ID: 975609527

View in Genome Browser
Species Human (GRCh38)
Location 4:76190336-76190358
Sequence CAGGGAGAGTATCCGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975609524_975609527 9 Left 975609524 4:76190304-76190326 CCAGTCTACTTGACATTTTAAAT 0: 1
1: 0
2: 2
3: 46
4: 599
Right 975609527 4:76190336-76190358 CAGGGAGAGTATCCGAAGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 244
975609523_975609527 10 Left 975609523 4:76190303-76190325 CCCAGTCTACTTGACATTTTAAA 0: 1
1: 0
2: 3
3: 53
4: 559
Right 975609527 4:76190336-76190358 CAGGGAGAGTATCCGAAGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 244
975609521_975609527 18 Left 975609521 4:76190295-76190317 CCACCGTGCCCAGTCTACTTGAC 0: 1
1: 0
2: 10
3: 149
4: 1156
Right 975609527 4:76190336-76190358 CAGGGAGAGTATCCGAAGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 244
975609522_975609527 15 Left 975609522 4:76190298-76190320 CCGTGCCCAGTCTACTTGACATT 0: 1
1: 0
2: 4
3: 44
4: 429
Right 975609527 4:76190336-76190358 CAGGGAGAGTATCCGAAGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975609527 Original CRISPR CAGGGAGAGTATCCGAAGTC AGG Intronic
901962987 1:12842003-12842025 CAGGTGGATTATCCGAGGTCAGG + Intergenic
902278010 1:15353303-15353325 GAGGGACAGGATCCGAAGCCTGG + Intronic
902316278 1:15621611-15621633 CAGGCAGATCATCCGAGGTCAGG - Intronic
902534813 1:17113541-17113563 CTGGGAGAGAATTCAAAGTCTGG + Intronic
902705128 1:18199225-18199247 CAGGGACAGTATTTGAACTCAGG - Intronic
904308080 1:29603308-29603330 CAGGGACATTCTCCCAAGTCAGG - Intergenic
905055149 1:35087217-35087239 CAGGCAGATTACCTGAAGTCAGG - Intronic
907330566 1:53668586-53668608 CAGGCAGATTATCTGAGGTCAGG - Intronic
908263413 1:62356055-62356077 CAGGGAGATCATCTGAGGTCAGG + Intergenic
909022808 1:70450810-70450832 CAGGCAGATCATCTGAAGTCAGG - Intergenic
910184521 1:84523130-84523152 CAGGGAGATCACCTGAAGTCAGG - Intergenic
913496291 1:119431193-119431215 CAGGAAGATTTGCCGAAGTCAGG - Intergenic
915119764 1:153622140-153622162 CAGGCAGATCATCTGAAGTCAGG + Intronic
915409822 1:155691853-155691875 CCCGTAGGGTATCCGAAGTCCGG + Intronic
917335637 1:173921948-173921970 CAGGCGGATCATCCGAAGTCAGG - Intergenic
917474058 1:175353085-175353107 CAGGGAGAGAATTCAAAGTCGGG + Intronic
918334590 1:183496002-183496024 CAGGCACAGTATCAGAATTCTGG - Intronic
919661999 1:200256446-200256468 CAGGCAGATTACCTGAAGTCAGG - Intergenic
920006926 1:202840097-202840119 CAGGCAGATTATCAGAGGTCAGG - Intergenic
921849488 1:219919546-219919568 CAGGTAGATCATCTGAAGTCAGG + Intronic
924793953 1:247278679-247278701 CAGGTAGATTATCTGAGGTCAGG + Intergenic
1064190671 10:13203070-13203092 CAGGCAGATCATCTGAAGTCAGG - Intronic
1064286325 10:13994547-13994569 CAGGCAGATGATCTGAAGTCAGG - Intronic
1064986496 10:21216024-21216046 CAGGGTCAGTATCCTAAGACAGG + Intergenic
1067546199 10:47194340-47194362 CAGGCAGATTACCTGAAGTCAGG - Intergenic
1068016747 10:51526045-51526067 CAGGTAGATCATCTGAAGTCAGG - Intronic
1072653069 10:97310534-97310556 CAGGCAGATAATCTGAAGTCAGG + Intergenic
1075072898 10:119330791-119330813 CAGGCAGATTACCTGAAGTCAGG + Intronic
1075507924 10:123042191-123042213 CAGGCAGATCATCCGACGTCAGG - Intronic
1075544256 10:123342623-123342645 CCTGGAGAGTCCCCGAAGTCAGG + Intergenic
1075921553 10:126217592-126217614 CAGGCAGATTATCTGAGGTCAGG - Intronic
1076468634 10:130703084-130703106 CAGGGACAGCATCTGAAGTCTGG - Intergenic
1076498012 10:130911491-130911513 CAGGTGGATTATCCGAGGTCAGG - Intergenic
1079030922 11:16986153-16986175 CAGGAAGAGAAGCCCAAGTCAGG + Intronic
1081293751 11:41359953-41359975 CAGGCAGATCATCCGCAGTCAGG + Intronic
1081455955 11:43223082-43223104 CAGGCCGATTGTCCGAAGTCAGG - Intergenic
1081675073 11:44963907-44963929 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1081816285 11:45944988-45945010 CAGGCAGATCATCTGAAGTCAGG - Intronic
1082929967 11:58592312-58592334 CAGGGAGATCATCTGAGGTCAGG - Intronic
1083809250 11:65094192-65094214 CAGGCAGATTACCCGAGGTCAGG - Intronic
1083883776 11:65560814-65560836 CAGGGAGAGGAGGCGGAGTCAGG + Intergenic
1083883782 11:65560837-65560859 CAGGGAGAGGAGGCGGAGTCAGG + Intergenic
1084158292 11:67328458-67328480 CAGGTGGATTATCTGAAGTCAGG - Intronic
1084998617 11:73008456-73008478 AAGGGAGAATATCCTAAGCCTGG + Intronic
1087731605 11:101784442-101784464 CAGGCAGATTATCTGAGGTCAGG - Intronic
1090362529 11:126183512-126183534 CAGGCAGATTACCTGAAGTCAGG - Intergenic
1090599810 11:128358553-128358575 CAGGGAGAGGATGGCAAGTCAGG - Intergenic
1092346323 12:7718069-7718091 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1092887072 12:12934253-12934275 CAGGCAGATTATCTGAACTCTGG - Intergenic
1093224809 12:16469414-16469436 CAGGCAGATCATCTGAAGTCAGG - Intronic
1094589899 12:31810276-31810298 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1095963219 12:47848792-47848814 CAGGCAGATTATCTGAGGTCAGG - Intronic
1096440117 12:51634875-51634897 CAGGCAGATTATCTGAGGTCAGG - Intronic
1096444899 12:51680772-51680794 CAGGCGGATCATCCGAAGTCAGG + Intronic
1097094588 12:56536253-56536275 CAGGCAGAGTACCTGAGGTCAGG + Intronic
1097665029 12:62468261-62468283 CAGGGGGATCATCTGAAGTCGGG - Intronic
1100249817 12:92807179-92807201 CAGGCAGATCATCTGAAGTCAGG - Intronic
1101676132 12:106918151-106918173 CAGGGAGAGCTTCAGAAGGCAGG + Intergenic
1103281498 12:119761535-119761557 GAGGGAGAGAAGCCGAAGACAGG + Intronic
1103957320 12:124584576-124584598 CAGGCAGATTACCTGAAGTCAGG - Intergenic
1104233789 12:126911786-126911808 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1104572344 12:129935967-129935989 CAGGGAGAGTACACTGAGTCCGG + Intergenic
1105374547 13:19831566-19831588 CAGGCAGATTACCTGAAGTCAGG + Intronic
1107289088 13:38831845-38831867 CAGGCAGATTATCTGAGGTCAGG - Intronic
1109636161 13:65120285-65120307 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1111959691 13:94796615-94796637 CAGGCAGATCATCCGAGGTCAGG - Intergenic
1114127708 14:19749369-19749391 CAGGCAGATCATCTGAAGTCAGG + Intronic
1114278360 14:21168472-21168494 CAGGCAGACCACCCGAAGTCAGG + Intergenic
1114843444 14:26292506-26292528 CAGGGAGATCATCTGAGGTCAGG - Intergenic
1115750737 14:36487192-36487214 CAGGCAGATCATCTGAAGTCAGG + Intronic
1116079948 14:40158801-40158823 CAGGCAGATTATCTGAGGTCAGG + Intergenic
1116876734 14:50119761-50119783 CAGGCAGATCATCTGAAGTCAGG - Intronic
1117665816 14:58054668-58054690 CAGGCAGATTACCTGAAGTCAGG + Intronic
1118863880 14:69687200-69687222 CAGGCAGATTACCTGAAGTCAGG - Intronic
1119650983 14:76382540-76382562 CAGGGAGAGAAGGGGAAGTCGGG - Intronic
1121362038 14:93270463-93270485 CAGGTAGATTACCCGAGGTCAGG + Intronic
1122547710 14:102533579-102533601 CAGGGAGATCATCTGAGGTCAGG - Intergenic
1122656484 14:103264676-103264698 CAGGGAGATCACCCGAAGCCAGG - Intergenic
1123460649 15:20467135-20467157 CAGGCAGAGACTCCGAAGACGGG + Intergenic
1123657412 15:22533281-22533303 CAGGCAGAGACTCCGAAGACGGG - Intergenic
1124271279 15:28282912-28282934 CAGGGAGAGACTCCGAAGATGGG + Intronic
1124311324 15:28628490-28628512 CAGGCAGAGACTCCGAAGACGGG - Intergenic
1125326193 15:38538034-38538056 CAGGCAGATTACCCGAGGTCAGG + Intronic
1125676913 15:41507030-41507052 CAGGGAGAGAATCAGAGGTGGGG + Intronic
1125981413 15:44005251-44005273 CAGGCAGATCATCTGAAGTCAGG + Intronic
1126532300 15:49724726-49724748 CAAGGAGAGTATCTGAAGGTGGG + Intergenic
1126651972 15:50932204-50932226 CAGGGAGATCATCTGAGGTCAGG - Intronic
1127126163 15:55813821-55813843 CTGGGAGGGTATGCGAACTCTGG + Intergenic
1127213506 15:56800213-56800235 CAGGGAGAGCCTCCAAAATCTGG + Intronic
1127433832 15:58937042-58937064 CAGGCAGAGTACTCGAGGTCAGG - Intronic
1128641650 15:69342760-69342782 GAGGGAGAGGATCAGAAGTGTGG + Intronic
1129646403 15:77437799-77437821 CAGGGAGATCATCTGAGGTCAGG - Intronic
1129802772 15:78428791-78428813 CAGGGAGATCATCTGAGGTCAGG - Intergenic
1130313983 15:82779435-82779457 CAGGCAGAGCACCTGAAGTCAGG + Intronic
1131009911 15:89008684-89008706 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1132824699 16:1898151-1898173 CAGGCAGATCATCCGAGGTCAGG + Intergenic
1134233005 16:12443676-12443698 CAGGTAGATTATCTGAGGTCGGG - Intronic
1134395745 16:13861284-13861306 CAGGGTAAATATCCGCAGTCAGG + Intergenic
1135535022 16:23287230-23287252 CAGGCAGATTACCTGAAGTCAGG - Intronic
1136508024 16:30718696-30718718 CAGGCAGATTATCTGAGGTCAGG - Intronic
1137310828 16:47256190-47256212 CAGGGAGAGCACTTGAAGTCAGG - Intronic
1139718264 16:68831764-68831786 CAGGGAGATCACCCGAGGTCAGG - Intronic
1142163841 16:88574434-88574456 CAGGTGGATCATCCGAAGTCAGG - Intronic
1142731201 17:1859128-1859150 CAGGCAGATCATCCGAGGTCAGG - Intronic
1143084336 17:4404413-4404435 CAGGCAGATTATCTGAGGTCAGG + Intergenic
1143178359 17:4969160-4969182 CAGGCAGGGTGGCCGAAGTCCGG + Exonic
1144075533 17:11716306-11716328 CAGGGAGATTACCTGAGGTCAGG - Intronic
1149601626 17:57896996-57897018 CAGGCAGATTATCAGAGGTCAGG - Intronic
1149734361 17:58978481-58978503 CAGGCAGATTATCAGAGGTCAGG + Intronic
1153202736 18:2662416-2662438 CAGGGAGATCATCTGAGGTCAGG + Intronic
1157711320 18:49851720-49851742 CAGGGAGTGTAAGGGAAGTCAGG - Intronic
1157869598 18:51217981-51218003 CAGGTAGAGCATCTGAGGTCAGG - Intronic
1158341534 18:56471867-56471889 CAGGCAGATTACCTGAAGTCAGG - Intergenic
1159861638 18:73655869-73655891 CAGGCAGATTATCTGAGGTCAGG + Intergenic
1160057336 18:75495795-75495817 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1161359485 19:3839303-3839325 CAGGCAGATTACCCGAGGTCAGG + Intronic
1163318912 19:16560632-16560654 CAGGGAGATGATCTGAGGTCAGG + Intronic
1163515428 19:17760276-17760298 CAGGCAGATTATCTGAGGTCAGG - Intronic
1163610081 19:18296068-18296090 CAGGCAGGGTATCAGCAGTCTGG + Intergenic
1165355796 19:35303149-35303171 CAGGCAGATCATCTGAAGTCAGG - Intronic
1165920614 19:39295648-39295670 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1168017480 19:53585112-53585134 CAGGTAGATCATCCGAGGTCAGG - Intergenic
1168174330 19:54612845-54612867 CCGGCAGATTATCTGAAGTCTGG + Intronic
1168244167 19:55102284-55102306 CAGGGAGATTACCTGAGGTCAGG + Intronic
926028049 2:9561871-9561893 CAGGCAGATCATCTGAAGTCAGG - Intergenic
926710214 2:15873443-15873465 CAGGGGGACAACCCGAAGTCAGG + Intergenic
927484882 2:23481686-23481708 CAGGCAGATCATCCGAGGTCAGG + Intronic
928373873 2:30759731-30759753 CACGGTGAGTATCTAAAGTCCGG + Intronic
931419846 2:62116757-62116779 CAGGCAGATTACCTGAAGTCGGG + Intronic
931730302 2:65147340-65147362 CAGGCAGATCACCCGAAGTCAGG - Intergenic
932252243 2:70254670-70254692 CAGGCAGAATATCTGAGGTCAGG - Intergenic
934966478 2:98728518-98728540 CAGGCAGATTACCCGAGGTCAGG + Intronic
937044085 2:118841908-118841930 CAGGCAGCGTTTCCGAAGCCAGG + Intergenic
941033973 2:160546150-160546172 CAGGCAGAATATCTGAGGTCAGG - Intergenic
942295604 2:174514445-174514467 CAGGCAGATCACCCGAAGTCGGG + Intergenic
943068227 2:183111225-183111247 CAGGCAGATTACCTGAAGTCAGG + Intergenic
945074368 2:206022969-206022991 CAGGCAGAGTACCTGAGGTCAGG + Intronic
946322877 2:218963652-218963674 CAGGGGCAGTATCCGAAGGCAGG - Intergenic
946580725 2:221125809-221125831 CAGGGAGACTTTCAAAAGTCTGG - Intergenic
946707481 2:222472785-222472807 CAGGCAGATTACCTGAAGTCAGG + Intronic
947136618 2:226982352-226982374 CAGGGACAATATCCTAGGTCAGG + Intronic
947784442 2:232803116-232803138 CAGGCAGATTATCTGAGGTCAGG - Intronic
1170603897 20:17861760-17861782 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1172955688 20:38756675-38756697 CAGGCAGATTATCTGAGGTCAGG + Intronic
1172985877 20:38988817-38988839 CAGGGAGAGTAGCTGAAGAAAGG + Exonic
1174072971 20:47911835-47911857 CAGGCAGATCACCCGAAGTCAGG - Intergenic
1174315573 20:49698092-49698114 CAGGCAGATTACCTGAAGTCAGG + Intronic
1174794926 20:53514031-53514053 CAGGGAGAGGTTCTGAAGGCAGG + Intergenic
1175462755 20:59165365-59165387 CAGGGAGAGTCTACCACGTCTGG + Intergenic
1176203061 20:63872603-63872625 CAGGCAGATTATCTGAGGTCAGG - Intronic
1177721193 21:24909006-24909028 CAGGGAGAGCACCTGAGGTCAGG + Intergenic
1179229280 21:39486943-39486965 CAGGCAGATTATCTGAGGTCAGG - Intronic
1180001667 21:44998026-44998048 CAGGGACAGTAGCCAGAGTCTGG + Intergenic
1182465360 22:30512572-30512594 CAGGGGGATTATCTGAAGTCAGG + Intergenic
1184298507 22:43541302-43541324 CAGGGAGAGGTACGGAAGTCGGG + Intronic
949157904 3:849831-849853 CAGTGGGAGGATCCGGAGTCAGG + Intergenic
953347395 3:42187692-42187714 CAGGCAGATCATCTGAAGTCAGG - Intronic
956762989 3:72459875-72459897 CAGGAAGGGTATCCAAGGTCAGG + Intergenic
957252897 3:77796924-77796946 CAGGTAGATCATTCGAAGTCAGG - Intergenic
957486543 3:80870054-80870076 CAGGGAGATCATCTGAGGTCAGG + Intergenic
958772987 3:98448460-98448482 CAGGGGGAATACCCGAGGTCAGG - Intergenic
960807308 3:121596607-121596629 CAGGCACAGAATCCGAAATCTGG - Intronic
961689636 3:128659504-128659526 CAGGTAGATCATCCGAGGTCAGG + Intronic
962757363 3:138475698-138475720 CAGGCAGATTATCTGAGGTCGGG + Intronic
962896058 3:139715886-139715908 CAGGGAGAATCTGAGAAGTCAGG + Intergenic
963943583 3:151119989-151120011 CAGGTGGATTATCTGAAGTCAGG + Intronic
964645305 3:158952497-158952519 CAGGCAGATTACCTGAAGTCAGG - Intergenic
965600583 3:170450589-170450611 CAGGGAGATCATCTGAGGTCTGG - Intronic
969481240 4:7448211-7448233 CAGGGAGAGTGGCCGGAGTGTGG + Intronic
972447552 4:39159930-39159952 CAGGCAGATCATCTGAAGTCAGG + Intergenic
972532576 4:39974881-39974903 CAGGCAGATCATTCGAAGTCAGG + Intronic
975609527 4:76190336-76190358 CAGGGAGAGTATCCGAAGTCAGG + Intronic
975993345 4:80284204-80284226 CAGGCAGATTATCTGAGGTCAGG + Intronic
981841058 4:149112898-149112920 CAGGGAGAGCACCTGAGGTCGGG + Intergenic
982599876 4:157435015-157435037 CAGGGAGAGGCTCCGCAGTGAGG + Intergenic
983032671 4:162822538-162822560 CTGGTGGATTATCCGAAGTCAGG + Intergenic
983585579 4:169350815-169350837 CAGGCAGATCATCCGAGGTCAGG - Intergenic
985876043 5:2596307-2596329 CAGGGAGAGTCTCCCAAGAACGG - Intergenic
990164801 5:52982550-52982572 CAGGCAGATCATCTGAAGTCAGG + Intergenic
991727040 5:69545962-69545984 CAGGGAGATCATCTGAGGTCAGG - Intronic
991867917 5:71081912-71081934 CAGGGAGATCATCTGAGGTCAGG + Intergenic
992009780 5:72514773-72514795 CAGGCAGATTATCTGAGGTCAGG - Intergenic
996742601 5:126814764-126814786 TAGGCAGAGTACCTGAAGTCAGG - Intronic
997330264 5:133054920-133054942 CAGGAAGAGAATCCCAAGTATGG + Intronic
997467538 5:134098450-134098472 CAGGCAGATCACCCGAAGTCAGG - Intergenic
998966745 5:147549372-147549394 CAGGCAGAGCATCTGAGGTCAGG - Intergenic
1000364559 5:160478862-160478884 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1003511062 6:6781025-6781047 CAGGCAGATCATCCGAGGTCAGG - Intergenic
1006702817 6:35990162-35990184 CAGGCAGATTACCCGAGGTCGGG - Intronic
1006750229 6:36372435-36372457 CACAGAGAGTTTCAGAAGTCAGG - Intronic
1012815054 6:104013221-104013243 CATGAAGAGTATGAGAAGTCTGG + Intergenic
1015576618 6:134678631-134678653 GAGGGAGTGTAACCGAAGTCTGG - Intergenic
1018819216 6:167360152-167360174 CAGGCAGATCATCTGAAGTCAGG - Intronic
1019323624 7:426603-426625 CAGGGAGAGTCTCTGAGGCCAGG - Intergenic
1019509869 7:1412473-1412495 CAGGGACAGCATCTGTAGTCAGG - Intergenic
1019605037 7:1905820-1905842 CAGGCAGATTATCTGAGGTCAGG + Intronic
1022405221 7:30083150-30083172 CACAAAGAGTATCTGAAGTCAGG - Exonic
1022478290 7:30726403-30726425 CAGGGAGATCATCTGAGGTCAGG - Intronic
1023809239 7:43898906-43898928 CAGGCAGATTACCTGAAGTCAGG + Intronic
1024604819 7:51014603-51014625 CAGGGAGAAAATGTGAAGTCCGG + Intergenic
1026102968 7:67397941-67397963 CAGGCAGATTACCTGAAGTCAGG - Intergenic
1026381299 7:69802147-69802169 CAGGGAAACTATCCAAAGACAGG - Intronic
1026664545 7:72331120-72331142 CAGGTAGATTACCTGAAGTCAGG + Intronic
1029253758 7:99255039-99255061 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1029520386 7:101057513-101057535 CAGGAAGATTGTCTGAAGTCAGG + Intronic
1030290860 7:107871399-107871421 CAGAGTCAGTATCCCAAGTCTGG - Intergenic
1030383137 7:108836120-108836142 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1030541271 7:110833209-110833231 CAGGCAGATTATCTGAGGTCAGG + Intronic
1031620612 7:123929975-123929997 CAGGGAGAGAAACGTAAGTCAGG + Intronic
1031703503 7:124955434-124955456 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1032053015 7:128661334-128661356 CAGGCAGATTATCTGAAGTCAGG - Intergenic
1032807710 7:135373807-135373829 CAGGCAGATCATCCGAGGTCAGG - Intronic
1033322061 7:140348918-140348940 GAGGGAGACTAGCTGAAGTCAGG - Intronic
1033990046 7:147272118-147272140 CAGGCAGATTACCTGAAGTCAGG - Intronic
1034993779 7:155565600-155565622 CAGGCAGATCATCTGAAGTCAGG - Intergenic
1035147592 7:156835465-156835487 CAGGCAGATTATCTGAGGTCAGG + Intronic
1035457858 7:159021074-159021096 CAGGGAGAGGACCAGAAGACCGG - Intergenic
1036137151 8:6172839-6172861 CAGGCAGATTACCTGAAGTCAGG - Intergenic
1037722238 8:21454636-21454658 CAGGCAGATCATCCGAGGTCAGG + Intergenic
1037961116 8:23099039-23099061 CAGGTAGATTACCCGAGGTCAGG + Intronic
1038473967 8:27849234-27849256 CAGGCAGATCATCTGAAGTCAGG + Intergenic
1038831479 8:31066103-31066125 CAGGCAGATTATCTGAGGTCAGG - Intronic
1038945822 8:32358776-32358798 CAGGAAGAGTATTTAAAGTCAGG + Intronic
1039436190 8:37560966-37560988 CATGAAGAGTATACAAAGTCTGG - Intergenic
1040589045 8:48772575-48772597 CAGGGAGAGTGACAGAAGTTGGG + Intergenic
1040758238 8:50807023-50807045 CAGAGAGAGTTTCCAAATTCTGG - Intergenic
1040909017 8:52499462-52499484 CGGGCAGAGTTTCCAAAGTCTGG + Intergenic
1041120011 8:54576683-54576705 CAGGGAAAATATTAGAAGTCTGG + Intergenic
1041165719 8:55090552-55090574 CAGGTAGATCATCTGAAGTCAGG - Intergenic
1041564476 8:59261441-59261463 TAAGGAGAGTATCAGAAGTAGGG - Intergenic
1042436760 8:68774877-68774899 CAGGCAGATTACCTGAAGTCAGG + Intronic
1044585422 8:93865162-93865184 CAGGCAGATTATCTGAGGTCAGG - Intronic
1046771905 8:118124965-118124987 CAGGCAGAGCACCTGAAGTCAGG - Intergenic
1047426168 8:124748900-124748922 CAGGGAGAGGAACCGAGGCCAGG + Intergenic
1053037944 9:34841628-34841650 CAGGCAGATTACCTGAAGTCAGG + Intergenic
1056157694 9:83855261-83855283 CAGGGAGATCACCTGAAGTCAGG - Intronic
1056352850 9:85768818-85768840 CAGGGAGATCACCTGAAGTCAGG + Intergenic
1057485317 9:95478327-95478349 CAGGGAGAGAAGCTGAAGTTGGG + Intronic
1058684489 9:107468167-107468189 CAGGCAGATTATCTGAAGTCAGG - Intergenic
1059649003 9:116297080-116297102 CAGGCAGATCATCCGAGGTCAGG - Intronic
1060091298 9:120746311-120746333 CAGGTAGATTACCTGAAGTCAGG + Intergenic
1061348669 9:130046504-130046526 CAGGCAGATCATCCGAGGTCAGG + Intergenic
1061870436 9:133517436-133517458 CAGGCAGATTACCTGAAGTCAGG + Intronic
1185808160 X:3079569-3079591 CAGGGGGATTACCTGAAGTCAGG - Intronic
1187315149 X:18186228-18186250 CAGGCAGAGCATCTGAGGTCAGG + Intronic
1187321806 X:18245964-18245986 CAGGCAGATCACCCGAAGTCGGG - Intronic
1192168288 X:68839551-68839573 CAGGGAGAGAAACTGCAGTCGGG - Intronic
1192169592 X:68846014-68846036 CAGGTAGAGTCTAAGAAGTCAGG + Intergenic
1192312359 X:70027593-70027615 CAGGCAGATCACCCGAAGTCAGG + Intronic
1195014939 X:100769142-100769164 CAGGGAGACTTTCCCAACTCAGG + Intergenic
1198668466 X:139051351-139051373 CAGGTTGTGTATCCTAAGTCAGG + Intronic
1198750953 X:139935760-139935782 CAGGCAGATTACCTGAAGTCAGG + Intronic