ID: 975609017

View in Genome Browser
Species Human (GRCh38)
Location 4:76185672-76185694
Sequence CAATTTATCAAACACCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975609017_975609019 24 Left 975609017 4:76185672-76185694 CCTCAGAGGTGTTTGATAAATTG 0: 1
1: 0
2: 2
3: 21
4: 188
Right 975609019 4:76185719-76185741 TCGTTATCTTTCAGTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975609017 Original CRISPR CAATTTATCAAACACCTCTG AGG (reversed) Intronic
902119126 1:14146638-14146660 CAAATTATCAATCAATTCTGAGG - Intergenic
905601984 1:39260190-39260212 GAAATTATCAAAGACCACTGTGG - Intronic
907426700 1:54384214-54384236 CATTTTCCCACACACCTCTGAGG + Intronic
907974654 1:59419887-59419909 CAATTTTGCAAACAACTCTATGG + Intronic
908304194 1:62794021-62794043 GTATTTATCAAACAACTGTGTGG + Intronic
909589696 1:77333199-77333221 CTCTGTATCAAACACCTCTGAGG + Intronic
910548209 1:88444312-88444334 GCATTTATCAAACACCTAGGAGG + Intergenic
911320601 1:96409553-96409575 CAAATTATCTAACACCTGTTGGG + Intergenic
911569603 1:99507519-99507541 AATTTTATCAAATACCTCTTCGG - Intergenic
911936150 1:103976000-103976022 AAATTTACCAAATACCACTGAGG - Intergenic
914385155 1:147161859-147161881 AAATTTCTCAAAGAGCTCTGAGG - Intronic
916005612 1:160657045-160657067 CATTGTATAAAATACCTCTGAGG + Intergenic
916309741 1:163384015-163384037 CTATTTTCCAAACACTTCTGTGG + Intergenic
919306065 1:195839061-195839083 CAACCAACCAAACACCTCTGAGG + Intergenic
919575248 1:199300485-199300507 ATATTTATTAAACACCTATGAGG + Intergenic
920856594 1:209667765-209667787 CTATGTATCAAACACCTCAAAGG + Intergenic
921876081 1:220198056-220198078 CTATTTATCAAGTACCTCTTGGG + Intronic
1064066950 10:12190490-12190512 CAGTTTAGCAAGCACATCTGGGG + Intronic
1064442292 10:15364584-15364606 CAAATTATCAAACAACTCAGTGG + Intronic
1069384969 10:67875917-67875939 CACTTTATCAAACACCATTTGGG - Intergenic
1070361582 10:75695452-75695474 CAATTTTTCAAAAAGCTCTGGGG - Intronic
1071836883 10:89427039-89427061 CTATTTATCAAGCACCTCTTTGG - Intergenic
1072191518 10:93080333-93080355 CATTTCACCAACCACCTCTGGGG - Intergenic
1073079580 10:100850571-100850593 TGGTTTATAAAACACCTCTGAGG - Intergenic
1074895121 10:117770741-117770763 TCATTTGTCAAAAACCTCTGAGG + Intergenic
1079170872 11:18094367-18094389 CAATTTAGCAGTCAGCTCTGTGG - Intronic
1080698597 11:34624716-34624738 CATTTTAGCAAATAACTCTGAGG - Intronic
1081552397 11:44125955-44125977 CGATATTCCAAACACCTCTGGGG - Intronic
1081822830 11:46016767-46016789 CAGTTTACCAAACATTTCTGAGG - Intronic
1083276267 11:61598783-61598805 CAATTCAACAAACAGCTCTTTGG - Intergenic
1083312129 11:61789323-61789345 CTATTGAGCACACACCTCTGAGG + Intronic
1084443085 11:69187109-69187131 CCATTTATCAAAGCCCTTTGGGG + Intergenic
1089056831 11:115592349-115592371 CATGTTATGAAACCCCTCTGTGG + Intergenic
1089380520 11:118027784-118027806 CATTCTCTCAAACACCTTTGTGG - Intergenic
1091975149 12:4818393-4818415 CAAGTTATGAAACAGTTCTGTGG + Intronic
1095535669 12:43243912-43243934 GAATTTATCAGAAACTTCTGAGG - Intergenic
1097565122 12:61258840-61258862 CATTTTATCATCCACCTGTGTGG + Intergenic
1098351779 12:69570097-69570119 CAATTAATCATACACTTTTGTGG + Intronic
1100394952 12:94177458-94177480 CAAGTTATCAAAAAGTTCTGTGG - Intronic
1101213411 12:102557571-102557593 TCAGTTATCAAACATCTCTGAGG - Intergenic
1102245061 12:111350616-111350638 CATTTTGTAAAACATCTCTGAGG - Intergenic
1102814855 12:115857472-115857494 CTATTTATCAAGCATCTGTGGGG - Intergenic
1106397574 13:29395693-29395715 CAACTTAACAAACCCTTCTGGGG + Intronic
1107327387 13:39259408-39259430 CAATTTCTGAAACAGCTCTGGGG + Intergenic
1107549455 13:41461336-41461358 CAATTTCTAAAGCACCTCTGAGG - Intronic
1109121902 13:58468439-58468461 CAATTCACCAAACACCTGAGTGG - Intergenic
1109326354 13:60871983-60872005 CAATTTATCAAAGAAATATGTGG + Intergenic
1109441023 13:62374678-62374700 CAATGCACCATACACCTCTGAGG - Intergenic
1110704758 13:78592775-78592797 CTCTCTATCAAACAGCTCTGGGG - Intergenic
1111159956 13:84382187-84382209 CAATATATCAAATACTTTTGAGG + Intergenic
1111172216 13:84542117-84542139 CACTTTGTCTAACACCACTGTGG + Intergenic
1111207162 13:85026302-85026324 AAATTTATCAAAAAACTTTGAGG - Intergenic
1111688002 13:91525589-91525611 CAGTTTATCCCATACCTCTGTGG - Intronic
1111965285 13:94855892-94855914 CAATTTATCTAAGAACTCAGAGG + Intergenic
1112935137 13:104787777-104787799 TAAATTATCAAACAGCCCTGAGG + Intergenic
1116795195 14:49382707-49382729 CTTTTCATCAAACAGCTCTGTGG - Intergenic
1117257286 14:53991184-53991206 CAATTTGTCAATCATCTCAGAGG + Intergenic
1119895472 14:78215935-78215957 CAGTTTATCAATCACTGCTGAGG - Intergenic
1123820279 15:24022733-24022755 CAATTTATCAAACACCCCAGCGG - Intergenic
1124185322 15:27520461-27520483 GAATTTGCCACACACCTCTGAGG + Intronic
1124791611 15:32732238-32732260 GAATTAATCAAAAACCTCAGAGG + Exonic
1125054343 15:35340018-35340040 CAATTTATTAGAGACCTCAGAGG - Intronic
1125077158 15:35632938-35632960 CATTTTCTCAAAAAGCTCTGAGG - Intergenic
1125911772 15:43446457-43446479 TAATTTATCATCCACGTCTGGGG + Exonic
1126550958 15:49928870-49928892 AAATGTCTCAAACATCTCTGGGG + Intronic
1126871735 15:52996593-52996615 CAATTTTACAAACACCTATAAGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1132322938 15:100940001-100940023 GAAGTTATCAAAGACTTCTGGGG - Intronic
1133186064 16:4099566-4099588 AAAGTTATCAAAGACCACTGGGG + Intronic
1136265029 16:29111231-29111253 CAATCTATGTAACACGTCTGAGG + Intergenic
1142053825 16:87979206-87979228 CAATGTATGTAACACGTCTGAGG + Intronic
1153108233 18:1552403-1552425 TGATTTATCAAAAAGCTCTGTGG + Intergenic
1154359350 18:13645958-13645980 AAATACATCAAATACCTCTGTGG - Exonic
1154399410 18:14021511-14021533 CAGTTTGTCAAAGAGCTCTGGGG + Intergenic
1155869864 18:31013425-31013447 CAATTTATCAGAGGCTTCTGTGG - Intronic
1155988092 18:32251997-32252019 CAAGTTATTAAACACCTTAGAGG - Intronic
1156653944 18:39261065-39261087 CAATTTGGAAAACACCTTTGAGG + Intergenic
1158379697 18:56915700-56915722 GAATTTTTCAAACACCCCTGAGG - Intronic
1162600239 19:11663330-11663352 CAATTTATCAAACACCACAGCGG - Intergenic
1163378689 19:16949985-16950007 CATTTTATCAAGCTCCTGTGTGG - Intronic
1164678801 19:30120597-30120619 TAATTTATCAAACATCTCTTAGG + Intergenic
1166320689 19:42016797-42016819 CACTTTACCAAACACCTCCCAGG - Intronic
925833184 2:7916442-7916464 CCAATTATAAAACACCTCTTAGG - Intergenic
926579030 2:14614637-14614659 CACTTTATGAAAAACCTCTTGGG - Intergenic
928171736 2:29008815-29008837 CCATATGTCAAAAACCTCTGTGG + Intronic
928923545 2:36552431-36552453 CACTTTCTCAAGCACCTCAGAGG + Exonic
931669294 2:64632313-64632335 AAATTTATGAACCACCTTTGTGG - Exonic
931937626 2:67215596-67215618 CTCTTTAACAAACACCTCTTGGG - Intergenic
932038834 2:68277090-68277112 TAATTTAACCAACACCCCTGTGG + Intergenic
932268861 2:70391397-70391419 CAAATTACCAAATATCTCTGGGG + Intergenic
935541636 2:104355010-104355032 ACATTTATCAAACACCTTTATGG - Intergenic
936734215 2:115420754-115420776 CACATTAACAAACAACTCTGTGG + Intronic
938821453 2:134964267-134964289 CAATTTCTCAGAGACATCTGAGG + Intergenic
939651305 2:144766013-144766035 CAATTAAACTAAAACCTCTGGGG - Intergenic
940692832 2:156940945-156940967 CAGTTTATCTTACCCCTCTGTGG + Intergenic
942501777 2:176598604-176598626 CAATTCATCAACCACTTCTGTGG - Intergenic
942969212 2:181937522-181937544 CAATTTTTAAAACACTACTGTGG + Intergenic
944541066 2:200754263-200754285 CAAGTTATTACACATCTCTGGGG - Intergenic
944985263 2:205168980-205169002 CCATTTATCGAACACCTATTAGG - Intronic
947190514 2:227500130-227500152 CAATTCCTCAAAAACCTATGAGG - Intronic
949080622 2:242095750-242095772 CAAATTCTCAAACACCACTGTGG - Intergenic
1173683142 20:44901365-44901387 TGATATATCAAACACCTCTAGGG - Intronic
1174442735 20:50569007-50569029 CAACTTTTCAAACACCCCTCGGG + Intronic
1177058989 21:16347588-16347610 CAACCTCTCAAATACCTCTGTGG + Intergenic
1177451416 21:21272536-21272558 GAATTTATCAGAAACATCTGAGG - Intronic
1178209950 21:30518293-30518315 CAATTTCTAAGACACATCTGAGG + Intergenic
1182411727 22:30192834-30192856 CCATTGATCCATCACCTCTGGGG - Intergenic
1184047148 22:41978612-41978634 CAAATAAACAAAGACCTCTGGGG - Intronic
951394792 3:22152415-22152437 AAATTTATCATACAGTTCTGAGG + Intronic
951491771 3:23278630-23278652 CAATTCAACAAATACTTCTGTGG - Intronic
953059404 3:39414695-39414717 CAATTCTGCAAACACCACTGGGG - Intergenic
955673481 3:61426481-61426503 CATTTTATCAAACACGGGTGTGG - Intergenic
957602414 3:82355080-82355102 TAACTTATCAAACAACTATGAGG + Intergenic
958068229 3:88573452-88573474 GCATTTATCAAACACATCCGTGG + Intergenic
960534306 3:118799808-118799830 CAATTTGACAAACTCATCTGTGG + Intergenic
965689530 3:171340820-171340842 CAATCTCTCAAACTCTTCTGTGG + Intronic
965770569 3:172177581-172177603 AAATTTACCAAATAGCTCTGAGG + Intronic
965950546 3:174303234-174303256 CAATGTATCAGTCACTTCTGAGG + Intergenic
967188151 3:186962805-186962827 CAATTTATGGTACAGCTCTGTGG + Intronic
968271164 3:197404788-197404810 CAAGTTATGAATCACCTCTGGGG - Intergenic
968584169 4:1408220-1408242 TAACTTATAAATCACCTCTGGGG + Intergenic
970270715 4:14344482-14344504 CAAGTTACAAAACATCTCTGAGG + Intergenic
970721106 4:18989464-18989486 CAAATTATCAAAAACCACTGAGG + Intergenic
971661041 4:29416081-29416103 AAATAAATCAATCACCTCTGGGG + Intergenic
975401102 4:73940671-73940693 CAATTATGCAAACATCTCTGGGG + Intergenic
975438541 4:74382378-74382400 CAACTTACAAAACACCACTGTGG + Intronic
975609017 4:76185672-76185694 CAATTTATCAAACACCTCTGAGG - Intronic
976386009 4:84459364-84459386 CAATTTTTAAAACAATTCTGTGG - Intergenic
976779132 4:88738850-88738872 GACTTTATCAAAGACCCCTGAGG - Intronic
976892371 4:90065459-90065481 CAATTCTTTAAACACCTCTGTGG - Intergenic
977799302 4:101206754-101206776 CAATTTATTTAATACTTCTGTGG + Intronic
977960972 4:103085054-103085076 CAATTTAATAAACACATCTACGG + Intronic
979555216 4:122038751-122038773 CTATTTTTCAAACATTTCTGGGG + Intergenic
980575005 4:134675604-134675626 GAATTTCTCAAAAACCTCTTTGG - Intergenic
981492946 4:145360251-145360273 CAATTTAAAAACCACCACTGTGG + Intergenic
981953755 4:150444752-150444774 CGATTTAACAAACACATCTTGGG + Intronic
982622545 4:157725585-157725607 CAATTTATCCAACATCCCTAAGG + Intergenic
982806197 4:159767102-159767124 CAAATTCTGAAACAACTCTGTGG + Intergenic
983346849 4:166537557-166537579 CAATTTTTTAAAAATCTCTGAGG + Intergenic
984155121 4:176187097-176187119 CAATGCAACAAATACCTCTGAGG - Intronic
987852328 5:23372514-23372536 CCATTTATCAACCACCACAGTGG - Intergenic
988987814 5:36637882-36637904 CAATTAATTAAAGAACTCTGGGG - Intronic
990257519 5:53986541-53986563 CATTTTATCAAACACTCCAGAGG + Intronic
992260402 5:74964811-74964833 CAATGTACCAAACATCTCTGGGG + Intergenic
992301488 5:75386667-75386689 CAATTTATGAAGGACCTATGGGG + Intronic
995414999 5:111900249-111900271 CAACATATCAAAAACCTATGGGG + Intronic
997130046 5:131267591-131267613 CACTTTATTAATCACATCTGAGG - Intronic
997256278 5:132430547-132430569 CAAGTTATTAAACTTCTCTGGGG - Intronic
997346735 5:133197663-133197685 CAAATTAGCAAAGACGTCTGTGG + Exonic
998439151 5:142141818-142141840 CAATTTATTAAACACCTGCCAGG - Intronic
999146647 5:149400410-149400432 GAATTTATCTCACAGCTCTGGGG - Intronic
999261256 5:150240252-150240274 CTAGTTATCAAACTCCTCAGAGG - Intronic
1000782163 5:165495768-165495790 CTATTTCTCAGACCCCTCTGAGG + Intergenic
1004734176 6:18388383-18388405 CAATGTATCTAACATTTCTGAGG + Intronic
1005144976 6:22679288-22679310 CAATTGATCATACACCTGTAGGG - Intergenic
1005194001 6:23261039-23261061 CTGATTATCAAACACTTCTGAGG - Intergenic
1006958312 6:37898622-37898644 AAAATTATAAAACACTTCTGAGG - Intronic
1008025895 6:46635534-46635556 CAAACAAACAAACACCTCTGAGG - Intronic
1008664595 6:53703668-53703690 CAATTTTTCCAACTCTTCTGGGG + Intergenic
1009197743 6:60707485-60707507 CAATGTATTAGACACCTCTGGGG + Intergenic
1009299824 6:62002941-62002963 CATTTTATCAAACCATTCTGAGG + Intronic
1011753594 6:90477186-90477208 CAGTATATAAAACACCTCTTAGG + Intergenic
1012297251 6:97540475-97540497 GAAGTTTTCAAACACCTCTTTGG - Intergenic
1013011655 6:106125979-106126001 CACTTGATCACACACCTCAGCGG - Intergenic
1013886958 6:114979327-114979349 CAATCAATCAAACAGCACTGAGG + Intergenic
1013958139 6:115864621-115864643 CAATTTATAAAAGTCCTATGAGG - Intergenic
1016024621 6:139273385-139273407 CAATTTATGAAACACCTGTAGGG - Intronic
1016206522 6:141473753-141473775 CAATTTCTCAATCCACTCTGAGG + Intergenic
1018285443 6:162232500-162232522 CAATTAATCCACCACTTCTGAGG - Intronic
1018354899 6:163002891-163002913 AGGTTTATCAAACACATCTGAGG - Intronic
1018453672 6:163932575-163932597 CAAATTATCAAACGTCTCTGTGG - Intergenic
1019030543 6:169006689-169006711 AAATTAATAAAACATCTCTGGGG - Intergenic
1022738944 7:33102972-33102994 CAATTTATAAAAGAGCACTGTGG + Intronic
1027805727 7:82819685-82819707 TAATTTAGGAAACACCTCAGTGG + Intronic
1028897820 7:96061764-96061786 CAATTTATCAAAAATCACTTTGG + Intronic
1029952404 7:104601150-104601172 CCCTTTATGAAACATCTCTGTGG - Intronic
1030634227 7:111930594-111930616 CCATTTAACAAACAATTCTGTGG + Intronic
1030906797 7:115195122-115195144 AAATTTAACAATCAGCTCTGTGG - Intergenic
1031143778 7:117974691-117974713 CCATTGTTTAAACACCTCTGTGG - Intergenic
1031310252 7:120187530-120187552 CACATTAGCAACCACCTCTGTGG + Intergenic
1031467716 7:122134015-122134037 CATTTTATCAAACATCTATTCGG + Intronic
1031537137 7:122948488-122948510 CAATTTCACAAACACTTATGTGG - Intergenic
1032342125 7:131083862-131083884 AAATGTATAAAACACATCTGAGG + Intergenic
1034674029 7:152878909-152878931 CAAGTTATCAAAAATCTCTGGGG - Intergenic
1035538668 8:413938-413960 CAAATTCTCAAACACCACTGTGG - Intronic
1035998926 8:4580117-4580139 AAATGTATTAAACACCTATGTGG + Intronic
1040754117 8:50749832-50749854 CAAATTATCCAAGAACTCTGAGG + Intronic
1043021501 8:75006786-75006808 CAACTTACCAAACAACTTTGTGG + Intronic
1043047063 8:75339504-75339526 CAATCCAGCAAAAACCTCTGAGG - Intergenic
1043991197 8:86757277-86757299 TAATTTATCTAACAATTCTGTGG + Intergenic
1044103878 8:88176890-88176912 CACTGAATCAAACATCTCTGAGG - Intronic
1044629300 8:94263187-94263209 CCATTTATTAAGTACCTCTGAGG + Intergenic
1047851477 8:128862282-128862304 CAATTTATATAACCTCTCTGAGG - Intergenic
1048629730 8:136229051-136229073 CAATCTGTCAAAGCCCTCTGTGG + Intergenic
1050811067 9:9748356-9748378 CAATTTATTAAACACTTCTATGG - Intronic
1052566371 9:30158083-30158105 AAATTTCTCAAATTCCTCTGGGG - Intergenic
1053343071 9:37355263-37355285 CAAGTTCACAACCACCTCTGTGG + Intronic
1056550624 9:87650735-87650757 GACATTATCAAACACCCCTGGGG - Intronic
1060860831 9:126953652-126953674 CAATTTATCAGACACTTATGTGG - Intronic
1186585022 X:10864040-10864062 GATTTCATCAAACACCTTTGAGG + Intergenic
1187197595 X:17102550-17102572 AAATTTATGAAACACATCGGTGG - Intronic
1187407339 X:19015784-19015806 CAATTTACCCAACATCTCTCAGG + Intronic
1187588734 X:20692596-20692618 GAATGTATTAAACACCTCCGGGG + Intergenic
1188415638 X:29930223-29930245 GAATTTTTTAAACACCACTGTGG - Intronic
1191986871 X:66991091-66991113 CAATCTCTCATACACTTCTGGGG - Intergenic
1193973029 X:88081056-88081078 CAATTAATCAAATACCTATTAGG + Intergenic
1197741216 X:129895806-129895828 CAGCTTATCAAAAACTTCTGAGG - Intergenic
1198724215 X:139659560-139659582 CCATTTATCCAACCTCTCTGGGG + Intronic
1198762800 X:140051265-140051287 AATTTTATGAAACCCCTCTGGGG + Intergenic
1198801178 X:140449163-140449185 CAATATGGTAAACACCTCTGAGG - Intergenic
1199159300 X:144589202-144589224 CAATTCATCCATAACCTCTGAGG + Intergenic
1200284059 X:154804294-154804316 TAATTTAGCAAACATTTCTGAGG + Intronic