ID: 975614996

View in Genome Browser
Species Human (GRCh38)
Location 4:76237269-76237291
Sequence CCTGAGGCATGATGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 265}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975614996_975615005 21 Left 975614996 4:76237269-76237291 CCCACTTCCCATCATGCCTCAGG 0: 1
1: 0
2: 3
3: 30
4: 265
Right 975615005 4:76237313-76237335 GCTGAGAAAGTCCATTCAGATGG 0: 2
1: 0
2: 7
3: 100
4: 269
975614996_975615008 29 Left 975614996 4:76237269-76237291 CCCACTTCCCATCATGCCTCAGG 0: 1
1: 0
2: 3
3: 30
4: 265
Right 975615008 4:76237321-76237343 AGTCCATTCAGATGGTTGAGGGG 0: 15
1: 63
2: 135
3: 218
4: 357
975614996_975615007 28 Left 975614996 4:76237269-76237291 CCCACTTCCCATCATGCCTCAGG 0: 1
1: 0
2: 3
3: 30
4: 265
Right 975615007 4:76237320-76237342 AAGTCCATTCAGATGGTTGAGGG No data
975614996_975615002 -1 Left 975614996 4:76237269-76237291 CCCACTTCCCATCATGCCTCAGG 0: 1
1: 0
2: 3
3: 30
4: 265
Right 975615002 4:76237291-76237313 GTTTAATTTTAAAAGTGCCCTGG 0: 1
1: 3
2: 42
3: 88
4: 374
975614996_975615006 27 Left 975614996 4:76237269-76237291 CCCACTTCCCATCATGCCTCAGG 0: 1
1: 0
2: 3
3: 30
4: 265
Right 975615006 4:76237319-76237341 AAAGTCCATTCAGATGGTTGAGG 0: 15
1: 61
2: 128
3: 186
4: 462

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975614996 Original CRISPR CCTGAGGCATGATGGGAAGT GGG (reversed) Intronic
900127621 1:1075494-1075516 CCCAAGGGATGCTGGGAAGTGGG + Intergenic
902557884 1:17257740-17257762 TCTGAGGGAAGATGGGAAGCGGG + Intronic
903381953 1:22903287-22903309 CCTGAGTCATGTTGGGAGGGAGG + Intronic
903686774 1:25137420-25137442 CCTGGGTCAGGAAGGGAAGTGGG - Intergenic
903758798 1:25683627-25683649 CCTGAAGGAAGATGGGCAGTTGG + Intronic
904961212 1:34334494-34334516 CCTGGGGCATGAAGGCAATTGGG + Intergenic
907592537 1:55689439-55689461 CCAGAGGCAGGATTGGAACTCGG + Intergenic
907636296 1:56137677-56137699 CCTGTGGCAAGAAGGGAAGTAGG - Intergenic
908269211 1:62406786-62406808 CATGTGGCATGAAGGGAAGGAGG - Intergenic
909547856 1:76867875-76867897 CCAGAGCCAGGATGGGAACTCGG + Intronic
909555944 1:76954364-76954386 ACTGAGGCCTGTTGGAAAGTGGG + Intronic
911429006 1:97759307-97759329 CCAGAAACATGAAGGGAAGTAGG - Intronic
911707728 1:101033751-101033773 GCAGAGGCATAATGAGAAGTGGG - Intergenic
912496991 1:110098230-110098252 AATGAGGGATGATGGGAAGGAGG - Intergenic
912666769 1:111588107-111588129 CCTGAGGCAGGAAGAGAAGCAGG - Intronic
912700320 1:111873404-111873426 CCTGTGGCATGATAGGTGGTGGG + Intronic
914677676 1:149917015-149917037 GCTGAGGCAAGATGGGGTGTGGG - Intronic
915588350 1:156857336-156857358 GCAGGGGCATGATGGGAAGTGGG - Intronic
915907361 1:159888576-159888598 CCACTGGCATGATGGGAAGAGGG - Intronic
916078494 1:161217601-161217623 CCTCAGCCAAGATGGGTAGTGGG - Intronic
916491154 1:165303672-165303694 CGCAAAGCATGATGGGAAGTAGG + Intronic
916495767 1:165345209-165345231 CCTGAGGCTTGATAGGGAGGAGG + Intronic
920698366 1:208199154-208199176 CCTGAGGCCAGAAGTGAAGTAGG + Intronic
922276396 1:224082818-224082840 TTTGGGCCATGATGGGAAGTTGG + Intergenic
923447078 1:234081710-234081732 CCTGGGGCAAGCTGGTAAGTTGG + Intronic
924323528 1:242872734-242872756 AGTGTGGCATGATGGGAAGAAGG + Intergenic
1063607576 10:7536293-7536315 TGTGAGGCATGTTAGGAAGTAGG - Intergenic
1065777683 10:29136792-29136814 CCTGAGGCATGCAGAGATGTTGG - Intergenic
1066393259 10:34995854-34995876 CATGAGGCATGAGGAGAACTAGG + Intergenic
1067209375 10:44246319-44246341 ACTGGGGCATGTTGGGAGGTGGG - Intergenic
1067235091 10:44440116-44440138 CCTGAGGCATGAGGGGAGCCAGG + Intergenic
1068734801 10:60400869-60400891 ACTGGGGCCTGTTGGGAAGTGGG - Intronic
1069053606 10:63820439-63820461 CCTGAGGCATTATGTGGTGTTGG + Intergenic
1071072273 10:81708618-81708640 CCTGATGCATGAGTGGAAGCCGG - Intergenic
1071760807 10:88604153-88604175 TATTAGGCATGCTGGGAAGTGGG + Intronic
1071803764 10:89094004-89094026 TCTGTGGCATGAGGGGAAATTGG - Intergenic
1072192723 10:93089534-93089556 CCTGTGGAATGCTGGGAACTGGG - Intergenic
1072616024 10:97049361-97049383 AATGAGGCTTGATGGGGAGTAGG - Intronic
1073443247 10:103565111-103565133 CCTGAGGCAGGATTGGTAGATGG + Intronic
1073579698 10:104653953-104653975 CCAGAGGCAGGAAGGGTAGTGGG - Intronic
1074486220 10:113884000-113884022 CTGGAGGCATGATGGGAGATGGG + Intronic
1074856192 10:117475469-117475491 CCTGATGCAGGGTGAGAAGTGGG - Intergenic
1075861336 10:125679327-125679349 ACTGAGGCATTATGGAAACTTGG - Intronic
1076324723 10:129612360-129612382 TTTCAGGCATGACGGGAAGTGGG - Intronic
1077065871 11:640723-640745 CCTGGGGGCTGATGGGGAGTGGG + Intergenic
1077366124 11:2162069-2162091 CCTAAGGCAGGGTGGGAACTAGG - Intergenic
1077406187 11:2383511-2383533 CCTGAGGCAGGAAGGAAAGGAGG - Intronic
1077537873 11:3133147-3133169 CCTAAGGAATAATGGAAAGTTGG + Intronic
1078516850 11:12029862-12029884 CCTGAGGCCTGATGCGGAGATGG + Intergenic
1078660541 11:13282122-13282144 CCTGGGGAATGAAGGGATGTAGG - Intronic
1080805398 11:35648444-35648466 CCTGAGGCAAACTGGGGAGTTGG + Intergenic
1083530306 11:63415303-63415325 CCAGAGACAAGATGGGAAGGAGG + Intergenic
1084117299 11:67049780-67049802 GCTGAGGCCTGATGGGAAGCCGG + Exonic
1084971405 11:72774214-72774236 CCTGCTGCCTAATGGGAAGTAGG - Intronic
1087175018 11:95088739-95088761 CGTGGGGGATGATGGGAAGTGGG - Intergenic
1087790578 11:102402731-102402753 CCTAATGCATAGTGGGAAGTTGG - Intronic
1090254672 11:125275142-125275164 CCTGACGAATGCTGGGAAGAAGG + Intronic
1090357988 11:126153406-126153428 CATGAGGCATGATGGAAGGAGGG + Intergenic
1090442971 11:126739410-126739432 CCTGAGACATGAAGGGATCTGGG + Intronic
1090606641 11:128428808-128428830 CCTGGAGAATGATGGGAAATGGG + Intergenic
1090935554 11:131338754-131338776 CCTGAACCAGGGTGGGAAGTGGG - Intergenic
1092024555 12:5230065-5230087 CCTGAACCATGTTGGGAAGTTGG + Intergenic
1092246366 12:6866529-6866551 ACTGAGGCAGGAGGGCAAGTCGG - Exonic
1093106309 12:15091969-15091991 TCTAAGGCATGAGGGGAAGGAGG - Intergenic
1093858516 12:24135239-24135261 TCTGAGGCGGGATTGGAAGTGGG - Intergenic
1094777861 12:33752786-33752808 CCAGAGGCCAAATGGGAAGTGGG - Intergenic
1095123504 12:38446102-38446124 CCTGAGGTATGAAAAGAAGTTGG - Intergenic
1096239765 12:49953565-49953587 CCTGAGGCCTGAAAGGCAGTGGG + Intronic
1097248116 12:57617787-57617809 GCTGAGGGAGGATGGGAAGGTGG + Intronic
1097281675 12:57848346-57848368 CCTGATGCATGTTGGGCAATGGG - Intergenic
1097405466 12:59183942-59183964 CCCGAGAAATGATGGTAAGTTGG - Intergenic
1098115619 12:67173277-67173299 CCTGTGGCAAGAAGGGAAGGAGG + Intergenic
1098245104 12:68508841-68508863 AATGAGGCATGAAGGAAAGTCGG + Intergenic
1099596714 12:84675673-84675695 ACTGAGGCCTGTTGGAAAGTGGG - Intergenic
1101535734 12:105614572-105614594 TCTGAGGAAAGATGGGAAGATGG - Intergenic
1101998874 12:109544358-109544380 CCTGAGACATCTTGTGAAGTGGG + Intergenic
1102411338 12:112722193-112722215 TCTGAGGCATGATGGGAGGTAGG - Intronic
1102704522 12:114869652-114869674 CCTGAGGCCTGACGGGTTGTTGG + Intergenic
1103798754 12:123523486-123523508 CCAGAAGCATGAAGGTAAGTGGG - Exonic
1103893595 12:124258020-124258042 ACTGAGGAATGATGGGCATTTGG + Intronic
1112922229 13:104628004-104628026 CCTGTGGCCTGTTGGGAACTGGG + Intergenic
1113326252 13:109284207-109284229 ACTGACGGATGTTGGGAAGTGGG - Intergenic
1113645982 13:111996320-111996342 CCTGTGGGATTATGGAAAGTGGG - Intergenic
1113823573 13:113232604-113232626 CCTGAGGAATGTTAGGAAGATGG - Intronic
1114650682 14:24282717-24282739 CATGAGGAATGCTGGGAAGTAGG - Intergenic
1114747603 14:25167201-25167223 CCTGAGGCTTGTTGGACAGTGGG + Intergenic
1116733566 14:48658345-48658367 CCTGAGGGATGATGTAAAGGAGG + Intergenic
1117243088 14:53855232-53855254 ACTGATGAATGAGGGGAAGTGGG + Intergenic
1118327341 14:64790669-64790691 CCTGAGGCAATCTGGGAGGTGGG - Intronic
1119596992 14:75944282-75944304 TCTGAAGCTTGATGGCAAGTAGG - Intronic
1121332029 14:93055728-93055750 CCTGAGGCCTGACTGGCAGTTGG - Intronic
1121523293 14:94600800-94600822 TCTCAGGAATCATGGGAAGTGGG - Intronic
1121960090 14:98251577-98251599 GCGGTAGCATGATGGGAAGTTGG + Intergenic
1123166126 14:106326761-106326783 CCTGAGGGAAGATGGGAGGTGGG - Intergenic
1123168821 14:106351796-106351818 CCTGAGGGAAGATGGGAGGTGGG - Intergenic
1123192949 14:106588841-106588863 CCTAAGGGAAGATGGGAGGTGGG - Intergenic
1124169407 15:27359203-27359225 CCTGAGGCCGGGTGGGAAGGAGG + Intronic
1124291897 15:28459552-28459574 GCTGATGCATGCTGAGAAGTAGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1126691168 15:51289932-51289954 ACAGAGGCATGGTGGGAAGTTGG - Intronic
1129306052 15:74663731-74663753 CATGTGGCATGATATGAAGTGGG - Intronic
1129307726 15:74679825-74679847 CCTGAGGCAGGAAGGGAGCTTGG + Intronic
1129454148 15:75667559-75667581 CCTAAGGCAGGGTGGGAGGTGGG - Intergenic
1131615985 15:94017882-94017904 CCTGAGGCCTGATGAGATGGAGG + Intergenic
1132303025 15:100788173-100788195 CCTGGGGCATGCTTGGAGGTTGG - Intergenic
1132706394 16:1245312-1245334 CCTGAGGAAGAATGGGAAGCGGG - Intergenic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1136172738 16:28498296-28498318 TCTGAGGCATGATGGGACCCCGG + Exonic
1136706886 16:32198123-32198145 GCTGATGCATGCTGAGAAGTAGG + Intergenic
1136761025 16:32731294-32731316 GCTGATGCATGCTGAGAAGTAGG - Intergenic
1136807078 16:33139092-33139114 GCTGATGCATGCTGAGAAGTAGG + Intergenic
1137042349 16:35624737-35624759 CATCAGGCTTGATGGGAAGAGGG - Intergenic
1138504153 16:57469143-57469165 CCTAAGGCAGGAAGGGAAGCAGG - Exonic
1139907844 16:70379036-70379058 CCTGTGGCATGGTGGAAATTGGG + Exonic
1140229598 16:73106701-73106723 CATGATGAATGATGGGAACTTGG - Intergenic
1140500625 16:75430899-75430921 TTTGGGCCATGATGGGAAGTGGG - Intronic
1141704813 16:85658898-85658920 CCTGGGGCATGATGGGAAGCAGG + Intronic
1203063177 16_KI270728v1_random:991611-991633 GCTGATGCATGCTGAGAAGTAGG - Intergenic
1142800697 17:2343632-2343654 ACTGAAGGATGATGGGAGGTCGG + Intronic
1147377735 17:40032932-40032954 CCTGCTCCATGATGGAAAGTGGG - Intronic
1147521368 17:41176524-41176546 CCTGAGCCATGCTGCTAAGTTGG - Intergenic
1148663991 17:49361599-49361621 CCTGAGGCCTGAGGGGAGGCTGG - Intronic
1149063521 17:52453115-52453137 TCTGGGGCAGGATGGGAATTGGG - Intergenic
1150955933 17:69860347-69860369 GCTGAGGCAGTATAGGAAGTGGG - Intergenic
1152580163 17:81162279-81162301 CCTGAGACCTGAGAGGAAGTAGG + Intronic
1153164191 18:2243412-2243434 CCAGTGGCATGGTGCGAAGTAGG - Intergenic
1153541322 18:6159119-6159141 CATGAGGCATGAGGGGAAGAGGG - Intronic
1155162370 18:23206271-23206293 CCTGAGCCCTGTGGGGAAGTCGG - Intronic
1156226969 18:35118908-35118930 CCTGAGGCAGGAGAGGAAGGTGG - Intronic
1158130571 18:54148436-54148458 CATGAGGCAGAAGGGGAAGTTGG + Intergenic
1158522008 18:58179491-58179513 CCTGTGGCGTGTTAGGAAGTGGG + Intronic
1159463173 18:68745719-68745741 CGGGAGGCATGAAGGGAGGTAGG - Intronic
1161298717 19:3532666-3532688 CCTGAGGCCTGGTGGGAGGCCGG - Intronic
1161802116 19:6422043-6422065 ACTGAGGCTTGATGTGAAGTTGG - Intronic
1161823669 19:6547295-6547317 GCTGAGGCAGGAAGGGAGGTAGG + Intergenic
1163698273 19:18774843-18774865 CCTGAGGCCAGGTGGGAAGTCGG - Intronic
1166053475 19:40274879-40274901 CCTGAGGCGAGCTGGGGAGTGGG + Intronic
1166387518 19:42390442-42390464 GCTGAGGCAGGAGGAGAAGTGGG - Intergenic
1166635451 19:44447641-44447663 CCTGTGGCGTGGTGGGAATTGGG - Intronic
1166702488 19:44890429-44890451 GCAGAGGCATGATGGGTAATGGG + Intergenic
1167387254 19:49171335-49171357 CCTGAGGCAAGAAGAGAAGGGGG - Exonic
1167482466 19:49741630-49741652 CCTAAAGCATGATAGGACGTTGG - Intronic
925994800 2:9283482-9283504 CCTGAGGCTTCAGGGGAAATCGG + Intronic
927003997 2:18828469-18828491 CCTGAGGCTTGATAGGAAGGAGG - Intergenic
928173424 2:29017988-29018010 CCTGAGGCAGCATGGGCAGAGGG - Intronic
929322464 2:40561212-40561234 TCAGAGGAAAGATGGGAAGTGGG - Intronic
929740663 2:44595972-44595994 ACTGGGGCCTGATGGGAGGTGGG + Intronic
930116120 2:47719821-47719843 CCTGAGGCAGGATAGGGAGGAGG + Intronic
931125718 2:59274238-59274260 CCAGCAGAATGATGGGAAGTAGG - Intergenic
932438847 2:71719108-71719130 CCTGGGGCCAGCTGGGAAGTAGG - Intergenic
933040395 2:77457832-77457854 GCTGAGGCATGATGATAAGAAGG - Intronic
933721593 2:85400760-85400782 CCTGAGGCAGGATGTGATGAGGG - Intronic
934188558 2:89765890-89765912 CCTGAGACATGATGTGAGGGTGG + Intergenic
934857545 2:97738610-97738632 CCTGTTGTCTGATGGGAAGTTGG - Intronic
936506264 2:113110002-113110024 CCTGATGGATAATGTGAAGTAGG - Intronic
936527372 2:113250745-113250767 CCTGAGTCATGATAGGCACTTGG - Intronic
937129152 2:119494329-119494351 CCTGGGCCAGGATGGGATGTGGG - Intronic
937280922 2:120716749-120716771 CCTGAGCCAAGATGGAATGTGGG - Intergenic
937599508 2:123713354-123713376 CCTCATACATGATGGGAAGTTGG + Intergenic
939958522 2:148546452-148546474 CCTGAGGCTGGAAGGGCAGTGGG - Intergenic
940252165 2:151691004-151691026 CCAGAGGCAACTTGGGAAGTGGG - Intronic
942470209 2:176252107-176252129 CCTGTGGCATGATTTGGAGTTGG + Intergenic
942535477 2:176958501-176958523 TCTGGGGCATGAAGGGAAATGGG - Intergenic
946093748 2:217253620-217253642 ACTGAGACATGATGGGAACAAGG + Intergenic
946112918 2:217436134-217436156 CCTGAGACATGAAGGCAAATAGG - Intronic
947443697 2:230146020-230146042 CATGAGGCATGATGGACATTTGG - Intergenic
948856345 2:240732223-240732245 GATGAGGCATGAGGGGAAGAGGG + Intronic
1169187580 20:3631659-3631681 CCTGAGGCATAGAGGGAAGCAGG + Intronic
1169322362 20:4644245-4644267 GGTGAGGCCTGATGGGAGGTGGG - Intergenic
1169346656 20:4834348-4834370 CCAGATGACTGATGGGAAGTGGG - Intergenic
1169424377 20:5484922-5484944 CCTGTGGCAAGGTGGGCAGTTGG + Intergenic
1172126091 20:32626198-32626220 CCACAGGCATGCTGGGAAGTGGG - Intergenic
1172439027 20:34952402-34952424 CAAGAGGCCTGATGGGAAGGAGG + Intronic
1173082579 20:39882986-39883008 TCTGAGGCATGAAGGCAAATAGG - Intergenic
1173209675 20:41022431-41022453 CCTGAGGAATGAAGGCAAATAGG - Intergenic
1173643067 20:44616899-44616921 CCTGCGGCAAGCTAGGAAGTGGG - Intronic
1174087852 20:48021942-48021964 CCTGTGGCAAGATAGGAAGGCGG - Intergenic
1175824651 20:61930439-61930461 CATGAGGGATGATGGGAAGAGGG - Intronic
1175835675 20:61992814-61992836 CCTGAGTCACGCTGGGACGTGGG - Intronic
1177411361 21:20734286-20734308 TCTGAGGCATCATGGGAAGATGG - Intergenic
1177446908 21:21209555-21209577 CATGAGGCAGGATGGGAAAAGGG + Intronic
1180135799 21:45861054-45861076 CCAGAGGCAGGAGGGGAACTGGG - Intronic
1180191780 21:46168800-46168822 CTTGAGGCCTGAGGGGAAGGAGG - Intronic
1181610607 22:24009004-24009026 CCTGAGGCACTCTGGGAAGCAGG - Intergenic
1182120017 22:27780341-27780363 CCTAAGGCAGGACGGGGAGTGGG - Intronic
1182349789 22:29692800-29692822 CCTGGCGCATGGTGGGAACTCGG - Intronic
1182434969 22:30324748-30324770 CCAGAGTAATGTTGGGAAGTGGG + Intronic
1182501719 22:30752987-30753009 CTAGGGTCATGATGGGAAGTGGG - Intronic
1183227195 22:36558681-36558703 CCTGAAGCATGAATGGAAGAGGG + Intergenic
1183328367 22:37206464-37206486 CCTGTGGCACCTTGGGAAGTAGG + Exonic
1183670202 22:39268420-39268442 CACAAGGCATGATGGGAAGAAGG + Intergenic
1184074490 22:42167544-42167566 ACTGAGGCATGAAGGGAAATAGG - Intronic
1184098191 22:42327965-42327987 CCAGAGCTATGATGGGAAGGAGG - Intronic
950193746 3:10994693-10994715 CTGGAGGCTTGATGAGAAGTGGG + Intronic
951901045 3:27657827-27657849 CCTGAAGGATGATAGGAGGTAGG - Intergenic
952820359 3:37481133-37481155 CCTGAAGCATGAGGGGAAGAGGG - Intronic
952902364 3:38118697-38118719 TCTGAAGCAGGAGGGGAAGTAGG - Intronic
953619525 3:44521142-44521164 TCTGGGGGATGATGGGAACTCGG - Intergenic
953803678 3:46049239-46049261 CCAGGGGCATGCTGGCAAGTAGG + Intergenic
954932451 3:54295999-54296021 CCTGGAGCATGAGGGGAGGTTGG + Intronic
955230501 3:57095036-57095058 CCTGAGGCAAGGTGGGAGGTGGG - Exonic
955789627 3:62574823-62574845 CATGAGGCATGTCAGGAAGTAGG + Intronic
956015043 3:64873588-64873610 CCTGACCCAGGATGGGGAGTGGG + Intergenic
956250139 3:67226983-67227005 CCTGAGGAATGATGGAAACATGG + Intergenic
958996394 3:100910245-100910267 ACTGAGGCCTGTTGGGAAGTCGG + Intronic
959919819 3:111858289-111858311 CCTGAGGCCTGTTGGGGGGTGGG + Intronic
960363615 3:116744383-116744405 CCAGGGGCAGGAAGGGAAGTGGG + Intronic
960906592 3:122607904-122607926 ACTGAGGCGTGATTGGAGGTTGG - Intronic
961137568 3:124526190-124526212 TCTGAGGCATGTTGGGAAACTGG - Intronic
962396177 3:135016973-135016995 CCTGAAGCTTGAAGGGAAGGAGG + Intronic
965932810 3:174067976-174067998 CCTGAGGCAAACTGGGAAGTAGG + Intronic
967147859 3:186621071-186621093 TGTGAGGAATGACGGGAAGTAGG - Exonic
968845139 4:3036781-3036803 CCTGCAGGAGGATGGGAAGTGGG + Intronic
969257405 4:6011642-6011664 CCTGGGGCATGCAGGGATGTGGG - Intergenic
969918174 4:10510564-10510586 TTTGGGTCATGATGGGAAGTAGG + Intronic
971133285 4:23837547-23837569 CCTGGGGCATGCTGGGTATTTGG - Intronic
972555307 4:40175388-40175410 CCTGGGGCAGGGTGGGAGGTAGG + Intergenic
975614996 4:76237269-76237291 CCTGAGGCATGATGGGAAGTGGG - Intronic
977440881 4:97066013-97066035 TTTGAGGCATGATGGCAATTAGG + Intergenic
981866058 4:149420462-149420484 ACTGAGGCCTGCTGGGAGGTGGG + Intergenic
982546544 4:156740352-156740374 CCTGAGACATAATAGAAAGTTGG - Intergenic
982875298 4:160640619-160640641 ACTGAGGCCTGTTGGGGAGTAGG + Intergenic
985735406 5:1577278-1577300 ACTTAGGTATGCTGGGAAGTAGG + Intergenic
985902550 5:2807999-2808021 TCTGAGGCTGGATGGGCAGTGGG + Intergenic
986055801 5:4135748-4135770 CCAGGGGCATGTTGGGACGTTGG + Intergenic
986137127 5:4990819-4990841 CCTGAGGTATGAAGGGGAGTGGG - Intergenic
989120312 5:37998250-37998272 GCTGAGGCATGAAGGGGAGACGG + Intergenic
990348605 5:54893158-54893180 CCTGAGGCATAGTTTGAAGTTGG - Intergenic
991631504 5:68660848-68660870 CCTGAGGCATGAAGGGAACAGGG - Intergenic
993019860 5:82579099-82579121 ACTGGGGCCTGTTGGGAAGTAGG - Intergenic
994615200 5:102095684-102095706 CCTGGGGCAGGGTGGGAAGGAGG - Intergenic
996123293 5:119695232-119695254 CCTGAGGCTTTCTGGGAAGCAGG - Intergenic
997895890 5:137716909-137716931 TCTCAGCCATGATGGGAAGGGGG - Intronic
998040982 5:138950950-138950972 CCTGAGGGCTGATGAGGAGTGGG - Intronic
999621595 5:153480120-153480142 CCTGCAGGATGAGGGGAAGTGGG - Intergenic
1000145525 5:158449733-158449755 CATGTGCCATGCTGGGAAGTTGG - Intergenic
1001742236 5:174062922-174062944 TTTGAGCCATAATGGGAAGTAGG + Intronic
1002210122 5:177593762-177593784 CTGGAGGCATGCTGGTAAGTGGG + Exonic
1002590112 5:180285257-180285279 TCTGAGCCATGCTGGGAATTTGG - Intronic
1003514789 6:6808964-6808986 CCTGCTGAATGATGGGAAGTGGG + Intergenic
1004510847 6:16283451-16283473 CCTAAGGCATCATGTGAAGTTGG + Intronic
1006455905 6:34131693-34131715 CCTGATGCATCATGGGAAGTGGG + Intronic
1007351962 6:41280642-41280664 CCAGGGGCCTGATGGGCAGTGGG - Intronic
1010490396 6:76469233-76469255 CTTGAGGGATGAAGAGAAGTAGG - Intergenic
1010878413 6:81138188-81138210 AGTGGGGCATGATGGGAAGTGGG - Intergenic
1010976379 6:82319106-82319128 TCTGGGGAAAGATGGGAAGTGGG + Intergenic
1011110015 6:83827529-83827551 CCTGAGGCAGGCTGGGCAGGTGG - Intergenic
1014622535 6:123686554-123686576 CTTTAGGTATGATGTGAAGTTGG - Intergenic
1016117135 6:140301322-140301344 CTTAAGTCATGATGGGAAGTGGG + Intergenic
1018034140 6:159867088-159867110 CCTGCGGCATCAGGGGCAGTGGG - Intergenic
1018066434 6:160127760-160127782 CCTGGGGCATGATGGCAACAGGG + Intronic
1019539893 7:1546797-1546819 CTGGAGGGAGGATGGGAAGTGGG + Exonic
1019737722 7:2658918-2658940 CCTGAGGCATGAGGGGAGAGAGG - Exonic
1022405238 7:30083450-30083472 TCTGAGACAGGATGGGAATTGGG - Exonic
1023972151 7:44999738-44999760 CGCGAGGCAGGCTGGGAAGTCGG + Intronic
1024263253 7:47587515-47587537 CCTGAGGCATAAGGAGAACTTGG + Intergenic
1024630926 7:51246429-51246451 AGTGAGCCATGATTGGAAGTGGG - Intronic
1025898186 7:65723161-65723183 GCTGGGGCAGGATGGGGAGTGGG - Intergenic
1026539480 7:71267865-71267887 ACTGGGGCCTGCTGGGAAGTGGG - Intronic
1026551602 7:71373500-71373522 CCTGTGGCCTGATAGGAACTGGG + Intronic
1027702811 7:81488949-81488971 TCTGAGGTATGTTGGGAAATTGG + Intergenic
1028786502 7:94800351-94800373 ACTGAGGCCTGTTGGGGAGTGGG + Intergenic
1030060762 7:105619026-105619048 CCTGAGCAATGCTGTGAAGTTGG - Intronic
1031923029 7:127615121-127615143 GGTGAGGCATGATGGGCAGAAGG + Intronic
1033031023 7:137826987-137827009 CCTTAGGAATAATAGGAAGTAGG - Intronic
1033184353 7:139213265-139213287 CTTGAGTCATGATAAGAAGTTGG + Intergenic
1035096672 7:156361540-156361562 CCTGAGGCAGTAGGGGAAGTAGG - Intergenic
1035457583 7:159018663-159018685 ACTGAGACATAATGGGGAGTTGG - Intergenic
1035920894 8:3675123-3675145 CTTGAGCCATGATGGGAAAGTGG - Intronic
1037095451 8:14980934-14980956 AATGAGGCATGGTGGGGAGTAGG - Intronic
1039266581 8:35831060-35831082 CCTGAGGAATGGTAGGAATTTGG + Intergenic
1041275796 8:56156630-56156652 CCTGAGTAAAGATGGGAAGGAGG + Intergenic
1042075969 8:64995000-64995022 CTTGAGTCATAATTGGAAGTGGG + Intergenic
1042145669 8:65727408-65727430 CCTGAGGAATGACGTGAAGGGGG - Intronic
1045251257 8:100485064-100485086 CCAGATTCATGCTGGGAAGTAGG + Intergenic
1046351171 8:113014382-113014404 TATGAGGCATGATGGCCAGTTGG - Intronic
1046481854 8:114830830-114830852 CCTGAGGCGTGAAAGGAAATTGG + Intergenic
1048348001 8:133592503-133592525 GCTGAGGCTTGAGGAGAAGTAGG - Intergenic
1048360730 8:133695162-133695184 CCTGAGGGATGATGGGGTGAGGG + Intergenic
1048654259 8:136517977-136517999 CCTGTGGCCTGTTAGGAAGTGGG + Intergenic
1048799295 8:138181460-138181482 ACTGGGCCAGGATGGGAAGTGGG - Intronic
1055718001 9:79139831-79139853 CTTGAGGGATTATGGGAACTAGG - Intergenic
1055967406 9:81879068-81879090 CCAGAGGCTTGGTGGGGAGTGGG + Intergenic
1056210829 9:84363685-84363707 TCTGAGTCAGAATGGGAAGTTGG + Intergenic
1056412468 9:86344422-86344444 CCTTTGGCATGATGGGGAGGGGG - Intronic
1056691693 9:88813461-88813483 CAGGAGGCCTGATGGGATGTGGG - Intergenic
1059391184 9:114000646-114000668 CCTGAGGCATGAAGTGAAGCTGG - Intronic
1060279981 9:122209280-122209302 CCAGTGAGATGATGGGAAGTGGG + Intronic
1185854570 X:3522205-3522227 CCTGTGGAATGATGGGATTTGGG + Intergenic
1185870367 X:3659645-3659667 CTTGAGGCATAAAGGGAAGCAGG + Intronic
1187293723 X:17979088-17979110 CCTGAGTCATGATATGAAGGGGG + Intergenic
1189048668 X:37620461-37620483 CCCCAGGCCTGATGGGAACTAGG - Intronic
1193504766 X:82328691-82328713 ACTGAGGCCTGTTGGGGAGTGGG + Intergenic
1193757936 X:85431609-85431631 CCAGAGGTATGGTTGGAAGTAGG + Intergenic
1193872713 X:86821303-86821325 CCAGAGGAATTGTGGGAAGTAGG + Intronic
1194040863 X:88940797-88940819 CCTGAGGCAGGATGGGGAAGGGG + Intergenic
1195724275 X:107898053-107898075 CCTGGGCAATAATGGGAAGTGGG + Intronic
1197872102 X:131070362-131070384 CCTGAGTGATGATGAGAAGGGGG + Intronic
1199773532 X:150990961-150990983 CCCGAGGCATAAGGGGGAGTTGG + Intergenic