ID: 975609139

View in Genome Browser
Species Human (GRCh38)
Location 4:76186544-76186566
Sequence GTATCCTGCTTTGTATCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975609139_975609142 1 Left 975609139 4:76186544-76186566 CCTGTAGATACAAAGCAGGATAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 975609142 4:76186568-76186590 GAGAAGAAGTGGTAAGAGCAGGG 0: 1
1: 0
2: 4
3: 53
4: 450
975609139_975609143 5 Left 975609139 4:76186544-76186566 CCTGTAGATACAAAGCAGGATAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 975609143 4:76186572-76186594 AGAAGTGGTAAGAGCAGGGTCGG 0: 1
1: 0
2: 5
3: 37
4: 342
975609139_975609141 0 Left 975609139 4:76186544-76186566 CCTGTAGATACAAAGCAGGATAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 975609141 4:76186567-76186589 TGAGAAGAAGTGGTAAGAGCAGG 0: 1
1: 0
2: 16
3: 205
4: 1917
975609139_975609144 6 Left 975609139 4:76186544-76186566 CCTGTAGATACAAAGCAGGATAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 975609144 4:76186573-76186595 GAAGTGGTAAGAGCAGGGTCGGG 0: 1
1: 0
2: 3
3: 31
4: 362
975609139_975609140 -10 Left 975609139 4:76186544-76186566 CCTGTAGATACAAAGCAGGATAC 0: 1
1: 0
2: 0
3: 6
4: 100
Right 975609140 4:76186557-76186579 AGCAGGATACTGAGAAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975609139 Original CRISPR GTATCCTGCTTTGTATCTAC AGG (reversed) Intronic
903451508 1:23456696-23456718 GTACCCTGCTTTGTATCTTAAGG - Intronic
906682801 1:47742058-47742080 GTTTCCTTCTTTGTGTCCACGGG - Intergenic
917662699 1:177193096-177193118 GGATCCAGTTTTGTGTCTACAGG + Intronic
920677516 1:208048467-208048489 GTGACCTGCCTGGTATCTACAGG - Intronic
922740096 1:228009705-228009727 GTTTCCTGGTTTGTTTCTCCAGG - Intronic
1065529049 10:26650468-26650490 GTAAACTGCTTTGTATTTTCAGG + Intergenic
1075842321 10:125515647-125515669 CCATCCTGCTTTGTCTCTAGCGG + Intergenic
1079646116 11:22865339-22865361 GTATCCTGTTTTATATATAAAGG - Intergenic
1079854024 11:25577588-25577610 GTATTCTGCTCGGTATCTGCAGG + Intergenic
1079922026 11:26444711-26444733 GTATCTTGGTTTTTCTCTACAGG + Intronic
1092864708 12:12750053-12750075 TTATTATGCTTTGTCTCTACCGG - Intronic
1093736796 12:22629802-22629824 GACTCCTTATTTGTATCTACAGG - Intronic
1098097094 12:66970041-66970063 GACGCTTGCTTTGTATCTACAGG + Intergenic
1100034600 12:90235515-90235537 GTATCCTTCTTTGTAATTAAAGG + Intergenic
1103954795 12:124569875-124569897 GTTTGCTACTTTGTTTCTACTGG + Intergenic
1104471213 12:129031433-129031455 GTATCCTCCTTTGGATCTGGGGG + Intergenic
1105487941 13:20856065-20856087 GTATAGTGCTTAGTATGTACTGG - Intronic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1106928545 13:34638586-34638608 GTATTCTGCTTTAAATCAACAGG + Intergenic
1112342970 13:98567608-98567630 GTATACTGCTGTTTATTTACAGG + Intronic
1122495335 14:102150072-102150094 TTATCTTGCTTTGTATCAATAGG + Intronic
1128378323 15:67092996-67093018 GTAGCCTGCTTTGAGTCAACAGG + Intronic
1128407029 15:67352784-67352806 TTATCCTGCTTTGTATTTATTGG + Intronic
1128407960 15:67363046-67363068 GAATCTTGTTTTGTATCTCCAGG - Intronic
1131337301 15:91561625-91561647 GAATCCTGCTTTGTTTCTCGTGG - Intergenic
1135085565 16:19472166-19472188 GTAGCCTGGGTTGTCTCTACAGG + Exonic
1137977636 16:53044535-53044557 GTAGCCTGCCTTGTATCTCAGGG + Intergenic
1140424271 16:74847893-74847915 GTATCGTGATTTTTATCTCCTGG - Intergenic
1146850289 17:36215832-36215854 GTGTCCTGCTTTGTCTGTTCTGG - Intronic
1153724638 18:7942498-7942520 GTATCCTGCCCTGTATCTGGAGG - Intronic
1156644654 18:39146477-39146499 GTATCCATCCCTGTATCTACAGG + Intergenic
1156689540 18:39691408-39691430 ACATTCTGCTTTGTATCTAATGG - Intergenic
1156703731 18:39855355-39855377 GTTTCCTGCTTTGTATTCAATGG - Intergenic
1157111902 18:44828634-44828656 GACTTGTGCTTTGTATCTACAGG + Intronic
1158105247 18:53878254-53878276 GTATACTGCTTTGTGTCCCCAGG + Intergenic
1158826139 18:61222301-61222323 GTGTCATGATTTGTAACTACTGG + Intergenic
1167627271 19:50600155-50600177 GTTTCCTGCTTTGTCTCTTATGG + Intergenic
925090358 2:1150293-1150315 GCATCTTACTTTGTATCTATTGG + Intronic
926172442 2:10560801-10560823 GTGGCCTGCATTGTGTCTACTGG + Intergenic
926197135 2:10770854-10770876 GTATTCTGCTTTATATCTTTAGG - Intronic
930189945 2:48447237-48447259 GGATCCTACTTTTTACCTACTGG - Intronic
934731440 2:96661197-96661219 GCATCCTGCTTTCTATCCAGTGG - Intergenic
938565611 2:132515752-132515774 GTATCCTGCTATATACCTAGAGG + Intronic
940302430 2:152189174-152189196 GTATTTTGCTTTGTACCCACTGG + Intergenic
942696269 2:178650148-178650170 GGATTCTGCTTTGTACCTGCTGG + Exonic
943901168 2:193438967-193438989 GTAACCTGCTAAGTATTTACAGG - Intergenic
946625195 2:221604135-221604157 GCAGCCTGCTTTGTATTTTCTGG - Intergenic
948695476 2:239731154-239731176 CTCTCCTGCTTTGTTTCTGCTGG + Intergenic
1170085970 20:12531937-12531959 GTATCTTTCTTTGTAACTAGAGG - Intergenic
1170921502 20:20683740-20683762 GTATCCTGCTTATCATCTTCAGG - Intronic
1173823612 20:46033572-46033594 GTATCCTGATTCGTATATCCAGG + Intronic
1176702321 21:10070282-10070304 GTCTCCAGCTTTGTAACTTCTGG + Intergenic
953306555 3:41836030-41836052 GTATCCTGCTTTTTACATATAGG - Intronic
955540196 3:59967717-59967739 GTAGCATTCTTTGGATCTACTGG - Intronic
955756668 3:62231560-62231582 GTTTCCGGGTTTGTATGTACTGG + Intronic
957970089 3:87372796-87372818 GTAACCTGCACTGTTTCTACTGG + Intergenic
959153569 3:102638283-102638305 GTTTCCTGCTTTTTATCATCTGG - Intergenic
960028852 3:113038047-113038069 GTGTCCTGCTCTGTATCTAGAGG + Intergenic
965548711 3:169941790-169941812 GTATCTTTCTTTTAATCTACAGG - Intergenic
973046375 4:45538446-45538468 CTCTCCTACTCTGTATCTACAGG + Intergenic
974534941 4:63162733-63162755 GTATCCTGCTTTATTTCAACAGG + Intergenic
975539101 4:75486029-75486051 TGATTCTGCTTTGTAGCTACAGG - Intronic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
978434043 4:108664256-108664278 GTATCCTTCCTTGTAACTAGTGG - Intronic
979430907 4:120629197-120629219 GTCTGCTACTTTGTATCTTCTGG - Intergenic
980374495 4:131926697-131926719 GTCTCCAGCTTTGTAACTTCTGG + Intergenic
981953481 4:150441239-150441261 TTATCCTGCTTTGTCTTTAGAGG - Intronic
983202808 4:164880669-164880691 GTATCTTTCTTTGTATATGCAGG - Intronic
984068153 4:175076030-175076052 ATGTACTGGTTTGTATCTACTGG + Intergenic
987628517 5:20435289-20435311 TTGTCCTCCTTTGTATCTTCAGG + Intronic
990246756 5:53870846-53870868 CTATCCTGCCTTGTGTCCACTGG + Intergenic
990271679 5:54148259-54148281 GTATCCTGCTAGTTATCTTCGGG - Intronic
992245235 5:74814618-74814640 GTATTTAGCATTGTATCTACAGG - Intronic
1004158566 6:13192876-13192898 GTATCCTGCTATGAAGATACAGG - Intronic
1006249306 6:32767098-32767120 GTTTCCTGATCTGTTTCTACAGG + Intergenic
1007262904 6:40576226-40576248 TTATGCTGCTTTGTATTTATTGG - Intronic
1008499186 6:52163571-52163593 GTGTCCTGCCCTGTATCTGCAGG - Intergenic
1008969728 6:57353211-57353233 TTACAGTGCTTTGTATCTACAGG - Intronic
1009158694 6:60255036-60255058 TTACAGTGCTTTGTATCTACAGG - Intergenic
1010331267 6:74626577-74626599 GCATCCAGCTCTGTAGCTACAGG + Intergenic
1015819288 6:137243674-137243696 ATATCCTACTTCTTATCTACAGG + Intergenic
1016847637 6:148584520-148584542 GAATCCTTCTTTGTACCTCCTGG + Intergenic
1017560176 6:155618636-155618658 GTTTCCTACTTTGTATGTAAAGG + Intergenic
1021100008 7:16576954-16576976 GTGTCCTGCCTTGTCTGTACTGG - Intronic
1023164594 7:37331007-37331029 TTATCCTGCTTTGTCCCTCCAGG - Intronic
1023425101 7:40027719-40027741 GAAGCCTGCTCTGTTTCTACGGG + Intronic
1030244216 7:107363239-107363261 GAATCCTGCTTTGTTTTTATTGG - Intronic
1031528778 7:122851982-122852004 GTTTCCTGGTTTGTATATAGGGG - Intronic
1032876942 7:136047911-136047933 GTATGCTGCTTTGAATTAACAGG - Intergenic
1033313008 7:140276171-140276193 GTTTCCTGCTTTGTAGTTAGAGG - Intergenic
1033460988 7:141547327-141547349 GTCACCTGCTTTGTAGTTACAGG + Intergenic
1036061172 8:5322877-5322899 TTATCATGCTTTTTCTCTACTGG + Intergenic
1038210568 8:25515744-25515766 GTTCCCTGCTTTGGATCTGCGGG + Intergenic
1039322015 8:36442616-36442638 TTATCCTGCTTGGGATATACTGG + Intergenic
1041392730 8:57361079-57361101 ATTTCCTGCCTTCTATCTACGGG - Intergenic
1043818711 8:84836739-84836761 GTATCCTTAGGTGTATCTACAGG - Intronic
1045571407 8:103371945-103371967 GTGTCATGCTTTTTATTTACAGG + Intronic
1047213593 8:122859185-122859207 GCATGCTGCTTAGTATCTCCTGG + Intronic
1050597104 9:7214993-7215015 GTGTCATGCATTGTATCCACTGG + Intergenic
1053639469 9:40056678-40056700 GTCTCCAGCTTTGTAACTTCTGG + Intergenic
1053766610 9:41408431-41408453 GTCTCCAGCTTTGTAACTTCTGG - Intergenic
1054545279 9:66319941-66319963 GTCTCCAGCTTTGTAACTTCTGG - Intergenic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1061520560 9:131115029-131115051 GCATCCTGCTGTGCAGCTACTGG + Intronic
1202787340 9_KI270719v1_random:40374-40396 GTCTCCAGCTTTGTAACTTCTGG + Intergenic
1189582374 X:42420471-42420493 GTATCCTGCCATGTATCCCCGGG + Intergenic
1199935352 X:152568061-152568083 GTATCCTAACTTGTATCTGCAGG - Intergenic