
969605990 4:8202542-8202564 ACCCCCCAACCACCTCTGAGGGG - Intronic
971363276 4:25955949-25955971 ACCCCTCAACCTCCAGGGAGGGG + Intergenic
973130939 4:46647693-46647715 ACCCCCTAATATCCCAGGAATGG - Intergenic
973586932 4:52402385-52402407 ACCCCCCAACCTCCAGGGAAGGG - Intergenic
975608833 4:76183714-76183736 ACCCCCCAACCTCCCAGGAGGGG - Intronic
975908881 4:79245710-79245732 CGCCCCCAACCTCCCAGAGGGGG - Intronic
975908901 4:79245750-79245772 GCCCCCCTACCTCCCAGAGGGGG - Intronic
981505274 4:145492663-145492685 ACCCTCCAACCTCAAGGGAGGGG - Intronic
982575932 4:157110061-157110083 ACCCCGCAACCTTCAGGGAGGGG - Intronic
983905963 4:173183699-173183721 GCCCCCCCACCTCCCAGACGGGG + Intronic
985139304 4:186822283-186822305 ACCCCCCAATCTCCAGGGAGGGG - Intergenic
985406053 4:189639448-189639470 ACCCATCAACCTCCTGGGAGGGG + Intergenic
985653070 5:1115960-1115982 ATACCCCACCCTGCCAGGAGAGG - Intergenic
987836596 5:23170524-23170546 ACCCCCTAACCTCAGAGGAGGGG - Intergenic
987996859 5:25293269-25293291 ACCCCCAATCCTCTCAGCAGTGG + Intergenic
988566032 5:32320616-32320638 GAGCCCCACCCTCCCAGGAGTGG - Intergenic
989126175 5:38054410-38054432 ACCCCCCATCCTCTGGGGAGGGG + Intergenic
989655778 5:43745873-43745895 ACCCCCCCACCTCCCAGACGGGG + Intergenic
990081126 5:51915053-51915075 ACCCCTCAAGCTCCCAGGAGGGG + Intergenic
990567226 5:57041867-57041889 GCCACCCAGCCTCCAAGGAGGGG - Intergenic
991291158 5:65035084-65035106 GCCCCGCCACCTCCCAGCAGCGG + Intergenic
992009709 5:72514185-72514207 ACCCCCCTACCTCCAGGAAGGGG - Intergenic
993182523 5:84572729-84572751 ACCTCCCAACCTCCCAGGAGGGG + Intergenic
993505911 5:88708341-88708363 ACCTCCCAACCTCACAGCTGGGG - Intergenic
993857841 5:93097763-93097785 ACCCCACTACCTCCTGGGAGAGG - Intergenic
995594569 5:113734128-113734150 ACCCCCTAACCTCTGGGGAGAGG - Intergenic
997398216 5:133581520-133581542 CCACCCACACCTCCCAGGAGGGG + Intronic
998224111 5:140313106-140313128 ACCCCCTAACCTTCCTGGAATGG - Intergenic
999217418 5:149946916-149946938 ATCCTCCAACCTCCAAGAAGGGG + Intergenic
1000595315 5:163208884-163208906 ACACCCCAATCTTCTAGGAGTGG - Intergenic
1002288271 5:178180139-178180161 CGCCCCCAACCTCCCAGGAAGGG - Intergenic
1002543842 5:179925227-179925249 ACCCCCCAGCCTCCAGGGAGCGG + Intronic
1002561334 5:180084238-180084260 AACCCCCAATCTCCAGGGAGGGG + Intergenic
1002561996 5:180088789-180088811 ACCCCCCAGCCTCCGGGGAGCGG - Intergenic
1003099403 6:3165468-3165490 ATCCCCTAACCTCCCTGGAGAGG - Intergenic
1005710968 6:28502523-28502545 GCCCCCCCACCTCCCAGACGGGG - Intergenic
1006723847 6:36181501-36181523 ACCTCCCAACATCCAAGGAGGGG - Intergenic
1006838741 6:37014875-37014897 GCACCCCAACCCCCTAGGAGCGG + Exonic
1007801439 6:44397103-44397125 AACCCCCAACCTCAGGGGAGGGG - Intronic
1007922287 6:45621285-45621307 ACCCCCACACCTCCGGGGAGAGG + Intronic
1008143060 6:47854429-47854451 GTCCCCAAACCTCACAGGAGAGG - Intergenic
1008909881 6:56721065-56721087 CCCCCCCCACCTCCCAGACGGGG + Intronic
1008909919 6:56721149-56721171 CCCCCCCCACCTCCCAGATGGGG + Intronic
1009301397 6:62027606-62027628 CTCCCCTAACCTCCTAGGAGTGG + Intronic
1009622618 6:66096733-66096755 CCCCCCCAACCTCCCGGACGGGG + Intergenic
1010175262 6:73020604-73020626 ACCACCCAACCTCCAAGGACGGG - Intronic
1011593462 6:88993530-88993552 ACCCCCCAACCTCCTAGAAGAGG + Intergenic
1015512521 6:134052527-134052549 ACCACCCCCGCTCCCAGGAGTGG + Exonic
1016825564 6:148385603-148385625 ACCTCCCAACCTCTGGGGAGGGG + Intronic
1017793528 6:157822737-157822759 ACCCCGCAACACCCCAGGCGTGG + Intronic
1018972320 6:168538068-168538090 ACTCCCCCACATCCCAGCAGGGG - Intronic
1019444146 7:1062437-1062459 TCCACCCAATCACCCAGGAGTGG + Intronic
1019575792 7:1737059-1737081 ACACCCCACACTCCCTGGAGGGG + Intronic
1019657921 7:2207415-2207437 ACCCCTCAACCTCCTAGGAGGGG + Intronic
1020181666 7:5927470-5927492 CCAGCCCAACCTCCCAGGAAGGG - Intronic
1020301265 7:6797470-6797492 CCAGCCCAACCTCCCAGGAAGGG + Intronic
1020330644 7:7013628-7013650 ACCCCTCGACCTCCTGGGAGGGG + Intergenic
1020334466 7:7052067-7052089 ACCCCCCAACCTTCCGGGGAGGG + Intergenic
1021107350 7:16653103-16653125 AACTCCCATCCTCCCAGAAGGGG - Intronic
1022318144 7:29263956-29263978 GCCCCCCCACCTCCCAGACGGGG - Intronic
1022680139 7:32537079-32537101 ACCCCTTGACCTCCCAGGAACGG - Intronic
1023299867 7:38758747-38758769 GCCCCACAACCTCCAAGGAGGGG + Intronic
1025775212 7:64554438-64554460 GCCCCCCCACCTCCCAGACGGGG - Intronic
1027174907 7:75897139-75897161 CCCCTCCACCCCCCCAGGAGAGG + Intergenic
1028160800 7:87483056-87483078 ACCCTTCATCCTCCCAGCAGTGG + Intergenic
1029123676 7:98283773-98283795 ACACCCCCACGTCCCAGGTGGGG - Intronic
1030658672 7:112195901-112195923 ACCAACCACCCTCCCACGAGGGG + Intronic
1032341934 7:131081979-131082001 ACCCCCAAGCCTCCCTGGAATGG - Intergenic
1033095003 7:138423104-138423126 ACCTCCCAACCTCCAGGGAAAGG + Intergenic
1033249381 7:139745720-139745742 ACCCCCCAACTTCCAGGCAGTGG + Intronic
1033278964 7:139992390-139992412 ACCCCGCCAGCTCCCAGCAGAGG + Intronic
1034232153 7:149538943-149538965 ATCCCCCTACCTCCAGGGAGGGG - Intergenic
1034442514 7:151093555-151093577 ACCACAGATCCTCCCAGGAGAGG - Intronic
1034964703 7:155383977-155383999 AACCCCCTGCTTCCCAGGAGGGG + Intronic
1035005322 7:155653561-155653583 AACCCCCAGCCTCCCTCGAGGGG + Intronic
1035327461 7:158074273-158074295 AACGCCCAGCCTCCCAGCAGAGG - Intronic
1036643694 8:10599395-10599417 ACCCCACTTCCTCCAAGGAGGGG - Intergenic
1036650203 8:10637230-10637252 AGTCCCCAACCTCCCAGGCTTGG + Intronic
1037892122 8:22628946-22628968 GCCCCCCAGCCTCCCCAGAGTGG - Intronic
1038035328 8:23682335-23682357 GCCCTCCACCGTCCCAGGAGCGG - Intronic
1038167984 8:25103207-25103229 ACCCCCCTACCTCCCAGATGGGG - Intergenic
1039536903 8:38324762-38324784 CCCCCCCATCCTCCGAGAAGGGG + Intronic
1040537215 8:48320833-48320855 ACCCACCCACCTCCCATGGGTGG - Intergenic
1040597395 8:48852840-48852862 ACCCCCCAAACTGACAGCAGAGG + Intergenic
1040616240 8:49041521-49041543 ACCCCCCCACCTCCCAGACAGGG + Intergenic
1041523118 8:58776518-58776540 CGCCCCCCACCTCCCAGAAGGGG - Intergenic
1041798484 8:61772380-61772402 TCCCCCAAACCTACTAGGAGAGG - Intergenic
1042823000 8:72952395-72952417 ACCCCGCACCCCGCCAGGAGCGG + Intergenic
1043501895 8:80866706-80866728 CCCCCCCAACCCCGCAAGAGGGG - Intronic
1043516662 8:81001120-81001142 ACCCTCCCACCTCTCAGGTGTGG + Intronic
1044449903 8:92322591-92322613 CCCCACCAACCTCTAAGGAGGGG - Intergenic
1046636883 8:116680183-116680205 CCCCCCCACCCTCCCGGAAGGGG - Intronic
1051427673 9:16950276-16950298 ATCCCCTAACCTCCAGGGAGAGG + Intergenic
1052236103 9:26214811-26214833 GCCCCCCCACCTCCCAGATGGGG + Intergenic
1053081693 9:35183260-35183282 AGCCCCTCACCTCCCAGGCGGGG + Intronic
1053446176 9:38154809-38154831 AGCCCCCAACCTCCCAGACTTGG - Intergenic
1055298029 9:74853301-74853323 GCCCCCCAACCTCCCGGATGGGG - Intronic
1056826563 9:89880062-89880084 ACACCCCATCCTTCCAGGAAAGG - Intergenic
1057198287 9:93127128-93127150 ACCTCCCAACCTCCCAGCCTTGG + Intronic
1057424471 9:94937099-94937121 GCCCCCCAATCTCCGGGGAGGGG - Intronic
1057674826 9:97130520-97130542 CGCCCCCCACCTCCCAGGAGGGG + Intergenic
1057674843 9:97130559-97130581 CCCCCCCCACCTCCCAGACGGGG + Intergenic
1059044922 9:110856004-110856026 ACCCCCAGACCTCCAGGGAGAGG - Intergenic
1059432427 9:114258275-114258297 ACTCCCCAGACTCCCAGGAAAGG + Intronic
1060080169 9:120636800-120636822 GCCCCCCCACCTCCCAGACGGGG - Intronic
1060129557 9:121081870-121081892 ACCCCACAACCTTTAAGGAGGGG - Intronic
1060207025 9:121688115-121688137 GCTCCCCCACCTCCCAGGAAAGG - Intronic
1060838694 9:126777691-126777713 CCTCCCCCAGCTCCCAGGAGGGG - Intergenic
1061003467 9:127915655-127915677 ACCACCAAGCCTCCCAGGAGGGG + Intronic
1062393142 9:136341998-136342020 CACCCCCAATTTCCCAGGAGAGG - Intronic
1203657138 Un_KI270753v1:8864-8886 ACCCATCAACCTCCTGGGAGGGG + Intergenic
1186896009 X:14005286-14005308 ACCCCCTAACCTCCAGGGAAGGG + Intergenic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1188245339 X:27830965-27830987 ACCCCCGAACCCCCGAGCAGAGG + Intergenic
1189312370 X:40028757-40028779 AGCCCCCAACCTCTGGGGAGGGG + Intergenic
1189509939 X:41652583-41652605 CACCCCCAACCTCCAGGGAGGGG + Intronic
1189515554 X:41710761-41710783 CATCCCCAACCTCCAAGGAGGGG + Intronic
1189882038 X:45503844-45503866 GGCCCCCCACCTCCCAGAAGGGG + Intergenic
1189994249 X:46623948-46623970 CCATCCCAACCTCCTAGGAGGGG + Intronic
1190081455 X:47359764-47359786 CACCCCCAACCTCCTGGGAGGGG - Intergenic
1190083101 X:47372237-47372259 ACCCTCCAACCACCTGGGAGGGG + Intronic
1191256663 X:58282471-58282493 ACTCCCCGACCCCCCAGGGGTGG + Intergenic
1191609721 X:63100050-63100072 ACCCCTCTCTCTCCCAGGAGGGG - Intergenic
1192500053 X:71644958-71644980 GCCCCCCCACCTCCCAGACGGGG + Intergenic
1194714553 X:97275230-97275252 CCCCCCCCACCTCCCAGACGGGG + Intronic
1195118357 X:101723092-101723114 AACCCCCAACCTCCAGGGAAAGG + Intergenic
1195212367 X:102661789-102661811 ACCCCTTGACCTCCAAGGAGAGG - Intergenic
1195325667 X:103756323-103756345 CACCCCCAGCCTCCTAGGAGGGG - Intergenic
1196734792 X:118974251-118974273 CCCCCCACTCCTCCCAGGAGAGG - Intergenic
1198454204 X:136799376-136799398 ACACCTCAACCTCACAGTAGTGG - Intergenic
1198816711 X:140599293-140599315 ATCCACCAACAGCCCAGGAGTGG - Intergenic
1199182288 X:144872406-144872428 ATTCCCCAACCTCCCTAGAGAGG - Intergenic
1199570692 X:149264276-149264298 ACCACACAAAATCCCAGGAGAGG - Intergenic
1200324545 X:155223785-155223807 ACCCCCCCACCTCCCGGACGGGG + Intronic
1202604214 Y:26625325-26625347 ACTCCCCAATCTCCAGGGAGGGG + Intergenic