ID: 975609017

View in Genome Browser
Species Human (GRCh38)
Location 4:76185672-76185694
Sequence CAATTTATCAAACACCTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975609017_975609019 24 Left 975609017 4:76185672-76185694 CCTCAGAGGTGTTTGATAAATTG 0: 1
1: 0
2: 2
3: 21
4: 188
Right 975609019 4:76185719-76185741 TCGTTATCTTTCAGTCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975609017 Original CRISPR CAATTTATCAAACACCTCTG AGG (reversed) Intronic