ID: 975609121

View in Genome Browser
Species Human (GRCh38)
Location 4:76186430-76186452
Sequence TAGGGTGACCACAGAGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 302}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975609115_975609121 30 Left 975609115 4:76186377-76186399 CCAGGCGAGGCTGGGGTGATGAA 0: 1
1: 0
2: 1
3: 10
4: 136
Right 975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG 0: 1
1: 0
2: 5
3: 26
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975609121 Original CRISPR TAGGGTGACCACAGAGAAGA GGG Intronic
900534859 1:3171811-3171833 CCGGGTGGCCACAGAGACGAGGG - Intronic
902193792 1:14782938-14782960 TGGGGTTACCACAGAGAAGAGGG - Intronic
902392756 1:16115862-16115884 GAGGGAGACCACAGAGATAAAGG - Intergenic
904811471 1:33165784-33165806 TAGGGTGGCCAAAGAGGAGGAGG - Intronic
905908780 1:41639647-41639669 AAGGCTGACCACAGAGAGGGAGG - Intronic
908171069 1:61505244-61505266 TGGGGTAAGCATAGAGAAGAGGG - Intergenic
908801472 1:67885034-67885056 GAGGGTGCCCACAGAGGAGATGG + Intergenic
909305073 1:74063963-74063985 TAGAGTGACCCCTGAGAATATGG - Intronic
909361060 1:74759277-74759299 TAGGGGTAACACAGAGAAGGAGG + Intronic
909623344 1:77689062-77689084 TTGGGTGACCACGGAGATGGAGG + Intergenic
910521054 1:88123019-88123041 TAAAGTTAGCACAGAGAAGATGG + Intergenic
912190876 1:107338763-107338785 GAGAATGACCACAGAGAATAGGG + Intronic
913361917 1:117990043-117990065 AAGGGTGACCACAGAGTATAGGG + Intronic
915617571 1:157051227-157051249 TAAGGTAACCACAGACAGGAAGG - Intergenic
915902911 1:159858914-159858936 TAGGGGGAGGGCAGAGAAGATGG + Intronic
916689332 1:167175538-167175560 TAGGGTGACAACATGGAGGAGGG + Intergenic
918008314 1:180562713-180562735 TGGGGTGTGCACAGAGAGGAAGG + Intergenic
918069573 1:181125043-181125065 TAAGGAGACCTCAGAGATGATGG - Intergenic
919551354 1:198992453-198992475 TAGGATGACATCAGAGAACAGGG + Intergenic
920193313 1:204209434-204209456 TAGGTTTAACACAGAGAAGGCGG - Intronic
924536161 1:244937487-244937509 TAGGGTGACCAGTGGGAAGCTGG - Intergenic
1063115212 10:3067778-3067800 TGGGGTGACCGGAGAGAAGAGGG + Intronic
1063370343 10:5517399-5517421 AGTGATGACCACAGAGAAGATGG + Intergenic
1064301846 10:14129942-14129964 GAGGGCCACCACAGGGAAGAGGG - Intronic
1065249917 10:23800439-23800461 TGGTGTGACCACTGAGAAGCTGG - Intronic
1067001464 10:42617959-42617981 TAGGGTGAGCACACACAAAAAGG - Intronic
1067717274 10:48699193-48699215 CAGGGTGACCATGGAGAAGAGGG + Intronic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1069607058 10:69745873-69745895 AAGTGAAACCACAGAGAAGAGGG - Intergenic
1069825502 10:71252916-71252938 GAGGGTTAGGACAGAGAAGAGGG + Intronic
1069828832 10:71270563-71270585 TAGGGAGCCCAGAGAGAGGAAGG + Intronic
1069890671 10:71650371-71650393 AAGGGTGATCACACAGAGGAAGG + Intronic
1071749399 10:88457736-88457758 TAGGGAGACATCAGAGGAGAGGG - Intronic
1071795522 10:89001095-89001117 TAGAGTCATCACAGTGAAGAGGG - Intronic
1073147339 10:101289532-101289554 AAGGGAGACCAATGAGAAGATGG - Intergenic
1074297397 10:112203192-112203214 TAGGGCTACCCCAGAGAAGGGGG - Intronic
1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG + Intergenic
1075514531 10:123098454-123098476 TTAGGTGACAATAGAGAAGAGGG + Intergenic
1076477478 10:130762608-130762630 TGGGGTGACCACAGACACCATGG + Intergenic
1076479759 10:130777468-130777490 TAGGGTGCACTCAGGGAAGATGG - Intergenic
1078682965 11:13497511-13497533 TAGGGTTACCATAAGGAAGAAGG + Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1079995487 11:27291132-27291154 TCGGGTGATCAGAGAAAAGAAGG + Intergenic
1081584299 11:44373768-44373790 CTGGCTGACCACAGACAAGATGG + Intergenic
1081757605 11:45555809-45555831 TAGAGGGACAAGAGAGAAGATGG + Intergenic
1082932244 11:58620495-58620517 TTGGGCAACCACAAAGAAGAGGG - Exonic
1084553925 11:69864792-69864814 GAGGGTGACCTCTGAGCAGAGGG + Intergenic
1086677188 11:89622605-89622627 AACGGTGAGCACAGAGATGATGG - Intergenic
1086960744 11:92978134-92978156 GAGGGTGAGCACAGAGGAGGGGG + Intronic
1088638330 11:111846301-111846323 TAGAGTGACCAGACAGAAAAGGG + Intronic
1088883021 11:113986537-113986559 CAGGCTGACCACATAGAAGAGGG - Exonic
1089115209 11:116089401-116089423 AAGGGTGGCTACAGAGAAGTGGG + Intergenic
1089309887 11:117551061-117551083 TAGGGTGAATCCTGAGAAGAGGG - Intronic
1089785951 11:120907287-120907309 TAGGGTGACTTCAGAGACGGCGG + Intronic
1090957218 11:131524235-131524257 TTGAGACACCACAGAGAAGAAGG - Intronic
1091707987 12:2712832-2712854 TAGGGTGACCATATAAAACATGG + Intergenic
1091824119 12:3497252-3497274 TAGAGTGAGCACAGGCAAGAAGG + Intronic
1092214928 12:6674470-6674492 TAGGGAGAACCCAAAGAAGAGGG - Intronic
1094043274 12:26140422-26140444 TAGGGTGACAGCACTGAAGATGG - Intronic
1094189319 12:27681123-27681145 TATGGTAACCAATGAGAAGAGGG - Intronic
1095050419 12:37549011-37549033 TAGAGTGACCTCAAAAAAGATGG + Intergenic
1098291951 12:68964855-68964877 TAGGCTGGCCACATGGAAGATGG - Intronic
1098758270 12:74391288-74391310 GAGCGAGACCACAGAGAAAATGG + Intergenic
1098919755 12:76292675-76292697 AAGCGTGCCCACAGTGAAGAAGG - Intergenic
1099245255 12:80186436-80186458 CAGGGAGACCAAAGAGCAGAGGG - Intergenic
1099976625 12:89552151-89552173 TAAGGAGATCACAGAGAAAAAGG + Intergenic
1103407241 12:120684930-120684952 TGGGGTGACCAAAGACACGAAGG + Intergenic
1104121621 12:125805404-125805426 TAGAGTGATAACACAGAAGAGGG + Intergenic
1104935059 12:132360093-132360115 CAGGGTGTCCCCAGAGGAGAAGG + Intergenic
1106522872 13:30513241-30513263 TGGGGTGGCCAGAGAGAAAATGG - Intronic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1108216255 13:48187689-48187711 GAGGGGGACCACAAAGAGGAAGG + Intergenic
1109368942 13:61396500-61396522 TGGGGTGCCCAAAGGGAAGAAGG + Intergenic
1110157141 13:72331169-72331191 TAAGGTGTCCATAGAGAAGGTGG + Intergenic
1112578497 13:100658503-100658525 GAAGGGGACCACAGAGAACAGGG + Intronic
1113376837 13:109772130-109772152 GAGGGTGGCCACTGAGATGACGG + Intronic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1115857051 14:37641560-37641582 TAGTCTCACCACAGTGAAGAGGG + Intronic
1117587189 14:57221511-57221533 TAGGGTGGCATCAGTGAAGATGG + Intronic
1118449845 14:65890314-65890336 TTGGGTGATCACTGAGAAGAGGG + Intergenic
1119423617 14:74522499-74522521 TGGGCTGATCTCAGAGAAGAGGG + Intronic
1119613838 14:76085362-76085384 TGGAGTGACCACAGAGCAGAGGG + Intergenic
1119923375 14:78468496-78468518 TATGCTGATCACAGAGAAGCAGG + Intronic
1121214595 14:92237636-92237658 TAAGGTGACCACTGAGAGAATGG - Intergenic
1121406749 14:93723712-93723734 TAAGGTGACCACTGAGAGAAGGG - Intronic
1124499671 15:30216389-30216411 TAGATTGAACACAAAGAAGAGGG + Intergenic
1124743908 15:32322278-32322300 TAGATTGAACACAAAGAAGAGGG - Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1127585110 15:60370971-60370993 TAGGGTGACCCCACAGAATATGG + Intronic
1128570826 15:68731558-68731580 TAGGGAGGCAACAGGGAAGAGGG + Intergenic
1129708295 15:77807039-77807061 AAGGGTGACCTCTGAGAAGCTGG - Intronic
1130288308 15:82573407-82573429 AAGGGTGAACATAGAGAAGCAGG - Intronic
1130520928 15:84660025-84660047 TAGCGTGAACACACAGAAGCTGG + Intergenic
1131166195 15:90143743-90143765 TAGGATGGGCACAGAGCAGAGGG - Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132652172 16:1026443-1026465 TCTGGTGTCCACAGCGAAGAAGG - Intergenic
1132773966 16:1581703-1581725 TAGGGAGTCTACAGAGGAGAGGG + Intronic
1132909380 16:2300622-2300644 TGTGATGGCCACAGAGAAGATGG - Intronic
1134482865 16:14633530-14633552 TAGGGTGACCGAAGCGCAGAAGG + Intronic
1134806121 16:17126880-17126902 TGGGGATACCACAGTGAAGAGGG + Intronic
1134899791 16:17927132-17927154 TGGGGTGGCACCAGAGAAGAGGG - Intergenic
1135922931 16:26667517-26667539 CAGGGTTCCCACAGAGCAGAAGG + Intergenic
1137397054 16:48123690-48123712 TTGGGTGACCCCAGGGAAAATGG - Intronic
1137634520 16:49974167-49974189 GAGGGAGGCCACAGAGAATATGG - Intergenic
1138567852 16:57846438-57846460 GAGGGTGACCTAACAGAAGAGGG + Intronic
1139490059 16:67281156-67281178 TTGGCTGAGCCCAGAGAAGAGGG - Exonic
1139838367 16:69858488-69858510 TTTGAGGACCACAGAGAAGAGGG + Intronic
1141138680 16:81483164-81483186 TAGGGTGACCAAAGAAAATCTGG + Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141296751 16:82776816-82776838 TGGGGTGAAGACAGAGAACAAGG + Intronic
1142881084 17:2883118-2883140 GAGCTTGAACACAGAGAAGATGG - Intronic
1143007858 17:3848463-3848485 TAAGGTGACCACAAAGAGCAAGG - Intergenic
1143933219 17:10453259-10453281 TAAGCTGACCAAGGAGAAGAAGG - Exonic
1143937562 17:10502845-10502867 TAAGCTGACCAAGGAGAAGAAGG - Exonic
1143939916 17:10529671-10529693 TAAGCTGACCAAGGAGAAGAAGG - Exonic
1145021999 17:19439478-19439500 TATGGGAACCACAGAAAAGAAGG + Intergenic
1146839057 17:36136879-36136901 TAGGATAACCACAGGGAAGCAGG + Intergenic
1147458213 17:40551872-40551894 TGGGGTGACCCCTGGGAAGAAGG - Intergenic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1151175570 17:72285064-72285086 GAAGGTGACCACAGTGATGAGGG + Intergenic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1151951020 17:77354043-77354065 GAGGATCTCCACAGAGAAGAAGG + Intronic
1152054342 17:78011326-78011348 TAGGGTGGGGACAGAGGAGATGG - Intronic
1153747764 18:8198020-8198042 CAGAGTGTCCACACAGAAGAAGG - Intronic
1154082091 18:11267610-11267632 TAGGTTGAGCACCTAGAAGAAGG + Intergenic
1155357132 18:24964212-24964234 AAGGCTGGCCACACAGAAGATGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156481905 18:37441630-37441652 GAGGGTGACCACAAAGCAGATGG - Intronic
1156775565 18:40784007-40784029 TAGAGAGAACACAGAGATGAGGG - Intergenic
1158014257 18:52765558-52765580 TACGGTGAGCACAAAGAAGATGG - Intronic
1162936469 19:13983996-13984018 CAGGGTCACCCCAGAGAAGGTGG - Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1164608024 19:29613804-29613826 TGGGGGAACCACAGAGAAGCAGG - Intronic
1164611132 19:29632442-29632464 GAGGGTGACCACAGAAAGGCAGG - Intergenic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1165611127 19:37154107-37154129 CAGGCTGAACACAGAGAAAAGGG + Intronic
1168171959 19:54595280-54595302 CACGGGGCCCACAGAGAAGATGG - Exonic
1168708192 19:58481493-58481515 AAGGGGGACCTCTGAGAAGAGGG + Intronic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926864422 2:17342298-17342320 TAGGATGACAACAGAGGAAAGGG + Intergenic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927925814 2:27012878-27012900 TATGGTGAGAGCAGAGAAGAGGG + Intronic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
928255225 2:29716501-29716523 TAGAATGAGCACAGAGAAGGAGG + Intronic
929080843 2:38120683-38120705 AAGGGGTACCACAGAGAATAGGG + Intergenic
929608206 2:43249825-43249847 TATGGTCACCACAGAGATGCTGG - Intronic
929930995 2:46255367-46255389 AAGAGAGGCCACAGAGAAGAAGG - Intergenic
930983088 2:57551440-57551462 TAGGCTAACCACAGAGAAGATGG - Intergenic
931893211 2:66698698-66698720 CAGTCTGACCAAAGAGAAGAAGG - Intergenic
934776290 2:96939701-96939723 CTGGCTGACCACAGAGGAGATGG + Intronic
935827234 2:106963946-106963968 TTGGTTGCCCACAGAGGAGAGGG + Intergenic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936659248 2:114523831-114523853 TAGGGTGAGTAGAGAGAAAAGGG - Intronic
937481001 2:122259202-122259224 CATGGAGACCACACAGAAGATGG + Intergenic
938341120 2:130537391-130537413 GAGGGTGGCCCCAGAGCAGAGGG + Intergenic
938348710 2:130583318-130583340 GAGGGTGGCCCCAGAGCAGAGGG - Intronic
938370194 2:130763683-130763705 TAGGGCACCCACAGAGAAGCTGG + Exonic
939215139 2:139227571-139227593 CAGTGTTACCACAGAAAAGAGGG - Intergenic
939591378 2:144067648-144067670 TAGGGTACCGCCAGAGAAGAAGG + Intronic
940833387 2:158493459-158493481 TAGGGTAACCACATGGAAAATGG - Intronic
941775182 2:169385761-169385783 TTGGGTGACCACAGAGAACAGGG + Intergenic
942528252 2:176879586-176879608 TAGGGTGAGCAGAGAGGAGCAGG + Intergenic
944713531 2:202357263-202357285 TATGGTGACCACCTAGAAGCAGG - Intergenic
945014162 2:205497634-205497656 TAGGAGGATCAAAGAGAAGAGGG - Intronic
945924254 2:215787749-215787771 CAGGCTGGCCACGGAGAAGATGG + Intergenic
948355284 2:237372732-237372754 TAGGGTGGGCTCAGAGAGGATGG + Intronic
948822818 2:240558432-240558454 AAGAGTCACCGCAGAGAAGAGGG + Intronic
949077016 2:242066561-242066583 TGCAGTGACCTCAGAGAAGATGG - Intergenic
1169038986 20:2477129-2477151 TATGGTAAACACAGATAAGAGGG + Intronic
1169450448 20:5706330-5706352 AAGGCAGACCACAGAGGAGAGGG - Intergenic
1169492662 20:6084202-6084224 CAGGGTGATCACAGAGCAGCCGG - Intronic
1169834928 20:9867554-9867576 TCAGGTGTCCTCAGAGAAGAAGG - Intergenic
1170124797 20:12950654-12950676 TAGGGTGAACACAGCAGAGATGG - Intergenic
1170381509 20:15764900-15764922 TAGAGTGAGCAGAGAGCAGAAGG - Intronic
1170948883 20:20916236-20916258 AAGGGTGACATCAGAGAAAATGG + Intergenic
1172173847 20:32960701-32960723 TAAGGGGACCACAGGGAGGAGGG - Intronic
1172224836 20:33298467-33298489 AAGGGCGACCAGAGAGGAGAAGG + Intronic
1173863705 20:46300566-46300588 TACGGTGACAACAAAGAATATGG + Intronic
1175219063 20:57406585-57406607 GGCGGTGACCACAGAGATGATGG - Intronic
1175482536 20:59321650-59321672 GAGGGTGGCCAAAGAGAAGGGGG - Intronic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1176968435 21:15237914-15237936 AAGGGTGACCCTAGAGAAGAGGG + Intergenic
1179993503 21:44960709-44960731 AAGGCTGACCTCAGAAAAGAGGG - Intronic
1180109116 21:45639756-45639778 TAGAATGAACACAGAGAGGATGG - Intergenic
1181063787 22:20295749-20295771 GAGGGTGACATCAGAGAAGGTGG - Intergenic
1181338475 22:22159628-22159650 TAAGGAGGTCACAGAGAAGAAGG - Intergenic
1181768445 22:25109037-25109059 CAGTATGACCTCAGAGAAGAAGG + Intronic
1182253095 22:29017550-29017572 AAGAGGGACCACAGAGAAGCTGG + Intronic
1182314259 22:29433420-29433442 TATAGTGACCACAGAGCAGATGG - Intergenic
1183253477 22:36745955-36745977 AAGGGTGAGGACAGAGAAGGGGG + Intergenic
1185172241 22:49300996-49301018 GACGGTGACCTCACAGAAGAGGG + Intergenic
949342435 3:3044527-3044549 TATGGTGACCTCAGAGTAGTCGG + Intronic
951497597 3:23348393-23348415 TAGGGTTACCACCTAGAACAGGG + Intronic
952525979 3:34211015-34211037 TAGAGTGAGTACAGAAAAGATGG - Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
953064119 3:39453748-39453770 CAGGGAGAAAACAGAGAAGATGG + Intergenic
953240474 3:41144296-41144318 TAGGGAGCCCAGAGACAAGACGG - Intergenic
953301641 3:41783050-41783072 TAGCATGACAGCAGAGAAGAGGG + Intronic
955352366 3:58203265-58203287 TAGGGGGACCAAAAAGAGGATGG - Intronic
958711567 3:97723169-97723191 TAGGATGTCCACAGAGCAGAAGG + Intronic
958966149 3:100561033-100561055 TAGGCTGACCACCAGGAAGAAGG - Intronic
965479623 3:169201903-169201925 GTGGGTGACCACATAGAAGAAGG - Intronic
965844775 3:172948280-172948302 TAAGGTTTCCACAGAGAAGTCGG - Intronic
969528848 4:7718424-7718446 TAGGGTCCCCGCAGAGCAGAAGG + Intronic
970780235 4:19729190-19729212 TATGGTGGCAACAGAGAAAAAGG - Intergenic
972644790 4:40957024-40957046 TTGTGTGACCTCAGAGAAAATGG + Intronic
973220738 4:47723277-47723299 CAGGGAGATCACAGAGAAGAGGG + Intronic
974330805 4:60475783-60475805 TAGGGTGACCATTGAGAGGGAGG + Intergenic
975520039 4:75290663-75290685 TGGGGTGAGCACAGAGAAAACGG + Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
977478985 4:97549682-97549704 AAGGGCAACTACAGAGAAGAAGG + Intronic
977618056 4:99107043-99107065 TAGGATGACAACAGAGGAAAGGG - Intergenic
977736935 4:100428002-100428024 CAGGGTGATCACAGAGTAGATGG - Intronic
977944930 4:102901752-102901774 TAGGGAGAACAATGAGAAGAAGG - Intronic
978685328 4:111435545-111435567 TAGTGTGGCCACAGTGAAAATGG - Intergenic
981105567 4:140876673-140876695 GAGGGTGAGCACATAGAAGATGG + Intronic
981855550 4:149286417-149286439 TAGGGCGATCACAGAGAGGAAGG + Intergenic
983060076 4:163149871-163149893 TTGGGGGACTGCAGAGAAGAGGG + Intronic
983346423 4:166531832-166531854 TAGGGAGACGACACAGAAGACGG - Intergenic
985306334 4:188545289-188545311 TAGAGATACCACAGAGAACAAGG - Intergenic
985992074 5:3570990-3571012 AAAGGTGAATACAGAGAAGAAGG - Intergenic
986242817 5:5976641-5976663 CAGGGTGATCTCAGAGGAGAAGG + Intergenic
986703913 5:10439826-10439848 CAGGGTGAACACAGAGGTGATGG - Exonic
988362006 5:30248339-30248361 TACGGTGACCACAAAGGAGCTGG - Intergenic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
988792346 5:34620207-34620229 GAAGGTGAGCACAGAGAAGAGGG + Intergenic
989563357 5:42875908-42875930 TCCGGGGGCCACAGAGAAGAAGG + Intronic
990749753 5:59001558-59001580 TAGGGAGACCAGAGAAAAGGAGG - Intronic
990878203 5:60510437-60510459 TAGGGAGACTATAGATAAGATGG + Intronic
992103411 5:73429342-73429364 TAAGGAGACCAGAGAGAAAAAGG + Intergenic
992167872 5:74072917-74072939 TAAGTTTACCAGAGAGAAGAAGG - Intergenic
992726972 5:79616909-79616931 TAGGTTGGCCACAGATAACAAGG - Intronic
992872561 5:81021792-81021814 TAGGGTGGCCAATGAGGAGATGG + Intronic
992986169 5:82232634-82232656 TAGGGTGAAGACAGTAAAGATGG - Intronic
993494166 5:88588332-88588354 TAGGGTTTCCACTGAGAAGTCGG - Intergenic
994094397 5:95835845-95835867 GGGGCTGACCTCAGAGAAGAGGG + Intergenic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
997392877 5:133531339-133531361 CAAGGTGACCACAGAGATTAGGG - Intronic
998329755 5:141314442-141314464 TAGGGTTACCAGAGAAAATAAGG + Intergenic
999247592 5:150163513-150163535 TAAGGGGACCACAGAGCAGCTGG + Intergenic
999390272 5:151184507-151184529 TTCAGTGACCACAGATAAGAGGG - Intronic
1000523537 5:162327736-162327758 TGGTGTGATCACAGAGAGGAAGG + Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001193108 5:169648630-169648652 TGGGGTGAACACAGCAAAGAAGG - Intronic
1001412767 5:171522518-171522540 TTGGGTGACCACTTAGAAGGTGG + Intergenic
1002166074 5:177347241-177347263 GAGGCTGACCTCAGAGCAGAAGG + Intronic
1002438675 5:179251751-179251773 GAAGCTGGCCACAGAGAAGATGG + Intronic
1002843104 6:922845-922867 CAGGGTGAACCCAGAGAAGCAGG - Intergenic
1004603956 6:17176501-17176523 TAGGGTGAGCTCAGAGCAGCTGG + Intergenic
1005500598 6:26425989-26426011 TAGGTGGACCACAAAGAAAAGGG + Intergenic
1008330608 6:50240439-50240461 AAGGGTGAGCAAAGCGAAGAGGG + Intergenic
1008568370 6:52791276-52791298 TAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1009918217 6:70023624-70023646 TAGGGTGAACAAGGAGAAAAAGG + Exonic
1010893455 6:81340409-81340431 TAGGATGACAACAGAGGAAAGGG + Intergenic
1011200785 6:84833663-84833685 TTTGGTGACTACTGAGAAGAAGG - Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1012117288 6:95318295-95318317 ATGGGAGCCCACAGAGAAGAAGG + Intergenic
1012419629 6:99049798-99049820 TAGCCTAACCACCGAGAAGAAGG + Intergenic
1013328077 6:109068197-109068219 TGGGGTGACTAAAGAGAAAAAGG - Intronic
1015592180 6:134832809-134832831 TAGGTTGAGGACAGGGAAGATGG - Intergenic
1015722715 6:136261458-136261480 TAGCATGACGACAGAGATGATGG - Exonic
1015816743 6:137219141-137219163 TAGGGCGACCTCGGAGAAGCGGG + Intronic
1016184920 6:141186436-141186458 CAGGGTGACTACAGATAAAAAGG + Intergenic
1016752177 6:147642905-147642927 TGGGGTGACAACAGTGCAGATGG - Intronic
1017206720 6:151809831-151809853 TAGGGTTAAAACAGAGAAAAAGG + Intronic
1017248429 6:152253182-152253204 TAGGGTGATCTCAGGGAAGATGG - Intronic
1018182963 6:161240646-161240668 TGCGGTGCCCACAGAGGAGAGGG + Intronic
1019274193 7:167252-167274 GAGGGTGTCCGCTGAGAAGAGGG + Intergenic
1019487466 7:1295975-1295997 TGAACTGACCACAGAGAAGATGG - Intergenic
1020244737 7:6421672-6421694 AATGCTGACCACACAGAAGATGG - Intronic
1021806854 7:24366098-24366120 CAGGGTGAACTCAGAGAAGTAGG - Intergenic
1021905577 7:25329925-25329947 CATGGTGACCTCAGAGAAGGTGG + Intergenic
1022190263 7:28010545-28010567 GAGGATGACCACAGAAAAGCAGG - Intronic
1022687275 7:32608731-32608753 TAGAGGGACAACAGAGAGGAAGG + Intergenic
1023170500 7:37386343-37386365 TAGGGAGACCACAGAGAAAAGGG + Intronic
1023817205 7:43960235-43960257 TATGTTCACCAAAGAGAAGACGG + Intergenic
1026541142 7:71280912-71280934 TGGGGTTCACACAGAGAAGAGGG + Intronic
1026766073 7:73160680-73160702 CAGGGTTACCACAGAGGACAAGG - Intergenic
1026937277 7:74265166-74265188 TGGGCTGACCCCAGAGACGATGG + Intergenic
1027042548 7:74970376-74970398 CAGGGTTACCACAGAGGACAAGG - Intronic
1027081095 7:75231981-75232003 CAGGGTTACCACAGAGGACAAGG + Intergenic
1027443447 7:78245577-78245599 TAGGATGGCCCCAGAGAGGATGG + Intronic
1029363606 7:100103538-100103560 GAGGGTGAGGAAAGAGAAGAGGG + Intronic
1030084015 7:105802090-105802112 GAGGATGACCACAGAGCACAAGG - Intronic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1030954379 7:115833955-115833977 TAGGGTGACAAGAGTGAAAAAGG + Intergenic
1030989717 7:116285690-116285712 TATGGTGACCATAGTAAAGAAGG + Intergenic
1031325655 7:120394159-120394181 AAGGCTGGCCACATAGAAGATGG + Intronic
1031513771 7:122678418-122678440 AAGGCTGGCCACACAGAAGATGG + Intronic
1032084623 7:128877430-128877452 GAGGCTCAGCACAGAGAAGAAGG - Intronic
1034764312 7:153703677-153703699 TAGGGCCACCACATAGGAGATGG + Intergenic
1035073758 7:156163630-156163652 TAGGAAGCCCACAGAGAAGGAGG + Intergenic
1035468171 7:159093305-159093327 AAGGATGACCTCTGAGAAGATGG - Intronic
1035535568 8:388445-388467 TGCAGTGACCTCAGAGAAGATGG - Intergenic
1035572766 8:684549-684571 CAGTGGTACCACAGAGAAGAGGG + Intronic
1038692603 8:29776409-29776431 TAGGGAGATGCCAGAGAAGAGGG - Intergenic
1040944946 8:52874378-52874400 AAGGGTGGCCTCAGAGAAGGAGG - Intergenic
1041469336 8:58191358-58191380 AAGAGGGAACACAGAGAAGATGG + Intronic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1047546836 8:125826310-125826332 AGGGGCAACCACAGAGAAGACGG + Intergenic
1048019405 8:130524680-130524702 TACGGTAACCACAGGGAAGGAGG + Intergenic
1048184208 8:132224482-132224504 TAGGGTGACCAGTGAGAATTAGG - Intronic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049775152 8:144400629-144400651 TAGGGGGCCCACAGTGCAGAGGG + Intronic
1050073190 9:1838051-1838073 TAGGGCGAACAGAGAGAACACGG - Intergenic
1050365749 9:4872219-4872241 TAGGGTTAGAAGAGAGAAGAGGG + Intronic
1050930655 9:11320176-11320198 TATTGTGACTACAGAGAAAAGGG + Intergenic
1052278010 9:26700744-26700766 TGGAGAGGCCACAGAGAAGAGGG + Intergenic
1053163665 9:35829805-35829827 TTGGGTAAACACAGAGATGAGGG - Exonic
1054760878 9:69003028-69003050 TCGGGTGAACCCAGAGATGAAGG + Intronic
1057846175 9:98526407-98526429 TAAGGAGACCTGAGAGAAGAGGG - Intronic
1057857365 9:98611760-98611782 TAGTGTGACCACAGCCACGAGGG - Intronic
1058781050 9:108335947-108335969 TTGGGTGCCCACAGAAAGGAGGG - Intergenic
1059304491 9:113343150-113343172 TAGGGCTAGCACAGAGTAGATGG + Intergenic
1059448988 9:114358148-114358170 CAGGGAGGCCACGGAGAAGATGG - Exonic
1059768052 9:117402535-117402557 TAGTGTGATCCCAGACAAGAAGG + Intronic
1059784008 9:117560867-117560889 TAGTGAGACTGCAGAGAAGAGGG + Intergenic
1060362096 9:122968940-122968962 TAGGGTGACTACAGTAAAAATGG - Intronic
1061196882 9:129111428-129111450 TAAAGTCACCACAGCGAAGACGG - Exonic
1062107440 9:134763690-134763712 CAGGGTGACGACGGAGAAGTTGG + Exonic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1187344798 X:18453152-18453174 TTGTGTGACCAAAAAGAAGAGGG - Intronic
1192051121 X:67724835-67724857 AAGTCTGACCACTGAGAAGAAGG + Exonic
1192601311 X:72467440-72467462 TAGGGTGACGATAGGGAAGTTGG + Intronic
1195379621 X:104257878-104257900 TATGGAGCCCAAAGAGAAGAAGG - Intergenic
1195469842 X:105219470-105219492 CATGGAGACCACAGAGAAGCTGG - Exonic
1196686511 X:118514808-118514830 TATGGTGGCCATGGAGAAGATGG - Intronic
1199722698 X:150553575-150553597 TAGGGTGACCACAGAACACATGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200985357 Y:9297420-9297442 TAGGGTCACTACATAGAAAATGG + Intergenic
1202125172 Y:21563331-21563353 TAGGGTCACTACATAGAAAATGG - Intergenic
1202153836 Y:21866061-21866083 TAGGGTCACTACATAGAAAATGG + Intergenic