ID: 975615392

View in Genome Browser
Species Human (GRCh38)
Location 4:76241411-76241433
Sequence TGCTGATTGTTGCTTTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975615392_975615394 0 Left 975615392 4:76241411-76241433 CCTTTGTAAAGCAACAATCAGCA 0: 1
1: 0
2: 1
3: 7
4: 151
Right 975615394 4:76241434-76241456 ATCAGAGCCCTAATATTTGGAGG 0: 1
1: 0
2: 2
3: 8
4: 111
975615392_975615393 -3 Left 975615392 4:76241411-76241433 CCTTTGTAAAGCAACAATCAGCA 0: 1
1: 0
2: 1
3: 7
4: 151
Right 975615393 4:76241431-76241453 GCAATCAGAGCCCTAATATTTGG 0: 1
1: 0
2: 1
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975615392 Original CRISPR TGCTGATTGTTGCTTTACAA AGG (reversed) Intronic
900278954 1:1852997-1853019 TGCTGAGGCTTGCTTTACACTGG - Intronic
906893653 1:49746483-49746505 TCCTGATCCTTGGTTTACAAAGG + Intronic
910272271 1:85409599-85409621 TCCTGCTTGTTGCTCTACACCGG + Intronic
911410293 1:97496078-97496100 TGTTTATTGTTGTTTTGCAAAGG - Intronic
911412136 1:97523049-97523071 AAATGATTCTTGCTTTACAATGG - Intronic
912479714 1:109972771-109972793 TGCCAATTGATGTTTTACAAAGG - Intergenic
912620375 1:111150074-111150096 TGCTGCTTGTTGTTCTGCAAGGG + Intronic
913205088 1:116531474-116531496 AGCAGATAGTTGCTTTATAATGG - Intronic
913427050 1:118744749-118744771 TGCTGTTTGTTAATGTACAATGG - Intergenic
914983529 1:152437433-152437455 TTCTGCCTGTTGCTTTGCAATGG + Intergenic
923580656 1:235209117-235209139 TGTTGATTTTTGTTATACAAAGG - Intronic
1063343611 10:5292009-5292031 TTCTCTTTGTTGCTTGACAATGG - Intergenic
1064672291 10:17728534-17728556 TGCTGAATGTTAATTTACATGGG + Intergenic
1065872291 10:29965844-29965866 TGCTGATAGGTACTTTACAGAGG + Intergenic
1066410043 10:35159085-35159107 GGCTGAATGTTGCTTCACATAGG - Intronic
1067963979 10:50888435-50888457 TGCTAAGTGTTGCATTAGAAAGG + Intergenic
1068108176 10:52645704-52645726 TGCTGAATGTTCCTGTACATTGG - Intergenic
1069408180 10:68124534-68124556 TATTGATTTTTGCTTTTCAAAGG + Intronic
1069761062 10:70811844-70811866 TGTTAATTCTTGCTTTACAAAGG + Intergenic
1070002793 10:72393608-72393630 TACTGACTGTGGCTTTACACAGG - Intronic
1074225416 10:111479757-111479779 TGCTCATTTTTTCTTTAAAAAGG + Intergenic
1079916617 11:26375828-26375850 TGCTGCTTGTTTCTTTTCATGGG - Intronic
1079932519 11:26582558-26582580 TACTAATTGTTAATTTACAAAGG - Intronic
1079976065 11:27093058-27093080 AGTTGATTGTTGATTTATAATGG - Intronic
1088175390 11:107047929-107047951 AGCTTATTTGTGCTTTACAAAGG - Intergenic
1088397271 11:109382521-109382543 TTCTGATTCTTGGTTTACCAGGG + Intergenic
1093090455 12:14914069-14914091 TGCAGGTTGTTGATTTACATAGG + Exonic
1093405883 12:18803324-18803346 TGCTAAGTCTTGCTTTAAAAAGG - Intergenic
1099232789 12:80047310-80047332 TTTTTATTGTTGATTTACAAGGG - Intergenic
1099725630 12:86424261-86424283 TGCTGATTGTAGCTGTTAAAAGG + Intronic
1101007127 12:100411900-100411922 TTTTGACTTTTGCTTTACAAGGG + Intronic
1104057086 12:125238879-125238901 TGCTGATCTTTTCTTAACAAAGG - Intronic
1106057094 13:26248361-26248383 TGATGATAGTAGCTGTACAATGG - Intergenic
1109119143 13:58431759-58431781 TTCTTATTTTTCCTTTACAAAGG - Intergenic
1109648742 13:65296334-65296356 TGATTATTGTAGCTTTACAGTGG - Intergenic
1110971147 13:81762920-81762942 TGGTGATTGTTTCTTTTTAAAGG - Intergenic
1111372229 13:87333781-87333803 TGCTGATTGTTGCATTTTCAGGG - Intergenic
1111423471 13:88048369-88048391 TGTTGGTTGGTGCTTTTCAAAGG - Intergenic
1111807981 13:93062391-93062413 TGCTGATTGTTCTTTCAAAATGG - Intergenic
1113122854 13:106942938-106942960 TGCCGATTGTTAATTTCCAAAGG + Intergenic
1113243966 13:108374053-108374075 TGCTGATTTTTGGTTAACATTGG + Intergenic
1113473057 13:110560616-110560638 TGGTGATTGTAGCATTGCAATGG - Intronic
1114889307 14:26896962-26896984 TCCTGATTGTAGCTTTCTAATGG + Intergenic
1117488415 14:56222406-56222428 TGTTGAATGGTACTTTACAAAGG + Intronic
1120246910 14:82017725-82017747 TGCTGATTATTTCATTATAATGG - Intergenic
1121949076 14:98153866-98153888 TGCAGTTTGTAGCTTTAGAAGGG - Intergenic
1127397110 15:58551816-58551838 TCCTGATTGTAGTTTCACAAAGG + Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1133476348 16:6125477-6125499 TGCTCTTTGATGTTTTACAAGGG + Intronic
1135154741 16:20042777-20042799 TGCTGATTCTAGCTTTGAAAAGG - Intronic
1137529197 16:49266372-49266394 TGCTGAAGGTGGCTTCACAAAGG - Intergenic
1140870119 16:79098511-79098533 TACTGATGGTTGCATTTCAATGG + Intronic
1141494234 16:84395899-84395921 TGGTGATGGTTGCATAACAATGG - Intronic
1144143124 17:12369517-12369539 TGCTGACTGTGGTTTCACAAGGG - Intergenic
1144517397 17:15928205-15928227 TGTTGCTGGTGGCTTTACAAGGG + Intergenic
1148986937 17:51630829-51630851 TGCTGTTTCTTGTTTTCCAAAGG - Exonic
1149586363 17:57790253-57790275 TGCTGATTCTGCCTTTACAGGGG - Intergenic
1152192229 17:78895879-78895901 TACTAATTGTTGGTTGACAAGGG - Intronic
1152723056 17:81932210-81932232 TGCTGAGGGTTGGGTTACAAGGG - Intergenic
1153388629 18:4529688-4529710 TGCTCTTTGTTGATTTCCAATGG + Intergenic
1155237355 18:23834013-23834035 TCCTAATTGTTCCTTTACAGAGG - Intronic
1155401212 18:25441636-25441658 TGCTGATTATGGCTTTCCATGGG - Intergenic
1157029642 18:43890163-43890185 TGCTGTTTTTTGCTTTTCAGGGG - Intergenic
1158486267 18:57868793-57868815 TGCTGATTGATCCTCTACAGTGG - Intergenic
1159301239 18:66571885-66571907 TGCTGTTTGAAGCTTTTCAATGG + Intronic
1162519436 19:11170801-11170823 GGCTAATTGTTCCTTTAAAAGGG + Intronic
926078828 2:9966830-9966852 AGGTGATTGTGGCTTTAGAAGGG + Intronic
928968862 2:37005570-37005592 TTTTGAGTATTGCTTTACAATGG - Intronic
929089158 2:38197706-38197728 TTCTGAGTGTGGATTTACAAAGG - Intergenic
932166493 2:69512549-69512571 TGCTAATTATTGCTTTAAGATGG + Intronic
934017666 2:87906554-87906576 AGCCGATTTTTGCTTTACAATGG + Intergenic
936291364 2:111226426-111226448 TCCTGATTGTTGGTTTACAGAGG + Intergenic
937657410 2:124392160-124392182 TGCTAATTGGTCCTTTAAAAGGG - Intronic
940328142 2:152446716-152446738 TGCAGATTCTTCCTTAACAATGG - Intronic
940370925 2:152899942-152899964 TGCTTTGTGTTGCTTTTCAAAGG - Intergenic
941619843 2:167764881-167764903 TGGTAGTTCTTGCTTTACAAAGG + Intergenic
942820642 2:180110182-180110204 TGATTATTATTGCTTTATAATGG - Intergenic
945236430 2:207635926-207635948 TGCTGATTTTTTTTTTTCAAGGG + Intergenic
947664899 2:231898758-231898780 TGCTCAGTGATGTTTTACAAAGG + Intergenic
948792185 2:240384808-240384830 TGCTGGTAATTGCTTAACAAGGG + Intergenic
1177784332 21:25654279-25654301 TGTTGATTGGAGCTTTACAATGG + Intronic
1180016717 21:45091382-45091404 TGATGATTTTTACTTTAGAAAGG + Intronic
1182375273 22:29842508-29842530 TGAGGAATGTTGGTTTACAAAGG + Intergenic
950344361 3:12278966-12278988 TGCTGATTTTTGCATTACTTAGG - Intergenic
950587077 3:13900786-13900808 TACTGATTTTTGATTTTCAAAGG + Intergenic
954851481 3:53604595-53604617 TGCTGGTCCTTGCTTTAAAATGG + Intronic
957240095 3:77648635-77648657 TGCTGTATGTAGCTATACAAAGG + Intronic
957869262 3:86066914-86066936 AGCTGATTGTTGGTATACACTGG - Intronic
959133844 3:102392118-102392140 TGCTGACTTCTGCTTTATAATGG + Intronic
961267421 3:125654868-125654890 TGCTGACTGTTACTTTCCATGGG + Intergenic
965024646 3:163284835-163284857 TGCTGCTTCTTTCTTTTCAAAGG - Intergenic
965382591 3:168008343-168008365 TTGTGATTGTTGCTTTCCTAAGG + Intergenic
966348812 3:179007600-179007622 TGCTCATTTTTGGTTTCCAATGG - Intergenic
966703778 3:182887786-182887808 TGGTGATTAATGCTTTACTAAGG + Intronic
967290185 3:187912058-187912080 TTCTGATTGTTGCTGTATCAGGG - Intergenic
974125372 4:57689882-57689904 TGCTCAGTGTTGCTTCACAGAGG + Intergenic
974759653 4:66258526-66258548 GGCTGAATGTTGCTTAGCAAGGG - Intergenic
975615392 4:76241411-76241433 TGCTGATTGTTGCTTTACAAAGG - Intronic
976521238 4:86030000-86030022 TACTCATTCTTGCTTTGCAATGG + Intronic
976820290 4:89198692-89198714 TTCTGATTTTTGTTTTACAAAGG + Intergenic
979888824 4:126064473-126064495 TTCTGATTGTTGCTTTGCCTCGG + Intergenic
980243391 4:130204558-130204580 TGCTGATTTTTAATATACAAGGG + Intergenic
981393905 4:144223369-144223391 TGTTGCTTGTTGCTTAACCATGG + Intergenic
984174768 4:176403667-176403689 TGCTGATTTTTGCTTTTTGAGGG + Intergenic
987660567 5:20868063-20868085 TTACGATTGTTGCTTTACACAGG - Intergenic
997077158 5:130692675-130692697 TGCTGATTGGCGTTTGACAAAGG + Intergenic
998787181 5:145725684-145725706 TGCTAATTGTCACTTTCCAAGGG + Intronic
999138721 5:149342464-149342486 TTCTGAATGTTGCAGTACAAGGG - Intergenic
999876155 5:155808286-155808308 TGGTGGGTGTTGCTTTCCAATGG - Intergenic
1004456792 6:15798799-15798821 TGTTGATTATTGATTTATAAGGG + Intergenic
1005059153 6:21760194-21760216 TGCTGATTCTTGTTTTAGCAGGG - Intergenic
1007708286 6:43804833-43804855 AGGTAACTGTTGCTTTACAAAGG + Intergenic
1010386917 6:75290807-75290829 TGCTCATTTTTGCATCACAAAGG - Intergenic
1010483815 6:76385172-76385194 TGCTAAGTGTTGCTTGTCAAAGG - Intergenic
1011847084 6:91579140-91579162 TGCTAAATGTTGATTTGCAAAGG + Intergenic
1012881693 6:104798582-104798604 TGATTATTGTTGCTTTCAAAGGG - Intronic
1013032763 6:106351510-106351532 TACTGTTTTTAGCTTTACAATGG - Intergenic
1014773319 6:125481439-125481461 TGATGTTTGCTGCTTTACTAGGG + Intergenic
1015880183 6:137864373-137864395 TGCTGATTCTTGATTAAGAAAGG + Intergenic
1016920961 6:149292760-149292782 AGCTCATTGTTGCTTAACTAAGG - Intronic
1023391636 7:39716724-39716746 GGCTGATTGTTACTTTCTAAGGG + Intergenic
1024741479 7:52359801-52359823 TGCTAATTGGTGCTTTATAGAGG - Intergenic
1026323294 7:69286265-69286287 TGCTGATTGTTGCTGGTCCAGGG + Intergenic
1028117331 7:87014045-87014067 TGCTTTATGTTGCTTTAAAATGG + Intronic
1028416733 7:90588796-90588818 TACTGATTGGGGCTTTTCAAAGG - Intronic
1028735954 7:94212333-94212355 TGGTGATTATGGGTTTACAATGG - Intergenic
1028895578 7:96037786-96037808 AGCTGAATTTTGCTTTACATTGG + Intronic
1031373994 7:121002334-121002356 TTCTGATTGATGCTTTGCTAAGG - Intronic
1036444438 8:8809383-8809405 TGCCCTTTGTTGCTCTACAATGG + Intronic
1036731603 8:11270501-11270523 GGCTGATTGTTACATTTCAAGGG - Intergenic
1037357519 8:18037858-18037880 TTCTGATAGTGGCTTTTCAATGG + Intergenic
1037691921 8:21188640-21188662 TAATTATTGTAGCTTTACAATGG + Intergenic
1038738507 8:30194784-30194806 TGCTGATTTTTGCTTTTTGAAGG - Intergenic
1039032175 8:33322386-33322408 TGCTGAGTGTAGCTCTACAAGGG + Intergenic
1041836090 8:62217143-62217165 AGCTAATTGTTGCTTTGCATGGG - Intergenic
1042674334 8:71303048-71303070 TGCTGCATGTTGGTTTACTAGGG - Intronic
1042988450 8:74610601-74610623 TGATTATTGTAGCTTTATAAAGG - Intronic
1043715576 8:83481426-83481448 TGCACATTGTTACTTTAAAAGGG - Intergenic
1043734277 8:83724345-83724367 TGCTGAAGGCAGCTTTACAATGG - Intergenic
1044905361 8:96995320-96995342 TGGTGGTTGTTGTTTTATAATGG + Intronic
1045154062 8:99446317-99446339 TGCTGACTCTTGCTTTTCATTGG + Intronic
1051307893 9:15734967-15734989 TACTAATTGCTTCTTTACAATGG - Intronic
1051755330 9:20393422-20393444 TGCTGATTGTTGCATTTCAAAGG + Intronic
1051958681 9:22731163-22731185 TGAAGATTGTTGTTTTATAATGG + Intergenic
1052310018 9:27056820-27056842 TGCTTATTGTTGCTTTAGTGTGG + Intronic
1052879593 9:33593089-33593111 TGATGATTGGAGCTGTACAATGG + Intergenic
1055471496 9:76616136-76616158 TGATGATTTTGGCTTTCCAAAGG - Intronic
1057409540 9:94805373-94805395 TGTTGATTGATTCTTTGCAAGGG + Intronic
1058134327 9:101290599-101290621 TTCTGATTGTTTCATTAGAATGG - Intronic
1187485155 X:19696137-19696159 TGCTCATTGCTGCTTTGAAATGG + Intronic
1187613701 X:20970625-20970647 TGTCAATTCTTGCTTTACAATGG + Intergenic
1191202333 X:57797223-57797245 GGCTGATTGGTGTTTGACAAGGG - Intergenic
1193262149 X:79420686-79420708 TGGTGATGGTTGCATTACATTGG - Intergenic
1194554812 X:95343033-95343055 TGGTGATTGTTGCACAACAATGG + Intergenic
1196981690 X:121221393-121221415 TGCTGAGTGTTTCTATACCAGGG + Intergenic
1197658223 X:129141273-129141295 TGCTGATTTTTTTTTTTCAAGGG + Intergenic
1198435573 X:136613765-136613787 TGCTTTTTCTTGTTTTACAAAGG + Intergenic
1199126815 X:144131991-144132013 AGCCGATTTTTGCTTTACAATGG - Intergenic
1199659227 X:150031158-150031180 AACTGATTGGTGCTGTACAAAGG + Intergenic
1201062395 Y:10059130-10059152 TGCAGATTGTTCCTTGACATTGG + Intergenic