ID: 975613162

View in Genome Browser
Species Human (GRCh38)
Location 4:76221154-76221176
Sequence TTGTGGCAGGGGAAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 823
Summary {0: 1, 1: 0, 2: 3, 3: 73, 4: 746}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975613150_975613162 1 Left 975613150 4:76221130-76221152 CCTGCCCACAGGAAGAAAAACCC 0: 1
1: 0
2: 2
3: 27
4: 252
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746
975613146_975613162 14 Left 975613146 4:76221117-76221139 CCACTTTCCCATACCTGCCCACA 0: 1
1: 0
2: 2
3: 40
4: 432
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746
975613152_975613162 -4 Left 975613152 4:76221135-76221157 CCACAGGAAGAAAAACCCATTGT 0: 1
1: 0
2: 1
3: 25
4: 266
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746
975613149_975613162 6 Left 975613149 4:76221125-76221147 CCATACCTGCCCACAGGAAGAAA 0: 1
1: 0
2: 1
3: 26
4: 266
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746
975613145_975613162 28 Left 975613145 4:76221103-76221125 CCTTATGAACAAGGCCACTTTCC 0: 1
1: 0
2: 5
3: 8
4: 127
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746
975613144_975613162 29 Left 975613144 4:76221102-76221124 CCCTTATGAACAAGGCCACTTTC 0: 1
1: 0
2: 4
3: 19
4: 147
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746
975613148_975613162 7 Left 975613148 4:76221124-76221146 CCCATACCTGCCCACAGGAAGAA 0: 1
1: 0
2: 0
3: 21
4: 185
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746
975613151_975613162 -3 Left 975613151 4:76221134-76221156 CCCACAGGAAGAAAAACCCATTG 0: 1
1: 0
2: 2
3: 28
4: 305
Right 975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG 0: 1
1: 0
2: 3
3: 73
4: 746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975613162 Original CRISPR TTGTGGCAGGGGAAGGGGAC AGG Intronic
900422116 1:2560164-2560186 TGGAGGCAGGGGAAGGGGCAAGG + Intronic
900638384 1:3676487-3676509 TTGGGACAGGGCAGGGGGACAGG + Intronic
900775689 1:4583530-4583552 TTCTGGCAGGAGATGGGCACTGG + Intergenic
900808990 1:4786941-4786963 TTGTGGAAGGGGCAGGGGTAGGG - Exonic
900813231 1:4824120-4824142 GTGGGGCAGGGGTAGGGGATGGG + Intergenic
900860156 1:5223186-5223208 CTGTGGCAGAGGAAGGGTCCAGG + Intergenic
901004372 1:6164793-6164815 TCTTGGAAGGGGAAGGGGGCTGG - Intronic
901065275 1:6491305-6491327 TTTTGGCCTGGGAAGGGGTCGGG - Intronic
901715837 1:11153181-11153203 GAGTGGAAGGGGAAGGGGCCAGG + Intronic
901800819 1:11706879-11706901 TTGGGGCATGGGAAGAGGAGAGG + Intronic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902240369 1:15084269-15084291 TTGTGGCAGGGCAGATGGACAGG + Intronic
902361315 1:15943948-15943970 TTGTGGGAGGGGCAGGTGAGGGG - Intronic
902489834 1:16773189-16773211 TAGGGGCGGGGGAGGGGGACTGG + Intronic
902606022 1:17569802-17569824 ATGTGGCCGGCAAAGGGGACAGG - Intronic
902623696 1:17664758-17664780 GTGTGGCAGAGGAAGAGGTCAGG - Intronic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
903058053 1:20650254-20650276 TTGGAGCACGGGCAGGGGACAGG + Intronic
903068516 1:20714968-20714990 TTGTGGCAGTGCACGGGGAATGG - Intronic
903771186 1:25765442-25765464 TGGAGGCAGGGGAAAGGGAAGGG - Intronic
903781775 1:25824660-25824682 GTGTCGCAGGGGTAGGGGGCAGG + Intronic
904057178 1:27679076-27679098 TTTTTGCAGGGGCAGGGGACAGG + Intergenic
904703661 1:32374664-32374686 TTGGGGCAGGTGCAGGGGAGTGG - Intronic
905182381 1:36175288-36175310 TGGTGGCTGGGGGTGGGGACAGG + Intronic
905337032 1:37251878-37251900 ATGTCTCAGGGGAAGGGGCCTGG + Intergenic
905568560 1:38985852-38985874 TAGTGGAATGGGAAGGGCACAGG + Intergenic
905775119 1:40663399-40663421 TTGTGGCTGGGGAGTGGGGCAGG + Intronic
905965557 1:42092484-42092506 TGGTGGAAGGTGAAGGGGAGTGG + Intergenic
906239434 1:44233356-44233378 TTGTGACAGGAGGAGAGGACTGG - Intronic
906675182 1:47688270-47688292 TTGTGCCAGGGGATGAGGAGAGG - Intergenic
906704480 1:47885002-47885024 GGGTGGCAGGGGAAGGGGAGGGG - Intronic
906714261 1:47955297-47955319 TGGTGGAAGGAGAAAGGGACTGG - Intronic
907142877 1:52204783-52204805 TTCTGGCAGGGAAAGGGGAAAGG - Intronic
907413533 1:54298710-54298732 TTGTGGAGGTGGAAGGGGTCAGG - Intronic
907765730 1:57408826-57408848 ATGGAGCAGGGGAAGGGGCCAGG - Intronic
907909005 1:58810829-58810851 CTGGGGCAGGGGAAGAGGAAGGG - Intergenic
908138697 1:61160112-61160134 GTGAGGCAGGAGAAGGGAACTGG + Intronic
908235152 1:62141135-62141157 TTGGAGCATGGGAAGGGGAGGGG - Intronic
908402483 1:63784595-63784617 TTGTGGCAGGGAGAGGAGCCAGG + Intronic
909139274 1:71843216-71843238 TTGTGGCAGGGGATGGAGAAAGG + Intronic
909548251 1:76870075-76870097 TTGTGGCAGGAGCAGGGGTTGGG + Intronic
910123744 1:83818281-83818303 TGGTGGACGGGGAAGGGGAAGGG - Intergenic
910534765 1:88284570-88284592 TGGTGGCAGGGGAAAGAGAGGGG - Intergenic
911168314 1:94744825-94744847 GTGTGGGAGGGGAGGTGGACAGG + Intergenic
911405397 1:97431849-97431871 TAGTGGGAGGGGAAGGGGAAGGG - Intronic
911513452 1:98837386-98837408 TTGTGGAAGGGGCAGTGGAAAGG + Intergenic
911686966 1:100788600-100788622 TTGTGGGAGGGGAAAGGAAAAGG - Intergenic
911852445 1:102836426-102836448 TTGTGGCAGGGTGGGGGGAGGGG + Intergenic
911884927 1:103286417-103286439 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
912297509 1:108484609-108484631 TTTTGGAAGTGGAAGGGGGCCGG - Intergenic
912327055 1:108776020-108776042 TTGAGGCAGGGGTATGGGAGAGG + Intronic
912430331 1:109625353-109625375 TTGAGGCAGGGGGCGGGGCCCGG - Exonic
912512542 1:110198853-110198875 TTGGGGCTGGGGAAGGAGAGTGG + Exonic
912513431 1:110203341-110203363 GTTTGGCAGAGGGAGGGGACCGG + Intergenic
912810897 1:112793677-112793699 TTGAGGAAGGGCAAGGGGAAAGG + Intergenic
912829543 1:112939890-112939912 TTGTGCCAGGGGATGGGCAGGGG - Intronic
912949206 1:114108999-114109021 TTGTGGGAGGGTAGGGGGGCTGG + Intronic
913154374 1:116080499-116080521 TTTAGGCAGGAGAAGGGGAGTGG + Intergenic
914326135 1:146618674-146618696 TTGTGGAAGGGGAAAGGGCATGG + Intergenic
914869255 1:151459237-151459259 TGGGAGCAGGGGGAGGGGACGGG + Exonic
915543352 1:156582443-156582465 CTGGGGCCGGGGAATGGGACTGG + Intronic
915720228 1:157979147-157979169 CTGGGGCGGCGGAAGGGGACAGG - Intergenic
915831998 1:159140035-159140057 TGGGGGAAGGGGAAGGGGAAGGG - Intronic
915832001 1:159140041-159140063 TAGTGGTGGGGGAAGGGGAAGGG - Intronic
915981952 1:160425872-160425894 TTGTGGCTGGGGTGAGGGACAGG - Exonic
916091338 1:161309908-161309930 CTGGGGCAGGGGCAGGGGCCCGG + Exonic
916313995 1:163427387-163427409 GTGTGGGAGGGGCTGGGGACAGG + Intergenic
916325724 1:163557647-163557669 GTGTGGCAGAGGACGGGGAGTGG - Intergenic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
917470193 1:175319919-175319941 TTCTGGAAGGTGAAGGGGTCAGG - Exonic
917887285 1:179398858-179398880 TTGTGGCAGGGGTTGGGGGGAGG + Intronic
918047185 1:180948644-180948666 TGGTGGCACGGGGAGGGGGCAGG - Exonic
918213210 1:182370143-182370165 TTGGGTGAGGGGCAGGGGACAGG + Intergenic
919012733 1:191986287-191986309 TTGTGGCTGGGGAAGGGGTGGGG - Intergenic
919227929 1:194732024-194732046 TTCTGGAATGGGAATGGGACTGG + Intergenic
919362005 1:196608426-196608448 TGGGAGAAGGGGAAGGGGACAGG + Exonic
919880507 1:201897814-201897836 ATGTGGCAGGGGCAGTGGCCTGG - Exonic
920273648 1:204787289-204787311 TGGTGGAAGGGGAAGGGGAAGGG - Intergenic
920728512 1:208460910-208460932 TTGGGGCAGGGGGAGGGAAAAGG - Intergenic
921036496 1:211383883-211383905 TTGAGGTAGAGGAAGGGGGCTGG - Intergenic
921524509 1:216200951-216200973 TGGGGGGAGGGGAAGGGGAAGGG - Intronic
922069070 1:222173549-222173571 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
922424763 1:225482498-225482520 ATTTGGCAGGGCAGGGGGACCGG + Intergenic
922597396 1:226824472-226824494 TGGGGGAAGGGAAAGGGGACAGG - Intergenic
922775682 1:228213336-228213358 TTGTGGGCGGGAAAGGAGACTGG - Intronic
923043939 1:230340957-230340979 ATGTCACAGGAGAAGGGGACAGG + Intronic
923134595 1:231107073-231107095 TGGTGACAGGGGAAGGAGAGTGG - Intergenic
923530606 1:234809339-234809361 TAGGGGCGGGGGAGGGGGACTGG - Intergenic
923659494 1:235945950-235945972 CTTTGGCAGGGGAAGGGTGCTGG + Intergenic
924432287 1:244007455-244007477 ATGTGGCAGGGGTGGGTGACAGG - Intergenic
924589912 1:245393925-245393947 CTGGGGGAGGGGAAGGGGTCAGG + Intronic
924637835 1:245805610-245805632 TTGTGGCACAGGAAAGGGATAGG + Intronic
924939876 1:248805633-248805655 TTGTGGCAGGGGCAGGCCAAGGG + Intergenic
1062784894 10:256190-256212 GTGAGGCAGGGGAAGGTGATGGG - Intergenic
1062815915 10:499938-499960 TTGTGGCAGGGTCAGGTTACTGG - Intronic
1063564215 10:7158121-7158143 TGGTGACAGAGGAAGGGGACAGG + Intergenic
1063762757 10:9098853-9098875 TGGTGGCATGGGAATGGGAATGG - Intergenic
1064133765 10:12732676-12732698 TTGTGGGAGGGACAGGGGGCGGG - Intronic
1065481147 10:26195084-26195106 TTGGGGCAGGGGGTGGGGAGTGG - Intronic
1065679826 10:28217684-28217706 ATGAGGCAGGGGAAGGGAAAAGG + Intronic
1067061779 10:43081478-43081500 GTGTGGCAAGGGGCGGGGACTGG + Intronic
1067427863 10:46223103-46223125 TGGAGACAGGTGAAGGGGACTGG - Intergenic
1067677149 10:48391726-48391748 TGGTGGCGGTGGGAGGGGACTGG - Intronic
1069740776 10:70685816-70685838 TGGTGGGAGGTGAAGGGGCCTGG + Intronic
1069934030 10:71902771-71902793 ATGTGGCAGGGGTGGGGGATGGG - Intergenic
1069937691 10:71929664-71929686 TTGTGGGAGGCCAAGGCGACTGG + Intergenic
1070161340 10:73868366-73868388 AGGTGGGAGGGGAGGGGGACAGG + Intronic
1070332931 10:75431133-75431155 TTGTAGGAGGGGAGGGGGATTGG - Intergenic
1070335501 10:75451605-75451627 TTGGGGTAGGGGAAGTGGAGGGG + Intronic
1070741313 10:78904990-78905012 TTCTGGGAGAGGAAGGGGACAGG - Intergenic
1071344518 10:84680014-84680036 TTGGGGGTGGGGAATGGGACTGG + Intergenic
1072035580 10:91560479-91560501 GAGTGGCAGGGGTAGGGGTCTGG - Intergenic
1073070234 10:100788576-100788598 TGGGGGCAGAGGAAGGAGACAGG + Intronic
1073345059 10:102776713-102776735 ATGGGGCTGGGGAAGGGGAGAGG + Intronic
1073361952 10:102906726-102906748 TTGTGTCAGGTGAAGTGGCCTGG + Intergenic
1073529288 10:104216640-104216662 CTGTGGGTGGGGAAGGGGAGAGG - Intronic
1073592149 10:104767678-104767700 AAGTGGGAGGGGAAGGGGAAGGG - Intronic
1073930451 10:108568081-108568103 TTGTCACTGGGGAAGAGGACAGG - Intergenic
1074008591 10:109454362-109454384 GTATGGCAGGAGATGGGGACGGG - Intergenic
1074353409 10:112759757-112759779 TTGTGGGGTGGGAAGGGGGCTGG - Intronic
1074615140 10:115060144-115060166 TTGTGTCAGGTTGAGGGGACAGG + Intergenic
1074769359 10:116723404-116723426 TTCTTCCAGGGGCAGGGGACGGG + Intronic
1074964051 10:118473238-118473260 TGGAGGCAGGGGAAGGGGCTGGG - Intergenic
1075152584 10:119947777-119947799 TTGTGGCACAGGAATGGCACAGG + Intergenic
1075346920 10:121689193-121689215 TTTTGGCGGGGGAGGGGTACAGG + Intergenic
1075682808 10:124344378-124344400 TGGAAGCAGGGGAGGGGGACGGG - Intergenic
1075964259 10:126597413-126597435 TTGGGGCAGGGCAAGTGGAGAGG + Intronic
1075989439 10:126822551-126822573 TCGTGGCAAGGGACGGGGAAAGG + Intergenic
1076087705 10:127649794-127649816 TTGAGGAAGAGGAAGGGGAACGG - Intergenic
1076542638 10:131223916-131223938 ATGTGGCCTGGGGAGGGGACAGG - Intronic
1076606615 10:131693689-131693711 GTGTAGCTGAGGAAGGGGACAGG - Intergenic
1076740035 10:132478446-132478468 CTGCTGCAGGGGAAGGGGCCAGG - Intergenic
1076865895 10:133166117-133166139 CTGGGGCAGGGTAGGGGGACCGG + Intronic
1077091269 11:779405-779427 TTGGGGGAGGGGAAGAGGAATGG - Intronic
1077864281 11:6210351-6210373 TTGAGGCAGGAGAAGGCAACAGG - Exonic
1077922556 11:6652591-6652613 CTGTGGAAGAGGAAGGGGATGGG + Intronic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078768723 11:14326654-14326676 ATTTGGGAGGGGGAGGGGACAGG + Intronic
1079929215 11:26537020-26537042 TTTTGGTAGGGGACGGGGACTGG + Intronic
1080704442 11:34677174-34677196 TTGTTTCAGGGCAAGGGGATTGG + Intergenic
1080803863 11:35634032-35634054 TTTGGGTAGGGGATGGGGACAGG + Intergenic
1081126248 11:39326646-39326668 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
1081653166 11:44839234-44839256 TTGATGCAGTGGAAGGGGTCAGG + Intronic
1081655227 11:44852798-44852820 GTTTGTCAGGGGAAGGGGAAAGG + Intronic
1081689083 11:45064162-45064184 TGGTGGGAAGGGAAGGGGAGTGG - Intergenic
1082067341 11:47911404-47911426 CTGTGGCAGAGGGAGGGGAGAGG - Intergenic
1082715156 11:56603241-56603263 CTGTGGAAAGGGAAGGGGAGAGG - Intergenic
1083095087 11:60242144-60242166 TGGTGGCATGGGAAGGGAAAAGG + Intronic
1083098781 11:60281512-60281534 TGGTGGCATGGGAAGGGAAAAGG - Intronic
1083427026 11:62593530-62593552 TTGTGAAAGGGGATGGGGAGGGG - Exonic
1083670467 11:64297206-64297228 TACTGGCAGGGGTCGGGGACCGG + Exonic
1083738010 11:64692741-64692763 GTGGAGGAGGGGAAGGGGACAGG + Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1084863343 11:72036898-72036920 GTGTGGCAGGAGATGGGGGCAGG - Intronic
1085007009 11:73101062-73101084 TTGAGGTAGAGGAAGAGGACTGG - Intronic
1085157639 11:74311240-74311262 TTGTGGCATGGGGTGGGGAGTGG - Intronic
1085479003 11:76806347-76806369 TTATGGCTGGGGAAGGGAGCAGG - Intergenic
1086135603 11:83441219-83441241 TGGCGGAAGGGGAAGGGGAAGGG + Intergenic
1087269722 11:96098955-96098977 TTGTGGAAAGGGATGGGGGCAGG - Intronic
1087620153 11:100531506-100531528 TTGTGGCAAGTGAATGGGATTGG - Intergenic
1087772204 11:102222871-102222893 TTTTGGCGGGGGAGGGGGTCGGG + Intronic
1088385848 11:109254904-109254926 TTGTGGCAGGAGTTGGGGAGGGG - Intergenic
1088685600 11:112282032-112282054 CTGTGGCAGGGGATGAGGGCAGG + Intergenic
1088915824 11:114227086-114227108 TTGTGGCAGGGAAGGTGGCCTGG + Intronic
1088973491 11:114794172-114794194 ATGAGGCTGGGGAAGTGGACAGG - Intergenic
1089056526 11:115590106-115590128 TTGTTACAGGGCAAAGGGACAGG + Intergenic
1089157018 11:116410283-116410305 CTGTGGCAGGGAAGGAGGACAGG - Intergenic
1089430293 11:118418009-118418031 ATGAGTCAGGGGTAGGGGACTGG + Intronic
1089538173 11:119173435-119173457 ATGTGTCAGGGAAAGGGGCCTGG - Intronic
1089813707 11:121153195-121153217 TCGTGGCAGGGGAATGGGATGGG + Intronic
1090004180 11:122985083-122985105 CTGTGGCAGGGAACGGGGACAGG + Intergenic
1090022288 11:123138605-123138627 TGGTGGCAGGGGAGGGGGAGGGG - Intronic
1090049223 11:123362751-123362773 TTGGGGAAGGGGTAGGGGATAGG + Intergenic
1091226270 11:133957971-133957993 TTGGGGGAGGGGAAGCAGACAGG - Intergenic
1091396320 12:156039-156061 GTGAGGCAGGGTGAGGGGACTGG + Intronic
1094016236 12:25867189-25867211 TTCTGGCAGGGGAAGTGGTTGGG - Intergenic
1094039795 12:26110663-26110685 TTTGGGGAGGGGAGGGGGACAGG + Intergenic
1095313795 12:40733487-40733509 CTCTGGCAGGGGAAGGGGGAGGG - Intronic
1095473852 12:42565433-42565455 TTGGGGCAGGGGATTGGGATAGG - Intronic
1095491527 12:42739510-42739532 TGGGGGTTGGGGAAGGGGACAGG + Intergenic
1095591861 12:43912346-43912368 GTGGGGTGGGGGAAGGGGACAGG + Intronic
1095902076 12:47338602-47338624 TTCTGGCAGGGGAAGGAAAGGGG + Intergenic
1096183943 12:49566284-49566306 GGCTGGCAGGGGAAGGGGGCTGG - Intronic
1096770535 12:53933494-53933516 TAGTGGGAAGGGAAGGGGACAGG + Intergenic
1096877904 12:54644843-54644865 TAGGGGAAGGGGAAGGGGAAGGG + Intronic
1097022060 12:56027548-56027570 GTGTGGCAGGGAGAGGGGCCTGG - Intronic
1097248043 12:57617350-57617372 TGGTGAAAGGAGAAGGGGACAGG + Intronic
1097719146 12:63001642-63001664 TGGTGGCAGGGTAAGAGGTCTGG - Intergenic
1098139030 12:67432688-67432710 ATGTGGCAGGTGAAGGAGAAGGG - Intergenic
1099811916 12:87593661-87593683 TTGTGGGGGGGGAAGGGGGGAGG + Intergenic
1100282396 12:93130402-93130424 TTTTGGCAGTGGATGGGGTCTGG - Intergenic
1100382377 12:94073760-94073782 ATGTGGCAGAGGAAGAGGGCAGG + Intergenic
1100459177 12:94781675-94781697 TTAGGGTAGGAGAAGGGGACAGG - Intergenic
1101685911 12:107020618-107020640 TGGTGGAAGGGGAAGGGAAAGGG - Intronic
1101915057 12:108889555-108889577 TTGTCACAGGCAAAGGGGACTGG + Intronic
1101993971 12:109511546-109511568 TGGAGGGAGGGAAAGGGGACAGG + Intronic
1102477829 12:113200426-113200448 TTGGTGGAGGGGAAGGGCACAGG - Intronic
1102555718 12:113725254-113725276 TGGTGGCAGAGGGAGGAGACAGG + Intergenic
1103191158 12:119003262-119003284 TGGTGGCGGGGGATGGGGAGGGG - Intronic
1103604979 12:122079441-122079463 TGCTGGCAGGGGAAGAGGCCAGG - Intronic
1104238381 12:126961621-126961643 TTTTGATATGGGAAGGGGACAGG - Intergenic
1104431346 12:128718841-128718863 TTGGGGCAGGAGGAAGGGACAGG + Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104823266 12:131690902-131690924 TAGTGACAGGGAAACGGGACAGG + Intergenic
1104984697 12:132590091-132590113 TAGTGGCAGGGTGGGGGGACAGG - Intergenic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105007364 12:132729584-132729606 GGGTGGGAGGGGAAGGGGAGGGG + Intronic
1105411391 13:20174480-20174502 AAGTGGAATGGGAAGGGGACAGG + Intergenic
1105435914 13:20378256-20378278 AGGTGGAAGGGGAAGGGGCCAGG - Intergenic
1105859261 13:24394952-24394974 GTGAGGCTGGGGAAGGAGACAGG + Intergenic
1106138276 13:26990677-26990699 TGGTGGGAGGGGACAGGGACAGG - Intergenic
1106520657 13:30494793-30494815 TTGGGGGAGGGAAAGGGGAGTGG - Intronic
1108972537 13:56394961-56394983 TTGTGCCTGGGGGAGGGGAGTGG + Intergenic
1109386861 13:61641133-61641155 TTGTGGCAGGGAGAAAGGACTGG + Intergenic
1110010844 13:70331657-70331679 TTGTGGCAGGGGTTGGGGAGTGG + Intergenic
1111828089 13:93294444-93294466 TTTTTGCAGGGGCAGGGGATGGG - Intronic
1113108639 13:106798294-106798316 TCTTAGCATGGGAAGGGGACGGG - Intergenic
1113393037 13:109916232-109916254 AAGTGGCACAGGAAGGGGACTGG + Intergenic
1113428542 13:110229990-110230012 TTGATGCTGTGGAAGGGGACAGG - Intronic
1113499639 13:110763327-110763349 TGGGGTCAGGGGAGGGGGACAGG - Intergenic
1113798566 13:113074711-113074733 GTGTGGGAGGGGAGGGGTACAGG - Intronic
1113914298 13:113861696-113861718 TTGGGGCAGGGGCAGGGGCAGGG - Intronic
1114647708 14:24264715-24264737 TGGTGGTGGGGGGAGGGGACTGG - Intergenic
1114723843 14:24912394-24912416 TTGTGACAGGGAAAGGTGGCTGG + Intronic
1114856090 14:26446210-26446232 TAGTGGAAGGGGAAGGGATCAGG + Exonic
1115160591 14:30389535-30389557 TTGGAGCAGGGGGAGGGGAAGGG - Intergenic
1115463845 14:33691897-33691919 TTGTGGCAGAGGAAGGGCCTTGG - Intronic
1115536434 14:34377629-34377651 TTGTGGCAGGGGTTGGGAAGAGG - Intronic
1116448668 14:45039897-45039919 CTGTGGCAGGGGAAGTGCGCTGG - Intronic
1116774603 14:49165702-49165724 TACTGGCAGGGAATGGGGACGGG + Intergenic
1117207944 14:53463825-53463847 TTGGGGCAGAGAAAGGGGATAGG - Intergenic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1117472267 14:56057803-56057825 TTGGGGCAGGGGATGGGGGTTGG - Intergenic
1117750792 14:58921711-58921733 GTGTGGCAGGGGAGGGCGGCAGG - Intergenic
1117994442 14:61466094-61466116 TTGAGGCTGGGGAGGGGAACGGG - Intronic
1118430062 14:65708848-65708870 GTGTGGGAGGGGATGGGGAAAGG + Intronic
1121311097 14:92935536-92935558 GTGTGGCTGGGGACGGGGAGAGG - Intergenic
1121810797 14:96887832-96887854 TTGGGGCAGGGGAAGGAGTAGGG - Intronic
1121994165 14:98589021-98589043 TGGTGGAAGGTGAAGGGGAGTGG - Intergenic
1122070029 14:99200292-99200314 AATGGGCAGGGGAAGGGGACTGG + Intronic
1122203944 14:100138971-100138993 ATGGGGCAGGGGAACGGGAAGGG + Intronic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1122360599 14:101159642-101159664 TTCTGGCAAGGAAAGGGGAAAGG - Intergenic
1122580156 14:102766573-102766595 TTGGGGTAGGGGCAGGGGACAGG + Intergenic
1122580862 14:102770816-102770838 TAGTGGCAGGGGAGGGAGAGCGG - Intergenic
1122602826 14:102929907-102929929 CTGAGGCTGGGGAGGGGGACGGG - Exonic
1122740586 14:103869591-103869613 GTGTGGCAGGGGTGGGGGATGGG + Intergenic
1123419203 15:20117739-20117761 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1123446660 15:20335760-20335782 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1123528425 15:21124282-21124304 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1123684424 15:22786919-22786941 TCGGGGCAGGGGACGGGGTCGGG + Intronic
1123923061 15:25084136-25084158 TCCTGGCAGTGGAAGGGGAGAGG + Intergenic
1123996481 15:25721327-25721349 GTGTGGCAGAGCAAGGGGACCGG + Intronic
1124461865 15:29899498-29899520 TGGTGGCAGGGAAAGGGGCAGGG + Intronic
1124793695 15:32754477-32754499 TGGTGGAAGGTGAAGGGGAGAGG - Intergenic
1125605450 15:40937559-40937581 TTGTGGGAGGGAAAGTGGCCTGG + Intronic
1125775359 15:42207999-42208021 CTGAGGCCGGGGAAGTGGACAGG - Intronic
1126146573 15:45479041-45479063 TTTTGGGGGGGGATGGGGACAGG + Intergenic
1127014381 15:54666956-54666978 TTGTAGCAGGGAAAGGAGAAAGG + Intergenic
1127039009 15:54952654-54952676 TTTTGGCTGGGGGAGGGGAGAGG - Intergenic
1127228884 15:56967122-56967144 GTGGGGGAGGGGAAGGGCACGGG - Intronic
1127324642 15:57883435-57883457 TGCTGGCAGGGAAAGGAGACTGG + Intergenic
1127389634 15:58495009-58495031 TTAGGGCAGGGTAAGGGGGCAGG - Intronic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128510057 15:68307786-68307808 TGGGGGCAGGGGCAGAGGACAGG + Intronic
1129118729 15:73381830-73381852 TTGGGGCAGAGGAAGGAGTCAGG - Intergenic
1129170888 15:73807202-73807224 GTGAGGGAGGGGAAGGGGAGAGG + Intergenic
1129252325 15:74315842-74315864 GTGTGGAGGGGGAGGGGGACAGG + Intronic
1129773598 15:78218460-78218482 ATGTGGCAGGCAAAGGGGTCAGG + Intronic
1129793464 15:78358202-78358224 TTGTGGCAGGGGATGGAGGTCGG + Intergenic
1129875337 15:78971762-78971784 TTCTGGAAGGGAAAGTGGACGGG + Intronic
1130220876 15:82018486-82018508 TAGGGCCAGGGGAAGGGGCCAGG - Intergenic
1130323164 15:82856834-82856856 CTCTGGCTGTGGAAGGGGACAGG + Intronic
1130635724 15:85618017-85618039 TTGGGGCACGAGAAGGGGAGGGG + Intronic
1130984077 15:88833404-88833426 GTGAGGCAGAGGAAGGGGACGGG - Intronic
1131228781 15:90645897-90645919 TGGTGGCAGGAGAAGGGGCCTGG - Intergenic
1131990498 15:98088644-98088666 CTGGGGGAGGGGAAGGGGCCGGG - Intergenic
1132099646 15:99014653-99014675 CTGGGGGAGGGGAAGGGGCCGGG + Intergenic
1132354176 15:101159202-101159224 TTGAGACAGGGGAAGGGGCTGGG - Intergenic
1132898064 16:2238240-2238262 GTGGGGCAGGGGCAGGGGCCGGG - Intronic
1132907215 16:2288892-2288914 TTGTGGCAGGGGGAGGGCAGGGG - Intronic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1133485257 16:6213854-6213876 TTATGGGAGGGGATGGGGTCAGG + Intronic
1134777383 16:16864981-16865003 GGGTGGCAGGGGAAGGGGTAGGG - Intergenic
1135247022 16:20865908-20865930 TTGCGGGTGGAGAAGGGGACAGG - Intronic
1135609437 16:23853350-23853372 TTGGGCCAGTGGAAGGGGAAAGG + Intronic
1135678537 16:24437801-24437823 TGGTGGAAGGGGAAGAGGAATGG - Intergenic
1135774170 16:25241805-25241827 CTGTGGCATGGGATGGGGAGAGG + Intronic
1135824657 16:25715969-25715991 TCGTGGCAGGGAAAGAGGTCAGG + Intronic
1136417486 16:30112814-30112836 GGGGGGCAGGGGCAGGGGACTGG + Intronic
1136502617 16:30680429-30680451 TTGGGGCAGGTGAAGGTGAAAGG - Intergenic
1137878568 16:52021830-52021852 TTGTGGCCAGGTGAGGGGACTGG - Intronic
1138405802 16:56792999-56793021 ATGGGGCAGGGGATGGGGATAGG + Intronic
1139430396 16:66908034-66908056 ATGTGGCAGGAGATGGGGAAGGG + Intergenic
1139482426 16:67237822-67237844 CTGTTGCTGGGGAAGGGGAAGGG + Intronic
1139886465 16:70211558-70211580 TTGTGGTGGGGGAGGGGGAAGGG + Intergenic
1140007432 16:71092272-71092294 TTGTGGAAGGGGAAAGGGCATGG - Intronic
1141076530 16:81010870-81010892 GTGAGGCAGGGGAAGAGGTCAGG - Intronic
1141459799 16:84171357-84171379 AGGTGGGAGGGGAAGGGGATGGG + Intronic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141926649 16:87174336-87174358 TGGAGGCAGGGGATGGGGCCGGG - Intronic
1142229675 16:88893941-88893963 TGCTGACAGGGGAGGGGGACTGG + Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1203137893 16_KI270728v1_random:1740973-1740995 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1142652203 17:1361674-1361696 TTGGGGGAGGGGAATGGGATAGG + Intronic
1142675973 17:1513598-1513620 CTGTGGCAGGGGAAGTAGCCTGG - Intronic
1142759274 17:2033956-2033978 TTGTGGGAGGGAAAGGGGGAAGG - Intronic
1142811440 17:2397333-2397355 TTGGGGTAGGGGAAGGGGCTGGG - Intronic
1143012323 17:3872706-3872728 TGGGGGCAGGGGTAGGGGGCAGG + Intronic
1143197380 17:5086382-5086404 ATGTGGTAAGGGAAGGGGAAAGG - Intronic
1143269167 17:5663008-5663030 ATGTCACATGGGAAGGGGACAGG - Intergenic
1143390910 17:6558736-6558758 TGGTGGGAGGGGAAGGGGTCTGG - Intergenic
1143516043 17:7419678-7419700 TTGGGGCATGGGAGGGGGGCTGG + Exonic
1143627826 17:8121365-8121387 TTGGGGCAGGGAAAAGGGACAGG + Exonic
1143628428 17:8123776-8123798 TTGTGGCCTGGGGAGGGGGCCGG - Intronic
1144921960 17:18771432-18771454 TGGGGGCACAGGAAGGGGACAGG + Intronic
1145855851 17:28156564-28156586 TTGTGGGAGGGGGAGGGGGATGG + Intronic
1145903086 17:28500395-28500417 GTTTGGCAAGGGAAGGGGAAGGG + Intronic
1146329652 17:31917084-31917106 GTGTGGTAGGGGACTGGGACAGG + Intergenic
1146477531 17:33174973-33174995 TTTTGGCAGGAGTAGGGGGCAGG - Intronic
1146581351 17:34040723-34040745 GTGAGGCTGGGGAAGGGGAGAGG - Intronic
1146649331 17:34597127-34597149 TGGTGGTAGGGGAAGGGAAGGGG - Intronic
1146712320 17:35053118-35053140 TAGTGGAAGAGGAAGGGGACAGG + Intronic
1147153407 17:38531339-38531361 TTTTGGCGGGGGAGGGGGGCTGG - Exonic
1147184759 17:38707052-38707074 GTGTGGGAGGGGCAGGGGAGTGG - Intronic
1147881391 17:43656381-43656403 TCGTGGCAGGGGTAGTGGAGGGG + Intronic
1147928884 17:43964059-43964081 TTGGGGCAGTGTGAGGGGACAGG + Intronic
1148150941 17:45396178-45396200 CTGGGGCAGGGGTTGGGGACGGG + Intronic
1148553887 17:48566369-48566391 TTGGGGAAAGGGAAGGGGAGGGG + Intronic
1148861201 17:50605106-50605128 GTGAGGAAGGGGAAGGGCACTGG - Intronic
1149071475 17:52549120-52549142 TTGGGGTGGGGGAAGGGGGCAGG - Intergenic
1149891260 17:60392146-60392168 AGGAGGCAGGGGAAGGGGGCGGG - Intronic
1150337662 17:64342330-64342352 CGGTGGCAGGGGAAGAGGAGTGG - Intronic
1150790141 17:68196549-68196571 TAGGGGGTGGGGAAGGGGACAGG + Intergenic
1150973094 17:70052997-70053019 TTCTGGCAGAGGAAGGGGAAAGG - Intergenic
1151285670 17:73109244-73109266 TCATGGCAGGGGATGGGGATGGG - Intergenic
1151320897 17:73351852-73351874 GTGTGGCAGGGGGAGGAGGCTGG + Intronic
1151337300 17:73447508-73447530 GAGTGGCAGAGGAGGGGGACAGG - Intronic
1151558969 17:74860840-74860862 TCGCGGCGGGGGAAGGGGTCTGG + Intronic
1151561108 17:74870156-74870178 TTGTGGAATGGGATGGGGAGGGG - Intronic
1151901354 17:77017536-77017558 CTGTGGCAGGGAGAGGGGACTGG + Intergenic
1151956022 17:77380674-77380696 TTGGGGCAGGGGAGGGGAAGCGG - Intronic
1152170770 17:78746189-78746211 ATGTGGCAGGGGGTGGGGTCAGG + Intronic
1152266118 17:79295878-79295900 CTGTGGCAGGGCATGGGGAAGGG + Intronic
1152329332 17:79662777-79662799 TTGTGGCATGGGAAGAGAAACGG + Intergenic
1152990700 18:361354-361376 TGGTGGCAGGGGAAATGGAGAGG - Intronic
1153302776 18:3606300-3606322 TTCTGGCAGGGGAAGGAAGCGGG - Intronic
1153450419 18:5221210-5221232 ATGGGGGAGGGGAAGGGGAAGGG - Intergenic
1153541112 18:6156520-6156542 CCATGGCAGGGGAAGGGAACTGG - Intronic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1153963974 18:10164402-10164424 TGGTGGCAGGTGGAGGGGAGGGG + Intergenic
1154272772 18:12934114-12934136 CTGTGGCAGGGGGAGAGGAGAGG - Intergenic
1155900030 18:31377752-31377774 TTCTGGGAGGGTAAGAGGACAGG + Intronic
1156225209 18:35098874-35098896 TTATTGCAGTGGAAGGAGACTGG + Intronic
1157324184 18:46657260-46657282 TGGTGGGAGGGGACAGGGACAGG - Intergenic
1157638252 18:49184249-49184271 TTTTGGCGGGGGAAGGGAAGTGG + Intronic
1157807972 18:50672512-50672534 TTCTGCCATGGGAAGGGGACAGG - Intronic
1158137621 18:54224295-54224317 CCGTGGCCGGGGACGGGGACGGG - Exonic
1158915331 18:62120203-62120225 TGGGGGAAGGGGAAGGGGAAGGG + Intronic
1159656726 18:71037922-71037944 TTGCAGCCGGGGAAGAGGACAGG + Intergenic
1160024476 18:75206981-75207003 TTGGGGAAGGGGAAAGGGAGGGG + Intronic
1160044753 18:75376378-75376400 TTGTTGCGGGGGTAGGTGACAGG + Intergenic
1160051399 18:75437449-75437471 ATGGGGGAGGGGAAGGGGAGAGG + Intergenic
1160488899 18:79320316-79320338 CTCTGCCAGGGGAAGGGGAGGGG + Intronic
1160774440 19:848544-848566 TTGAGGAAGGGGATGGGGATGGG + Intergenic
1160786249 19:901330-901352 TTCTGGCGGGGGACGGGCACAGG + Intronic
1161120370 19:2522284-2522306 GGGTGGCAGGGGCAGGGGCCAGG + Intronic
1161202897 19:3025668-3025690 GTGTGGGTGGGGAAGGGGGCGGG + Intronic
1161515009 19:4691579-4691601 GTGTGGCACGGGAAGGGGGGCGG + Intronic
1162298144 19:9827687-9827709 TTGTGGCCAGGGAAGGGGCGTGG - Intronic
1162646145 19:12051945-12051967 TTGGGGAAGGGGGCGGGGACTGG + Intronic
1163445255 19:17342099-17342121 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
1164533869 19:29069584-29069606 TTCTGGCAGGGGAAAGGAAAAGG + Intergenic
1165234052 19:34406128-34406150 TTTTGGCAGGGGACAGGGTCTGG - Intronic
1165319252 19:35075620-35075642 ATGTGGCATGGGTAGGGGCCCGG + Intergenic
1165369896 19:35398572-35398594 ATGAGGCAGGGGCAGGCGACTGG - Intergenic
1165534064 19:36428637-36428659 CTGGGGCAGGGGATGGGGAGGGG + Intergenic
1165879257 19:39031449-39031471 TGGTGGGAGGGGAAGGGGGCGGG - Intronic
1165902540 19:39175429-39175451 TGATGGCAGGGTGAGGGGACGGG + Exonic
1166089323 19:40497942-40497964 TTGGGGCTGGGGTAGGGGAGTGG - Intronic
1166300045 19:41908081-41908103 CTGGGGCTGGGGAAGGAGACTGG + Intronic
1166856004 19:45782873-45782895 TTGAGGCCTGGGAAGGGGACGGG + Intronic
1167107341 19:47437960-47437982 ATGCTGCAGGGGATGGGGACAGG - Exonic
1167262640 19:48467671-48467693 TAGAGGCTGGGGAAGGGGAAGGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167379991 19:49133204-49133226 GAGAGGCAGGGGGAGGGGACGGG - Intronic
1167493115 19:49803022-49803044 GTGGGGGAGGGGAACGGGACAGG + Intronic
1167608856 19:50496623-50496645 CTCTGCCTGGGGAAGGGGACAGG - Intergenic
1167964294 19:53131255-53131277 TTGGGGCAGGGGGAGGGGAAGGG - Intronic
1168273747 19:55265147-55265169 AGGTGCCAGGGGGAGGGGACAGG - Intronic
925022992 2:586850-586872 TTGGGGCAGGGGCAGGGGCAGGG - Intergenic
926060798 2:9803476-9803498 GGGTGGCAGGGGCAGGGGGCAGG - Intergenic
926309801 2:11667282-11667304 TTGTGGAAGGGGAAAGAGGCTGG - Intronic
926896676 2:17698115-17698137 TTTTGCCAGGGGATGGGAACAGG + Intronic
927616057 2:24597492-24597514 TTGTGGCAGGGGCTGGGGCTGGG + Intronic
927861857 2:26565070-26565092 TAGGGGAAGGGGAAGGGGAAGGG - Intronic
928091701 2:28378544-28378566 GTGTAGCAGAGGAAGGGAACAGG + Intergenic
928248865 2:29657097-29657119 GGGTGGCAGGGCAAGGGCACTGG - Intronic
928412343 2:31064785-31064807 TAGGGGAAGGTGAAGGGGACTGG + Intronic
928948837 2:36796481-36796503 ATGTGGTAGGGGAAAGAGACAGG + Intronic
929589200 2:43134283-43134305 TTGTTGCAGGGGAAGAGGGGCGG - Intergenic
930847467 2:55921636-55921658 TTGTAGCAGTGGGAGGGGTCAGG + Intronic
930999335 2:57761913-57761935 TTGTGGCAGGGGCATGGAAGAGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
931761817 2:65424186-65424208 TAGTGGCAGGGGAAGAGGTACGG + Intronic
931970051 2:67576108-67576130 TTTAGGAAGGGGAAAGGGACAGG + Intergenic
932092893 2:68822569-68822591 CTAAGGCAGGGGAAGGGCACAGG + Exonic
932116087 2:69049213-69049235 TTTTGGCAGGGGATGGGGATGGG - Intronic
932283840 2:70516528-70516550 TGGAGGCAGGGCAGGGGGACAGG + Intronic
932487493 2:72093471-72093493 TGGTGACAGGAGAATGGGACTGG - Intergenic
932591417 2:73070405-73070427 TTGTTGTGGTGGAAGGGGACTGG - Intronic
933782450 2:85811784-85811806 TTTCTGCAGGGGAAGGGGCCTGG - Intergenic
934555390 2:95284483-95284505 TTTTGGTTGGGGAAGCGGACAGG - Intronic
934751752 2:96798296-96798318 TTGTGGAATGGGAAGGAGAAGGG + Intronic
935066509 2:99652925-99652947 GAGAGGCAGGGGAAGAGGACCGG + Intronic
935141390 2:100355960-100355982 ATGGGGAGGGGGAAGGGGACAGG - Intergenic
935219726 2:101002197-101002219 GTGTGGCTAGGGAAGGGGAGAGG - Intronic
936153379 2:110033564-110033586 TTGCGGGAGGCGAAGGGGATGGG - Intergenic
936191302 2:110337851-110337873 TTGCGGGAGGCGAAGGGGATGGG + Intergenic
936280070 2:111131207-111131229 TTTTGGCGGGGGATGGGGGCGGG + Intronic
937198789 2:120183308-120183330 TTTTGGCAGGTGGAGGGGAGGGG - Intergenic
937242656 2:120472327-120472349 CTGTGGCAGGGGAAGAGAAAAGG - Intergenic
937291658 2:120785613-120785635 TTGGGGCAGGGGCAGGGCAGGGG - Intronic
937338672 2:121077184-121077206 CTGTGGCCGCGGAAGGGGCCGGG + Intergenic
937417923 2:121731745-121731767 GTGAGCCAGGTGAAGGGGACAGG - Intronic
937542407 2:122974219-122974241 TTGTGGGAGGGGGAGGGGGAAGG - Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937926324 2:127170454-127170476 GTGAGCCAGGTGAAGGGGACAGG + Intergenic
938382052 2:130842127-130842149 TGGAGGCAGGGAAAGGGGCCAGG + Intronic
938895103 2:135742003-135742025 TCGTGGCAGGTGAAGGAGGCAGG + Exonic
938982387 2:136539057-136539079 TTGAGGCCGGGGGAGGGGAGGGG - Intergenic
940901667 2:159131513-159131535 TGGGGGCAGGGGAAGGGGCGGGG - Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
942241094 2:173964654-173964676 GTGGGGGAGGGGAAGGGGCCTGG - Intronic
942427436 2:175874801-175874823 TGGCGGCAGGGGAAGGGGACAGG + Intergenic
942945476 2:181667539-181667561 TTGAGGGAGGGGAAAGGGGCTGG + Intronic
946245441 2:218384534-218384556 TTGTGTGGGGGGTAGGGGACTGG + Intronic
946249243 2:218402779-218402801 TTGAGGCAGGGGAAGGGATTGGG + Intronic
946413216 2:219526041-219526063 CTGTGGCAGGGGGAGGGCCCTGG - Intronic
946447127 2:219749545-219749567 TTGTTGCAGGTGAAGGGGAGAGG - Intergenic
946580822 2:221126859-221126881 TTGTGTCAGGGAAAGGGACCTGG + Intergenic
947000113 2:225444657-225444679 TTGTGGCAAGGCAAGGGAAGTGG + Intronic
947150250 2:227108123-227108145 GAGTGGCAGGGGGAGGAGACGGG + Intronic
947349285 2:229225733-229225755 TGGTGGCAGGGGAAGCAAACAGG + Intronic
947531892 2:230914642-230914664 TTGTGGGTGGGGGAGGGGAACGG + Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947982650 2:234423636-234423658 TTTTGGTGGGGGATGGGGACAGG - Intergenic
948205000 2:236158982-236159004 TTGTGGGAGGGGACGAGGTCAGG + Intergenic
948995433 2:241575997-241576019 GAGTTGCAGGGGAAGGGGAGAGG - Intergenic
1168786389 20:543545-543567 TGGGGGCAGGGGAAGGCGACGGG + Intronic
1168977694 20:1980503-1980525 AGGTGGCTGGGGAGGGGGACGGG - Exonic
1171210282 20:23311183-23311205 GAGTGGGAGGGGAGGGGGACAGG - Intergenic
1171963923 20:31515287-31515309 TTGAGGCAGGGGCAAGGGCCAGG - Intronic
1172186492 20:33034295-33034317 GTGTGGCAGGGGAGGGGCAGCGG + Intronic
1172441401 20:34968998-34969020 TTGAGGCCAGGGAAGAGGACAGG + Intergenic
1172589272 20:36105967-36105989 TGGAGGCAGGGGAAAGGGCCAGG - Intronic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1172840866 20:37902207-37902229 GTGTGGCAGGGGAGGGGGATAGG - Intergenic
1173105792 20:40132841-40132863 TTGAGGCAGGGCAAGGCGATGGG - Intergenic
1173191203 20:40876802-40876824 TGGAGGCAGGAGAAGGTGACAGG + Intergenic
1173402355 20:42736747-42736769 CCTTGGCAGGGGAAGGGGGCAGG + Intronic
1173448191 20:43138755-43138777 GTGTGGCTGTGGCAGGGGACTGG - Intronic
1173461224 20:43244897-43244919 TCTTGGCAGGTGCAGGGGACAGG - Intergenic
1173461283 20:43245269-43245291 ATGGGGATGGGGAAGGGGACAGG - Intergenic
1174012863 20:47464673-47464695 TGGTGGCAGGGGAAGGAGAATGG - Intergenic
1174125234 20:48299559-48299581 TTGTGGGATGGGAAGAGGAGGGG - Intergenic
1175299356 20:57932106-57932128 TTGTGGCAGGAGCACAGGACAGG - Intergenic
1175479398 20:59300745-59300767 TTGTGGCCGCGAAAGGGCACTGG - Exonic
1175504013 20:59469429-59469451 GTGTGGCAGGGCAGGGAGACTGG + Intergenic
1175554997 20:59845318-59845340 TTGTGGCGGGGGACGGGGGAAGG - Intronic
1175965103 20:62656482-62656504 TTGGGGCTGGGGAAGGTGAGCGG - Exonic
1176017429 20:62942497-62942519 TTATGTCAGGGGCAGGGGAAGGG + Intronic
1176214544 20:63941923-63941945 GTGTGGCAGGGGAAGGAAAGAGG + Intronic
1176293536 21:5058883-5058905 TAGGGGGAGGGGAAGGGGATGGG - Intergenic
1176303180 21:5108583-5108605 ATGTGGCTGGGGAAGGGGTGTGG - Intergenic
1177249383 21:18572288-18572310 TGGTGGAAGGGGAAGGGGAGGGG + Intergenic
1178262417 21:31112136-31112158 TTTTGGCGGTGGAGGGGGACAGG - Intergenic
1178356448 21:31913574-31913596 TTGGGGCCGGGGGAGGTGACAGG + Intronic
1178764580 21:35438167-35438189 TGGTGGCAGTGGAAGGAGACTGG - Intronic
1178790682 21:35697322-35697344 TTGAGGGAGAGGAAGGGGAGGGG - Intronic
1178951984 21:36992806-36992828 TGGTGCCAGGGGAGGGGGAGTGG - Intergenic
1179853845 21:44153341-44153363 ATGTGGCTGGGGAAGGGGTGTGG + Intergenic
1179863724 21:44204765-44204787 TAGGGGGAGGGGAAGGGGATGGG + Intergenic
1179881887 21:44296477-44296499 CTGAGGCAGGGGAGGGGGAGTGG - Intronic
1180094449 21:45549621-45549643 ATGTGGCAGGGGAGGGGCAGGGG + Intergenic
1180094499 21:45549730-45549752 GTGGGGGAGGGGCAGGGGACAGG + Intergenic
1180182692 21:46124943-46124965 TTTTGGCAGGAGAAGGACACTGG - Intronic
1180552713 22:16553530-16553552 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1181503881 22:23337856-23337878 TGCTGGCAGGGGAGGGCGACAGG + Intergenic
1181654718 22:24287391-24287413 TGCTGGCAGGGGAGGGCGACAGG + Intronic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1181708870 22:24668076-24668098 TGCTGGCAGGGGAGGGCGACAGG + Intergenic
1182517204 22:30865679-30865701 TTGCGTCAGTGGAAGGTGACCGG + Intronic
1182548405 22:31088619-31088641 CTGGGGCAGGGGATGGGGGCAGG + Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1182757777 22:32694284-32694306 ATGTGGCAGGGGAAGGGATATGG - Intronic
1183082456 22:35465239-35465261 TGGTTGCAGGGCAAAGGGACTGG + Intergenic
1183269166 22:36850017-36850039 CTGTGGCAGGCCAAGGAGACAGG + Intergenic
1183413257 22:37667713-37667735 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
1183483195 22:38075980-38076002 TGGGGGCGGGGGAAGGGGGCGGG - Intergenic
1183770142 22:39917378-39917400 ATCTGGCAGGTGAAGGGGAGAGG - Intronic
1183942156 22:41301996-41302018 TTGGGGCAGGGCACGGGGACCGG - Intronic
1184331412 22:43830210-43830232 TGGTGGCAGGGCAAGGGAAAGGG - Intronic
1184507823 22:44914700-44914722 TGGTGGATGGGGAAGGGGAAGGG + Intronic
1184683766 22:46086690-46086712 ATGTGGCAGGGAAATGGAACTGG - Intronic
1185143575 22:49117242-49117264 TTGGGGCAGGGGCAGGGGTCGGG + Intergenic
950258920 3:11529759-11529781 TGGTAGCAGTGGGAGGGGACAGG + Intronic
951017441 3:17745836-17745858 GGGTGGCAGGGGAGGGGGAGCGG - Intronic
952000977 3:28785433-28785455 TCATGGCATGGAAAGGGGACAGG - Intergenic
952316537 3:32237832-32237854 TCCTGGCATGGGAAGGGGATGGG - Intergenic
952455343 3:33467035-33467057 GTGTGGGAGGGGGAGGGGGCTGG + Intergenic
953863040 3:46561559-46561581 GGTTGGCAGGGGAAGGGGCCGGG + Intronic
953986031 3:47443746-47443768 TTATGGAAGGGGACGGGTACTGG - Intronic
954214700 3:49117904-49117926 TTGTTGCTAGGGAAGGGGAGGGG - Intronic
954660394 3:52223981-52224003 ATGTGGCAGGGGAAGTGCATGGG + Exonic
954750579 3:52811224-52811246 AGGTGGAAGGGGAGGGGGACCGG - Intergenic
954802282 3:53194173-53194195 TTGTGGCAGAGGCAGGGAACAGG - Intergenic
955470626 3:59282669-59282691 TTGTGGCCTGGGAAGGTGGCAGG + Intergenic
955687472 3:61561770-61561792 TTGCGAGAGGGGAAGGGGAGGGG - Intronic
956576895 3:70761508-70761530 TGGTGGCAGGGGAATAGGGCAGG + Intergenic
956725067 3:72150264-72150286 TTGTGGTAGGAGAATGGCACTGG - Intergenic
956880783 3:73508821-73508843 TTATGGCTAGGGAAGTGGACAGG - Intronic
957258875 3:77874688-77874710 ATGTTGAAGGGGAAGGGGTCAGG + Intergenic
957485072 3:80850301-80850323 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
958201090 3:90315131-90315153 TTGTGGTGGGGCAAGGGGAGAGG + Intergenic
959095539 3:101951395-101951417 GTGGGGCAGGGGTAGGGGAGTGG + Intergenic
959466856 3:106698951-106698973 TGGTAGCAGGGGTTGGGGACTGG + Intergenic
959739636 3:109702431-109702453 TTGTGGGAGGGGAATGAGAATGG + Intergenic
961511915 3:127408570-127408592 ATGTGGCCCGGGAAGGGGATGGG + Intergenic
961512873 3:127413731-127413753 TTATGGCAGGGGAGGGGAAGGGG - Intergenic
961533200 3:127552650-127552672 TTGTCCCTGGGGAAGGGAACTGG - Intergenic
961919199 3:130408275-130408297 TGGTGGCAGGGGGTGGGGGCGGG + Intronic
962398203 3:135035795-135035817 TTGTGGCAGGGTCAGGTGACTGG + Intronic
962481644 3:135803215-135803237 TAGCGGAGGGGGAAGGGGACAGG - Intergenic
962965380 3:140348879-140348901 TTGTGCCAGAAGCAGGGGACTGG - Intronic
963603290 3:147394963-147394985 TGGGGGCGGGAGAAGGGGACTGG - Intronic
964369131 3:155981218-155981240 TTGTGGCAGGGGTCGGGGGCGGG + Intergenic
964549156 3:157867752-157867774 GTGTGGCGGTGGAAAGGGACAGG - Intergenic
964833299 3:160910172-160910194 AAGGGGAAGGGGAAGGGGACAGG - Intronic
964966292 3:162497158-162497180 TGGTGGAAGGGGAAGGGGAAGGG + Intergenic
965210354 3:165779006-165779028 TTGTGGGTGGGGAGGGTGACTGG - Intronic
965360600 3:167734685-167734707 TTCTGGCAGGCGGAGCGGACGGG - Exonic
965512628 3:169585275-169585297 TTAATGCAGGGGAATGGGACAGG + Intronic
966183144 3:177204784-177204806 GAGTGGCAGGAGACGGGGACAGG + Intergenic
966711805 3:182980147-182980169 TTGGGGCGGGGGGAGGGGAGGGG - Intronic
966840603 3:184084028-184084050 TCGTGGAGTGGGAAGGGGACAGG - Intergenic
967185759 3:186943243-186943265 TTGAGGCAGGGGAAGGCTGCAGG + Intronic
967194494 3:187014641-187014663 TTGTGGGGAGGGAAGGGCACTGG + Intronic
967387511 3:188926127-188926149 TTGTGGGATGGGAAGGGAAAAGG - Intergenic
968128453 3:196177352-196177374 TTGAGGGAGGGAAAGGTGACTGG - Intergenic
968582677 4:1402302-1402324 GTGGGGCAGGGGAGTGGGACCGG + Intergenic
968599547 4:1502530-1502552 TGGTGGCAGAGGCAGGGGATGGG + Intergenic
968739494 4:2320126-2320148 GTGGGGGAGGGGAGGGGGACAGG - Intronic
968846093 4:3042260-3042282 TTGTACGAGGGGAAGGGGAAGGG + Intergenic
968944953 4:3658719-3658741 TTAGGGGAAGGGAAGGGGACCGG - Intergenic
968962550 4:3752911-3752933 TGGTGGGAGGGGACAGGGACAGG - Intergenic
969302351 4:6304545-6304567 GTGGCCCAGGGGAAGGGGACAGG - Intergenic
969482996 4:7456765-7456787 CTGTGGCAGGGGTAGGGGGGTGG + Intronic
969615082 4:8247502-8247524 TGGGGACAGGGCAAGGGGACTGG - Intergenic
970392633 4:15631064-15631086 CTGTGGTGGGGGTAGGGGACTGG - Intronic
971305123 4:25473307-25473329 AAGGGGAAGGGGAAGGGGACGGG + Intergenic
971466535 4:26969253-26969275 TTGTGGAAGGGGATGGAGGCGGG + Intronic
971467663 4:26981555-26981577 TGGTGGCACTGGAAGGGGAGCGG - Intronic
971766064 4:30833561-30833583 TGGTGGCAGGGGGTGGGGATGGG - Intronic
972117180 4:35650915-35650937 GTGGGGCAGGGGAAGGGGGGAGG + Intergenic
972269180 4:37493495-37493517 GAGTGGCAGGGAAAGGGGAGAGG - Intronic
973981287 4:56310266-56310288 GTGTGGCTGGAGAAGGGGAGAGG + Intronic
974231174 4:59116192-59116214 ATCTGGCAGGGTAAGGGGGCAGG - Intergenic
974488846 4:62537888-62537910 TCCTGGCAGGGGAAGGGGAAAGG + Intergenic
974969364 4:68805204-68805226 TTGTTTCAGGGGAGGGGGAAGGG - Intergenic
974981556 4:68963919-68963941 TTGTTACAGTGGAAGGTGACTGG + Intergenic
975361569 4:73477053-73477075 TTGGTGCAAGGGAAGGGTACTGG + Intergenic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
975915313 4:79318046-79318068 TTCTGCCAGGAGAAAGGGACAGG + Intronic
976252734 4:83069864-83069886 TGGTGGGAGGGGAAAGGGAAAGG - Intronic
976401832 4:84615578-84615600 CTGTGGCAGGGGGAGGGGGTGGG - Intronic
976753860 4:88477545-88477567 GTGGGGGAGGGGAAGGGGAAGGG + Intronic
977890043 4:102299126-102299148 GAGTGGGAGGAGAAGGGGACTGG - Intronic
978567818 4:110102909-110102931 TTGTGGGAGGGATGGGGGACGGG + Intronic
978659584 4:111108554-111108576 CTCTGGCAGGGGAGAGGGACCGG + Intergenic
980208699 4:129756406-129756428 TAGTGGCAGGGGAAGGAGGAGGG - Intergenic
980576351 4:134687744-134687766 TGGTGGCAGGGGCAGGGCACTGG + Intergenic
980897699 4:138875570-138875592 TCTGGGAAGGGGAAGGGGACAGG + Intergenic
981354249 4:143768982-143769004 TTGTGGTGGGGGAAGGGCAAAGG - Intergenic
981550462 4:145937232-145937254 GTGGAGGAGGGGAAGGGGACCGG + Intronic
981782588 4:148444550-148444572 CTGGGGCGGGGGAAGGGGAACGG + Intronic
982134401 4:152259497-152259519 CTGTGGCAGGGGGAGGGGCATGG - Intergenic
982280692 4:153681216-153681238 TGGGGGCAGGGGAAGGGAGCAGG - Intergenic
982410489 4:155071035-155071057 TGGTGGCCGGGGGAGGGGGCGGG - Intergenic
982619500 4:157685975-157685997 TTGGGGCTGGGGTGGGGGACGGG + Intergenic
983252609 4:165361716-165361738 TTTTGGCAGGGGGAGGAGAGAGG + Intronic
983466666 4:168101495-168101517 TTTTTGGGGGGGAAGGGGACGGG + Intronic
983656143 4:170086915-170086937 TTGTGGCCGGGGATGGGCAAGGG - Intronic
984490768 4:180431765-180431787 CTGTGGCGGGGGAACGGGGCAGG + Intergenic
984668331 4:182452323-182452345 TTTTGGCAGGGGACGGGGGGCGG + Intronic
984708359 4:182864108-182864130 TTGTGGAAGGGGGTGGGGAGGGG - Intergenic
984727304 4:183034205-183034227 TTGGGGTAGGGGAAGGGGGGAGG - Intergenic
985544035 5:500393-500415 GGGTGGCAGGAGACGGGGACGGG + Intronic
985690114 5:1304252-1304274 AAGTGGAAGGGGAAGGGGAAGGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985909017 5:2864492-2864514 AAGTAGCAGTGGAAGGGGACTGG + Intergenic
986154578 5:5161858-5161880 TAATGGCTGGGGCAGGGGACAGG + Intronic
986174084 5:5337129-5337151 TGGTGCCGGGGGAAGGGGAAAGG + Intergenic
986831304 5:11581849-11581871 GTGGGGCATGGGAAGGGGAAGGG + Intronic
987423638 5:17749087-17749109 TTTTGGCAGGGGTAGGGGTGGGG + Intergenic
988735980 5:34021758-34021780 CTGTGGCAGGGTGAGGGGAAAGG + Intronic
988927487 5:36004256-36004278 TTGAGGCAGGGGTGGGGGATTGG - Intergenic
989164558 5:38421846-38421868 TTGTTCCAGGGGAAGAGGAAGGG + Intronic
989983260 5:50667357-50667379 GTGGGGGAGGGGAAGGGGAGAGG - Intronic
990304345 5:54480171-54480193 TGGTGGAAGGGGAAGGGAAAGGG - Intergenic
990475544 5:56158697-56158719 TTTTTGGAGGGGAGGGGGACAGG + Intronic
990876129 5:60488271-60488293 TTGTCGGAGGGGAAAAGGACAGG + Intronic
991414052 5:66373360-66373382 TAGCAGCAGGGGAGGGGGACTGG - Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
992087470 5:73290927-73290949 TTTTGGTAGGGGATGGGGCCAGG + Intergenic
992087890 5:73294473-73294495 TTGGGGGATGGGAAGGGGAAAGG + Intergenic
992365079 5:76083047-76083069 TTGTAGCAGGTGAAGGAGAGGGG - Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992673545 5:79083085-79083107 TTGTGGGAGGTGGAGGGGAATGG + Intronic
992683042 5:79172066-79172088 TAGTGGCAGAGAAATGGGACAGG - Intronic
993701926 5:91128684-91128706 GGGTGGCAGGGGGAGGGGGCAGG + Intronic
994145651 5:96392225-96392247 TTGTGGCTGAGAAAGGAGACAGG + Exonic
994166561 5:96615368-96615390 TTATGGCAGAGTAAGGGGAGAGG - Intronic
994675321 5:102814023-102814045 CTGTGGTAGGGGCAGGAGACTGG + Intronic
995558866 5:113359247-113359269 TTGGGGTGGGGGAAGGGGAGAGG - Intronic
996070976 5:119131273-119131295 TTGGGGGAGGGTGAGGGGACTGG + Intronic
996801579 5:127409397-127409419 TTCTGCCAAGGGAAGGAGACAGG - Intronic
997111413 5:131078969-131078991 CTCTGGCAGGGGATGGGGGCAGG - Intergenic
997275774 5:132587293-132587315 TTGTGGCAGGTGTTGAGGACAGG + Intronic
997641977 5:135455361-135455383 TTGTGGCTAGGCCAGGGGACTGG - Intergenic
997652049 5:135529515-135529537 TTATGGCAAGGGTAGGGGAAGGG - Intergenic
998160591 5:139810792-139810814 GTGGGGAAGGGGCAGGGGACTGG + Intronic
998161003 5:139813009-139813031 GCGGGGCAGGGGCAGGGGACTGG + Intronic
999246911 5:150159981-150160003 GTGGGGCAGGGGGAGGGAACCGG + Intergenic
999320851 5:150614276-150614298 GTGTGGTGGGGGAAGGGCACTGG - Intronic
999712688 5:154332424-154332446 TTCAGGCAGAGGAAGGGCACAGG - Intronic
999991911 5:157057815-157057837 ATGGGGTAGGGGAAGGGGAGGGG - Intronic
1000096777 5:157978222-157978244 GAATGGCAGGGGCAGGGGACAGG + Intergenic
1000105997 5:158059249-158059271 TTGTGGCAGGAGAACAGGAAAGG - Intergenic
1000185263 5:158851933-158851955 GAGGGGCAGGGGAAGGGGAGGGG + Intronic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001483030 5:172101677-172101699 GTAGGGCAGGGAAAGGGGACTGG + Intronic
1002388280 5:178887897-178887919 TTCTGGCAGGGGCAGGGGTGGGG - Intronic
1002436434 5:179234627-179234649 TTGGGGTAGGGAAAGGTGACAGG - Intronic
1002927601 6:1614102-1614124 TCGGGGCGGGGGAAGGGGAGGGG + Intergenic
1003116118 6:3284819-3284841 TGGTGCCAGGGGAAGGGGCGGGG + Intronic
1004757128 6:18622621-18622643 TTTTGGTAGGGGAAGTAGACAGG + Intergenic
1005417704 6:25619333-25619355 TTGGGGGAGGGGAGGGGGCCAGG - Intronic
1005560834 6:27039278-27039300 TTGTGGAAGAGGAAGGTGCCAGG - Intergenic
1005899355 6:30204578-30204600 TTGTGTATGGGGAAGGGGAGCGG - Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006295857 6:33169780-33169802 TTGAGGCGGGTGACGGGGACTGG + Intronic
1006365783 6:33614373-33614395 CTGGGGCCGGGGAAGGGGACTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006429904 6:33989038-33989060 GTGTCACAGGGGACGGGGACTGG - Intergenic
1007211112 6:40194053-40194075 TTGTAGCAGGGAAAGGAGGCTGG - Intergenic
1007576525 6:42928641-42928663 TTGTTGCTGGGGAAGCGGAAGGG + Intergenic
1008860059 6:56138393-56138415 ATGAGGAAGGGGAAGAGGACAGG + Intronic
1009244368 6:61217342-61217364 TTGTGGCAGAAGTAGGGGAGTGG + Intergenic
1009621582 6:66084819-66084841 TTGGTGCAGGGGCAGGGCACTGG + Intergenic
1009787912 6:68362278-68362300 GTGTGTCAGGGGATGGGGGCAGG + Intergenic
1010729725 6:79378047-79378069 TTGGGGGAGGGGAAAGGGTCAGG + Intergenic
1011180958 6:84620181-84620203 ATGGGGGAGGGGATGGGGACAGG - Intergenic
1011535853 6:88375284-88375306 CTCTGGCAGGGGAAGGGTCCTGG + Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1011975060 6:93285715-93285737 ATGTGGCAAGAGAAGGAGACAGG - Intronic
1012386340 6:98687661-98687683 TTGTGGTTGGAGGAGGGGACAGG + Intergenic
1012520925 6:100120206-100120228 TTGGGGCTGGGGAAAGGGTCTGG + Intergenic
1013068978 6:106711176-106711198 AAGGGGCAGGGGAAGGGGACTGG - Intergenic
1013113792 6:107085404-107085426 TTCTGGCAGGGGGAGGGGAAAGG + Intronic
1013653874 6:112224964-112224986 TTTTGGCAGGGGACGGGGAAGGG + Intronic
1014061962 6:117082029-117082051 ATGGGGTAGGGGAAGGGGAGAGG + Intergenic
1014125842 6:117776273-117776295 TGGAGGGAGGGGAAGGGGAATGG - Intergenic
1014189370 6:118475176-118475198 TTATGGCTGGGGAAGTGGATGGG + Intronic
1014456593 6:121642063-121642085 ATATGGCAGCTGAAGGGGACTGG + Intergenic
1015741314 6:136457324-136457346 TTGGGGCAGGGGATGGGGGCGGG - Intronic
1016922206 6:149306815-149306837 TTGTGGGTGGGGATGGGGAGAGG + Intronic
1016932899 6:149427306-149427328 TTTTGGCAGGGGATGGGGGTTGG + Intergenic
1017464586 6:154682649-154682671 GTGTGGCAGGGGATGGGTTCGGG - Intergenic
1017571118 6:155745440-155745462 ATGTGGTAGGGGGAGGGGAGTGG + Intergenic
1018248160 6:161841941-161841963 TTGCAGCAGGGGAAGGAGATTGG - Intronic
1018730735 6:166648502-166648524 AGCTGGCACGGGAAGGGGACGGG + Intronic
1018754501 6:166837540-166837562 TTCTCGCAGGGGGAGGGGACTGG - Intronic
1019207976 6:170378634-170378656 TTCTAGCAGGGGAAATGGACAGG + Intronic
1019440174 7:1041952-1041974 ATGCGGCAGGGGAAGGGGAAGGG + Intronic
1019521443 7:1462273-1462295 TTGTTGGAGAGGAAGGGGAAAGG + Intergenic
1019691896 7:2419866-2419888 TGGGGGCAGGGGAGGGGGATGGG - Intronic
1020461092 7:8431036-8431058 TTTTGGCAGGGGAGAGGGAAGGG - Intergenic
1020667724 7:11068778-11068800 TAGTGGCAGGGAAAGGGGCTGGG + Intronic
1021272516 7:18608286-18608308 GAGTGGGAGGGGAGGGGGACTGG + Intronic
1021332895 7:19360405-19360427 TCGGGGCAGGGGAGGGGGATAGG - Intergenic
1022023193 7:26421300-26421322 TCGTGTCTGGGGAAGGGGCCGGG - Intergenic
1022598113 7:31731809-31731831 TTCTGGCAGAGGGAGAGGACAGG + Intergenic
1022884046 7:34623169-34623191 TAGTGGGAGGAGAAGGGGAGAGG + Intergenic
1024437787 7:49379768-49379790 TTGTGGTGGGGGAGGGGGAAGGG - Intergenic
1024577089 7:50773399-50773421 AAGGGGAAGGGGAAGGGGACGGG + Intronic
1025092882 7:56077982-56078004 CTGGGGAAGGGGAAGGGCACGGG - Intronic
1025597457 7:62949256-62949278 GTGGGGTAGGGGAAGGGGGCAGG - Intergenic
1025605661 7:63038328-63038350 TTGGGGCAGTGGAAGAGGAGGGG + Intergenic
1026501759 7:70948684-70948706 TGGTGGAAGGTGAAGGGGGCCGG - Intergenic
1026508925 7:71011204-71011226 TGTTGGCTGGGGAAGGGGAGTGG - Intergenic
1026580079 7:71608359-71608381 TTGGGGGAGGGGGAAGGGACAGG + Intronic
1026735181 7:72944779-72944801 TGGTGGCAGGGGTCGGGGAGAGG + Intronic
1026785522 7:73299708-73299730 TGGTGGCAGGGGTCGGGGAGAGG + Intergenic
1026994570 7:74606977-74606999 TTGGAGCAGGGGAAGGGGGTGGG - Intergenic
1027108550 7:75420228-75420250 TGGTGGCAGGGGTCGGGGAGAGG - Intronic
1027653783 7:80903896-80903918 TGGTGGTAGGGGTAGGGGAGTGG - Intronic
1027941789 7:84691518-84691540 TGGTGGAAGGTGAAGGGGAGCGG - Intergenic
1028743111 7:94298690-94298712 TATGGGCAGGGGAAGGGGAGAGG - Intergenic
1029116707 7:98241362-98241384 TTTTGGCCGGGGTAGGGGGCAGG - Intronic
1029154788 7:98508718-98508740 ATGTGGCAGATGAATGGGACAGG + Intergenic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1029709416 7:102291509-102291531 TTCTGGCTGGCGATGGGGACAGG - Intronic
1030902399 7:115140615-115140637 TCGTGGAAGGGGAAGGAGAACGG - Intergenic
1031462834 7:122072810-122072832 GTGGGGTAGGGGAAGGGGAGAGG - Intergenic
1031737880 7:125389581-125389603 TTGTGGGAGGGTAAGGTGATTGG + Intergenic
1031937776 7:127753475-127753497 TGGTGGCAGGGGAAGAGGAAAGG - Intronic
1031985853 7:128164370-128164392 TGGGGCCAGGGGAAGGGGGCTGG - Intergenic
1032075389 7:128833501-128833523 TTGGGGCAGGAGAAGGGCAGTGG - Intronic
1032436212 7:131902382-131902404 TAGTGGAAGGGGAAGGGAAAGGG - Intergenic
1032548338 7:132762024-132762046 TTGGGGCTGGGGATGGGGAAGGG + Intergenic
1033053127 7:138024894-138024916 TCGTGGCAGGGTCAGGGGAGGGG - Intronic
1033594532 7:142847783-142847805 TTGTGGCAGGAGAAGGGAAGGGG + Intergenic
1033707171 7:143901522-143901544 TTGTGGTGGGGGAAGGGACCTGG - Intronic
1033825652 7:145186871-145186893 TGGAGGGAGGGGAAGGGGAGGGG - Intergenic
1033840669 7:145369960-145369982 TTGTGGGTGGGGAAGGGGTCTGG + Intergenic
1034085870 7:148322025-148322047 TTGGGGTGGGGGAGGGGGACGGG - Intronic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1035053829 7:156020357-156020379 TTGGAGCAGGGGTAGGGGGCAGG + Intergenic
1035676949 8:1462687-1462709 GGGTGGCTGGGGAAGGGGAAGGG + Intergenic
1036658899 8:10695089-10695111 ATGGGGGAGGGGAAGGGGAATGG + Intronic
1036760108 8:11502858-11502880 CGGTGGCAGGGGAAGGGGGGTGG + Intronic
1036793887 8:11741887-11741909 TTGCCGCTGGGGAAGGGGTCAGG + Intronic
1037734834 8:21557424-21557446 TTGTGGCTGTGGAATAGGACAGG - Intergenic
1037778075 8:21848896-21848918 AGGTGGCAGGGGATGGGGAAAGG - Intergenic
1037801739 8:22039793-22039815 TTGGGGCAGGGGAAGGGCAAAGG - Intergenic
1038577850 8:28720666-28720688 TGGTGGCGGGGCAAGGAGACAGG + Intronic
1039209456 8:35196124-35196146 TTGTCCCAGGGGAAGCTGACTGG + Intergenic
1039290148 8:36085888-36085910 GTGTGGCAGGGGAAGGGAACAGG + Intergenic
1039380445 8:37079966-37079988 TTGTGGCCTGGGCTGGGGACTGG - Intergenic
1039493163 8:37963036-37963058 TTGTAGCTGGGGAAGGTGAGTGG + Exonic
1040112117 8:43571202-43571224 GTCTTCCAGGGGAAGGGGACAGG - Intergenic
1041354768 8:56988827-56988849 TTGTTGCTGGTGAAGGGGAGTGG - Intronic
1041588400 8:59547372-59547394 GTGGGGCAGGGGAGGGGGAGGGG - Intergenic
1041774816 8:61512198-61512220 TTTTAGCAGGGAAGGGGGACAGG - Intronic
1042077787 8:65015318-65015340 TTGTGGCAGGGGCAGAGGTGGGG - Intergenic
1042448901 8:68922003-68922025 TTCTGGCTGGGGATGGGGCCAGG - Intergenic
1043043346 8:75290007-75290029 TTGTTGAAGGGGAAGGGAATAGG + Intergenic
1043477846 8:80622431-80622453 TTGAGGCAGGGCCAGGAGACTGG + Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1045178158 8:99749370-99749392 TTGGGGCAGGGGAAGGGAGGTGG - Intronic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1045941299 8:107741417-107741439 TTTTGGCAGGGGATGGGAAGGGG + Intergenic
1046195395 8:110857544-110857566 CTTTGGCAGGGCAAGGGGAGTGG + Intergenic
1046885192 8:119359059-119359081 ATGTGGAAGGAGAAGGGGAGGGG + Intergenic
1047311160 8:123693281-123693303 TTGAGGCAGGGGAAGGCCGCTGG - Exonic
1047491906 8:125382135-125382157 TTTTGGCAGGGGCAGGGGTGGGG - Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1047754058 8:127905107-127905129 TTGAGGCTGGGGAAGGGCAGGGG - Intergenic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049122521 8:140751811-140751833 TTGTAGCAGGACAAGGGGAATGG + Intronic
1049745213 8:144260384-144260406 TTGGGGCAGGGGGAGGGAAGAGG + Intronic
1049998924 9:1055559-1055581 TGGTATCAGGGGAAGGGGCCTGG + Intronic
1050417178 9:5429949-5429971 TTGTGGCAGGGGGAGAGGGTGGG - Intronic
1051512679 9:17896520-17896542 TTGTGGAAGGGGACGGAAACAGG + Intergenic
1052078251 9:24171944-24171966 GTGTGGCAGGGGGAGGGGAGTGG + Intergenic
1052247103 9:26349092-26349114 TAGTTTCAGGGGAAGGGGAAGGG - Intergenic
1052287722 9:26805839-26805861 GTGTGTCAGGGGACGAGGACTGG - Intergenic
1053348546 9:37395994-37396016 GTGTGGGAGGGGAGGGGGCCGGG - Intergenic
1053409668 9:37907392-37907414 CTGGGGCAGGGGAATGGGGCCGG - Intronic
1053672244 9:40378095-40378117 GTGGGGCAGGGGGAGGGGGCAGG + Intergenic
1054383355 9:64518129-64518151 GTGGGGCAGGGGGAGGGGGCAGG + Intergenic
1054512380 9:65998215-65998237 GTGGGGCAGGGGGAGGGGGCAGG - Intergenic
1055243072 9:74207676-74207698 TCATGGCAGGAGAAGAGGACTGG - Intergenic
1055758001 9:79574725-79574747 TTATGGAAAGGGAAGGGGAAAGG - Intronic
1055775117 9:79759564-79759586 TTGGGGCAGGGAAGGAGGACAGG + Intergenic
1055825465 9:80318930-80318952 TGGTGGCAGTGCAAGGAGACTGG - Intergenic
1056646971 9:88421602-88421624 TTGGGGCGGGGGGAGGGGGCTGG - Intronic
1057410189 9:94811018-94811040 ATGTGACAGGGGTAGGGGGCAGG - Intronic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1059451360 9:114373072-114373094 CTGTGGCAGGGGCAGGGTCCTGG + Intronic
1059683218 9:116606310-116606332 TGGGGGCAGGGGTAGGAGACAGG + Intronic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059889588 9:118786548-118786570 TGGTGGCAGGAGAAGGGGGTTGG + Intergenic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060163935 9:121392976-121392998 TGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1060206021 9:121683320-121683342 TTGGGGCTGGGGAAGGGAGCAGG - Intronic
1061240995 9:129372308-129372330 TTGTGGCAAGGCAGGGGGGCAGG + Intergenic
1061379114 9:130243693-130243715 CTGAGGCAGGGGCAGGGGTCTGG + Intergenic
1061871237 9:133521904-133521926 TCCTGGCAGGGCAAGGGCACAGG - Intronic
1061943498 9:133895125-133895147 AAGGGGCAGGGGAGGGGGACAGG + Intronic
1061987990 9:134141332-134141354 GGGAGGGAGGGGAAGGGGACTGG + Intronic
1062105704 9:134753750-134753772 GAGGGGCAGGGGGAGGGGACAGG - Intronic
1062252565 9:135605620-135605642 GTGTGGCAGGGGAGGGTGATTGG + Intergenic
1062267650 9:135694732-135694754 GTGTGGGAGGGGGAGGGGAGGGG - Intronic
1062314705 9:135960996-135961018 TGGGGGCAGGGGAGGGGGCCCGG + Intronic
1062493773 9:136822062-136822084 TTGAGGTAGAGGGAGGGGACTGG + Intronic
1062645798 9:137547501-137547523 ATGAGCCAGGGGATGGGGACAGG + Intronic
1185532896 X:835845-835867 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1186036804 X:5431896-5431918 TTGTGGGAGGGGTGGGGGAGTGG - Intergenic
1187214305 X:17261327-17261349 TTTTGGAAGGGGAAGGGTACAGG + Intergenic
1187297258 X:18013786-18013808 TTTTGCCAGGGGAACGGGAAAGG - Intergenic
1187391928 X:18891731-18891753 TTGTGGGATGGGGAGGGAACAGG + Intergenic
1187419612 X:19122714-19122736 TCGGGGCAGGGGCAGGGGCCGGG + Intergenic
1187805030 X:23110432-23110454 TTGTGGGAGGGAAAGGGGGAGGG - Intergenic
1188788796 X:34382426-34382448 TTGTGGTGGGAGAAGGGGAAGGG + Intergenic
1189363416 X:40370422-40370444 CTGGGGCAGGGGACGGGGAGAGG - Intergenic
1189407885 X:40741995-40742017 TTGTGGAGGGGAGAGGGGACAGG + Intergenic
1192269445 X:69565004-69565026 TTGTGGCTGGAGTAGGGGGCAGG + Intergenic
1192321859 X:70096263-70096285 ATGTGCCAGGTGAAGGAGACTGG - Intergenic
1192369057 X:70498436-70498458 TCCTGGCAGGGGAGGGGTACGGG + Intronic
1193850875 X:86536070-86536092 TAGTTTCAGGGGAAGGGGAAGGG + Intronic
1195270176 X:103221030-103221052 TGGTGGTTGGGGAAGGGGGCGGG - Intergenic
1196243143 X:113366770-113366792 TGCTGCCAGGGGAAGGGGAGAGG + Intergenic
1198152851 X:133928102-133928124 TTGGGGCAGGGGAAAGGAAATGG - Intronic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198605417 X:138332051-138332073 TTGTGGAAGGAGAAGAGGCCAGG - Intergenic
1199138227 X:144278593-144278615 GTGTGGCATGGGAAGAAGACAGG + Intergenic
1199786618 X:151112013-151112035 TTGTGGCATGGGATGGGGGCAGG + Intergenic
1200175610 X:154113862-154113884 TTCTGGCAGGGGGAGGGAAAAGG - Intergenic
1201403017 Y:13623505-13623527 GTGTGGCTGGGGAAGGGGGGAGG - Intergenic
1202021122 Y:20466210-20466232 TTGTGACATGGGAAGAGGAGAGG + Intergenic