ID: 975609019 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:76185719-76185741 |
| Sequence | TCGTTATCTTTCAGTCATAT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 975609017_975609019 | 24 | Left | 975609017 | 4:76185672-76185694 | CCTCAGAGGTGTTTGATAAATTG | 0: 1 1: 0 2: 2 3: 21 4: 188 |
||
| Right | 975609019 | 4:76185719-76185741 | TCGTTATCTTTCAGTCATATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 975609019 | Original CRISPR | TCGTTATCTTTCAGTCATAT TGG | Intronic | ||