ID: 975618816

View in Genome Browser
Species Human (GRCh38)
Location 4:76275221-76275243
Sequence ATGAGCAAGGCTAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975618816_975618820 -5 Left 975618816 4:76275221-76275243 CCTGCCACCTTAGCCTTGCTCAT 0: 1
1: 0
2: 2
3: 19
4: 302
Right 975618820 4:76275239-76275261 CTCATAGTATTCTCGCTGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 103
975618816_975618823 22 Left 975618816 4:76275221-76275243 CCTGCCACCTTAGCCTTGCTCAT 0: 1
1: 0
2: 2
3: 19
4: 302
Right 975618823 4:76275266-76275288 CCCCTCCTCTCCATGTCCATAGG 0: 1
1: 1
2: 1
3: 41
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975618816 Original CRISPR ATGAGCAAGGCTAAGGTGGC AGG (reversed) Intronic
903387802 1:22940181-22940203 ATTAGGAAGTCTAAGGTGGGAGG - Intergenic
903450175 1:23448286-23448308 TTGAGCCACGCTTAGGTGGCAGG + Intronic
903495321 1:23762568-23762590 ATGTGAAAGGCTGAGGTGGGAGG + Intergenic
905384828 1:37595370-37595392 AAGGTCAAAGCTAAGGTGGCAGG + Intronic
905773130 1:40650979-40651001 TTTAGCCAGGCAAAGGTGGCAGG - Intronic
906792133 1:48668415-48668437 ATGGTCTAGGCTAAGGGGGCTGG - Intronic
906869010 1:49455777-49455799 ATGAGCAAAGGGAAGGTAGCAGG - Intronic
907526429 1:55056612-55056634 TTGAGCAAGGCTAATGTGAATGG + Intronic
907729325 1:57050467-57050489 ATGACTAAGTCTGAGGTGGCAGG - Intronic
908342195 1:63193069-63193091 AACAGCAAGGCCAAGGTAGCTGG + Intergenic
908821044 1:68086908-68086930 GTGAGAAAGGGTAGGGTGGCAGG - Intergenic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912310095 1:108611582-108611604 ATCAGCAAGGCAAATGTGGAAGG + Intronic
912410639 1:109478575-109478597 CAGAGCAGGGCTGAGGTGGCTGG - Intronic
912788745 1:112630149-112630171 ATTAGAAAGGCTGAGGTGGGAGG - Intronic
914245873 1:145885562-145885584 TTGAGGAAGGCAAAGCTGGCGGG + Intronic
914337949 1:146733055-146733077 ATGTGGGAGGCTAAGGTGGGAGG - Intergenic
915612952 1:157009703-157009725 ATGAGCTAGTCTAAGCTAGCTGG + Intronic
915718882 1:157969017-157969039 CTGAGCAAGCCTGAGGAGGCTGG + Intergenic
915820410 1:159017229-159017251 CTGAGAAAGGCTATGGTGGTGGG + Intronic
916514152 1:165499614-165499636 AACAGCAAGGCCAAGGTGGGGGG + Intergenic
917103434 1:171468770-171468792 ATTAGCCAGGCCATGGTGGCGGG + Intergenic
919635604 1:200000369-200000391 ATTTGCAAGGCCAAGGTGGCTGG - Intergenic
919685685 1:200481615-200481637 ATGAGCAAGGCCAACAGGGCTGG + Intergenic
921216963 1:212946081-212946103 TTGAGCAAGGACATGGTGGCTGG - Intergenic
922697182 1:227736327-227736349 ATGAGCAGGGCTGAAGTGGGAGG + Intronic
922806466 1:228392660-228392682 ATCAGCAATTCTGAGGTGGCGGG + Intergenic
923557150 1:235010137-235010159 CTCAGGAAGGCTCAGGTGGCTGG + Intergenic
923585430 1:235265588-235265610 ATGAGGGAGGCTAAGGTGGGAGG + Intronic
923805259 1:237250676-237250698 AGGAGCAAAGGTAAAGTGGCTGG - Intronic
1063210071 10:3872198-3872220 CTGAGCAAGGCTACGGTGCTCGG - Intergenic
1064116755 10:12584709-12584731 ATTAGGAAGGCTGAGGTGGGAGG + Intronic
1064576224 10:16748687-16748709 AAGAGCAAGGCCAGTGTGGCTGG - Intronic
1067281977 10:44879960-44879982 ATGAGAAAGTCTAAAGTGGAGGG - Intergenic
1069387261 10:67895271-67895293 ATCAGCCAGGCTTGGGTGGCGGG + Intronic
1069428593 10:68312756-68312778 ATTAGCCAGGCCATGGTGGCGGG - Intronic
1070040697 10:72776057-72776079 ATGTGGGAGGCTAAGGTGGGAGG + Intronic
1070141601 10:73742171-73742193 ATTTGGAAGGCTAAGGTGGGAGG + Intergenic
1072729662 10:97837164-97837186 ATGACCAAGGCCAAAGTGACAGG + Intergenic
1074016736 10:109542292-109542314 CTCAGCAAGGCTACTGTGGCCGG - Intergenic
1075809170 10:125211903-125211925 ATGACAAAGGCAAGGGTGGCTGG + Intergenic
1076946588 10:133655933-133655955 ATGGGCAAGGCTGGGGTAGCAGG + Intergenic
1079192959 11:18297119-18297141 ATGAGCAAGGCTTAGGTGCCTGG + Intronic
1080169046 11:29276607-29276629 ATGACTAAGACTAGGGTGGCAGG - Intergenic
1081592147 11:44431116-44431138 ACTAGGAAGGCTAAGGTGGGAGG + Intergenic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083327842 11:61882217-61882239 ACGAGAGAGGCTAAGGTGGGAGG - Intronic
1083466163 11:62847768-62847790 ATTAGCAAGGGTAAGGTTGATGG - Intergenic
1084023947 11:66436252-66436274 ATGAGCAAAGGTATGGAGGCTGG - Intronic
1084157618 11:67322968-67322990 ATGAACAGGGCTGAGGTGGAGGG - Intronic
1084274519 11:68044609-68044631 ATGAGCAGGCCTAAGGTCACAGG - Intronic
1085023095 11:73221384-73221406 ATGGGGAGGGCTAAGCTGGCAGG - Intronic
1085354006 11:75819454-75819476 ATGCGGAAGGCTGAGGTGGGAGG - Intronic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1088856653 11:113761385-113761407 CTCAGCAGGGCTAAGGTGGGAGG - Intronic
1089234384 11:117010603-117010625 AGGACCAAGGCCATGGTGGCAGG - Intronic
1089614153 11:119685769-119685791 GTGAGCAGAGCAAAGGTGGCAGG - Intronic
1091346091 11:134855219-134855241 TTGAGCAAAGCACAGGTGGCTGG - Intergenic
1091711468 12:2743584-2743606 ACCAGCTAGGCTGAGGTGGCTGG - Intergenic
1091830662 12:3548674-3548696 ATCAGTAATGCTAAGGTGTCTGG + Intronic
1092166529 12:6346123-6346145 ATGAATAAGACTAAGGTGGCAGG + Intergenic
1094845199 12:34358469-34358491 GGGAGCCAGCCTAAGGTGGCAGG - Intergenic
1094849229 12:34374941-34374963 AGGAGCCAGCCAAAGGTGGCAGG - Intergenic
1094849354 12:34375475-34375497 GGGAGCAAGCCCAAGGTGGCAGG - Intergenic
1094850262 12:34379244-34379266 AGGGGCCAGCCTAAGGTGGCAGG - Intergenic
1095107700 12:38255294-38255316 ATTTGCAAGGCTAAGGTGGGAGG + Intergenic
1096081593 12:48836867-48836889 GTGATCAAGGCTAGGGTGGCTGG - Intronic
1096989580 12:55788688-55788710 ACGAGAAAGGCTGAGGTGGGAGG + Intronic
1099451832 12:82817114-82817136 ATTAGCAAGGGTGTGGTGGCGGG - Intronic
1099951302 12:89307498-89307520 ATGAGCCAGATTAAGGAGGCAGG + Intergenic
1100073139 12:90746208-90746230 ATGAGCAAGGTTAAAGTAGTAGG + Intergenic
1100129787 12:91477561-91477583 ATGAGCAAGGTTTAGCTGGAGGG - Intergenic
1100245359 12:92751906-92751928 ATGTGAAAGGCTGAGGTGGGAGG + Intronic
1100695323 12:97086449-97086471 ATGAGGATGGCCAAGGTGGTAGG + Intergenic
1101502321 12:105315677-105315699 ATGAGCAAAGGTATGGTGGTGGG + Intronic
1101848834 12:108386215-108386237 ATGAGCAGGGCAGAGGTGACTGG + Intergenic
1102352319 12:112203057-112203079 ATGTGGGAGGCTAAGGTGGGAGG - Intronic
1102903271 12:116655647-116655669 ATGAGCTCAGCTTAGGTGGCTGG - Intergenic
1103329120 12:120141609-120141631 CTGAGCAAGGCCAGTGTGGCTGG - Intronic
1104586262 12:130050424-130050446 AAAAGCAAAGCTAAGGTGGAAGG - Intergenic
1106071942 13:26420847-26420869 CAGATCAAAGCTAAGGTGGCTGG - Intergenic
1106151178 13:27104137-27104159 ACTTGGAAGGCTAAGGTGGCAGG - Intronic
1106307102 13:28522438-28522460 ATGACCAAGGCTACTCTGGCAGG + Intergenic
1107264820 13:38540885-38540907 ATGAGTTAGGCCAAGGTGGGTGG + Intergenic
1107497265 13:40939204-40939226 ATGAGGAAGGCTGAGGTGAGAGG + Intronic
1108041003 13:46339214-46339236 ATGAGTAATGCTGAGGTAGCAGG - Intergenic
1108115445 13:47122465-47122487 GTGGGCAAGCCTAAGGTGGGAGG + Intergenic
1110343532 13:74419503-74419525 ATGTGCGAGGCTGAGGTGGGAGG - Intergenic
1114481112 14:23035111-23035133 ATGACCAAAGCCAAGATGGCAGG - Exonic
1116342452 14:43741664-43741686 ATGAGCAAGGTTAAGGCAGAAGG - Intergenic
1116357342 14:43945893-43945915 ATTTGGAAGGCTAAGGTGGGTGG + Intergenic
1117711812 14:58538037-58538059 ACTAGGAAGGCTGAGGTGGCAGG + Intronic
1118202922 14:63693839-63693861 ATTTGCAAGGCCAAGGTGGGAGG - Intronic
1119779293 14:77267430-77267452 ATGAGGGAGGCTGAGGTGGGAGG + Intronic
1202920694 14_KI270723v1_random:28555-28577 ATGGGCAAGGCTGGGGTAGCAGG + Intergenic
1202924239 14_KI270724v1_random:9094-9116 ATGGGCAAGGCTGCGGTAGCAGG - Intergenic
1126660172 15:51025557-51025579 AGGAGCAAGCCTAGGGTGGCAGG + Intergenic
1126744722 15:51814390-51814412 CTGACCAGGGCTAAGGTTGCTGG - Exonic
1126845652 15:52758556-52758578 ATGAACATGGCTAACTTGGCAGG - Intronic
1127675513 15:61234425-61234447 ACTAGGAAGGCTAAGGTGGGAGG + Intergenic
1128910331 15:71508071-71508093 ATGAACATTGCTAAGGGGGCGGG + Intronic
1129381468 15:75170323-75170345 ATGACCCAGGCTAAGATGGGTGG - Intergenic
1129977177 15:79832059-79832081 ATGAGAAAGCCTACGGTGTCTGG + Intergenic
1130123109 15:81069354-81069376 ATTAGAAAGGCTAAGGTGGCTGG + Intronic
1132906883 16:2287023-2287045 ATTAGCCATGCTCAGGTGGCAGG - Intronic
1133414735 16:5597546-5597568 ATCAGCCAGGCTGTGGTGGCGGG - Intergenic
1134659127 16:15970572-15970594 ATGAGGAAGGCCACTGTGGCTGG + Intronic
1138197263 16:55060880-55060902 ATGTGCAAGGCCTAGGTAGCAGG - Intergenic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1138718558 16:59052282-59052304 GTGAGCAAGGATTAGGTCGCTGG + Intergenic
1139635126 16:68253930-68253952 ATTTGCAAGGCCAAGGTGGGAGG - Intronic
1139675645 16:68521403-68521425 AGGAGGAAGGCTAAGGTGAAAGG - Intergenic
1139996330 16:70984281-70984303 ATGTGGGAGGCTAAGGTGGGAGG + Intronic
1141179559 16:81743240-81743262 ACTAGCGAGGCTAAGGTGGGAGG + Intronic
1141377918 16:83548753-83548775 AGAATCAAGGGTAAGGTGGCTGG - Intronic
1141539771 16:84710835-84710857 CTGAGCCAGGCTCAGGTTGCAGG + Intronic
1142681889 17:1554873-1554895 ATTAGCAAGGTCAAGGTGACTGG - Intronic
1143571498 17:7761726-7761748 CTGAGGGAGGCTAAGGTGGGTGG - Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145963225 17:28899650-28899672 TTGAGAAAGGCTAATGTGGCTGG - Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1147138391 17:38448011-38448033 AGGAGCATGGCAAAGGTGCCAGG - Intronic
1149275966 17:55037292-55037314 ATGAGGAAGGCAAAGATGGTTGG + Intronic
1151426741 17:74035600-74035622 ATGAGCAAGGCACAGTGGGCAGG + Intergenic
1151999134 17:77634302-77634324 ATGGGCAAGGCGAAGGTTGGAGG + Intergenic
1152456662 17:80421092-80421114 AGAAGCAAGGCTAAGGCTGCTGG - Intronic
1153213043 18:2789128-2789150 ATTCGAAAGGCTAAGGTGGGAGG - Intronic
1154455641 18:14520864-14520886 AGTAGAAAGGCTGAGGTGGCAGG + Intronic
1155047119 18:22112624-22112646 ATGGGCAAGGCCCAGGAGGCAGG + Intergenic
1155934424 18:31740351-31740373 ATATGAAAGGCTAGGGTGGCAGG - Intergenic
1155946930 18:31863759-31863781 AGGAGCAGGGCAAAGGTGGTAGG - Intronic
1156170797 18:34482560-34482582 ATCATCAAGGTTAAGGTGGGGGG + Intergenic
1156511897 18:37643977-37643999 ATGAGCAAACCTAAGGTCGGGGG + Intergenic
1157798888 18:50602452-50602474 CTGAGCTAGGCTCAGGGGGCAGG - Intronic
1159784318 18:72695875-72695897 CTTTGCAAGGCTAAGGTGGGTGG + Intergenic
1160817688 19:1043642-1043664 AGGAGCAAGGCAGAGGGGGCAGG + Intronic
1161108973 19:2458228-2458250 ATTTGGGAGGCTAAGGTGGCAGG + Intergenic
1161339889 19:3735625-3735647 ATGAGCAACGGTCAGGTGGGTGG + Exonic
1162757908 19:12871255-12871277 AAGAGCACGGGAAAGGTGGCGGG + Intronic
1162784966 19:13028910-13028932 AGGACCAAGGCTTAGGTGTCAGG - Intronic
1163937294 19:20458841-20458863 ATTAGCTGGGCTTAGGTGGCGGG + Intergenic
1164870301 19:31637834-31637856 ACTTGCAAGGCTAAGGTGGGAGG + Intergenic
1165995335 19:39839930-39839952 AACAGCAAGGCCAGGGTGGCTGG + Intronic
1168234222 19:55051839-55051861 ATGTGGAAGGCTGAGGTGGGAGG - Intronic
1168269812 19:55243420-55243442 AAAAGAAAGGCCAAGGTGGCAGG + Intronic
925547433 2:5032668-5032690 ATGAGGAAGACTTAGGTTGCAGG + Intergenic
926111735 2:10188163-10188185 ATGAGCAGGGCCCAGGTGGCTGG + Intronic
926152134 2:10431160-10431182 ATAAGCAAGGCTTATGTGGGTGG + Intergenic
926239895 2:11077472-11077494 ATGAGCAATGGTCTGGTGGCAGG + Intergenic
927958461 2:27224552-27224574 AGGAGAAGGGCTAAGGTTGCAGG + Intronic
929693458 2:44093875-44093897 AAGGGCAAGGCTGAGGTGCCTGG + Intergenic
929924271 2:46196152-46196174 CTGAGCAAGGCTGGGCTGGCGGG + Intergenic
930041246 2:47126432-47126454 CTCAGCGAGGCTAAGGTGGGAGG - Intronic
932383819 2:71311943-71311965 ATTTGGAAGGCTAAGGTGGGAGG + Intronic
934619902 2:95797596-95797618 ATGGGCCAGGCTAAGGGGACAGG + Intergenic
934640986 2:96026961-96026983 ATGGGCCAGGCTAAGGGGACAGG - Intronic
935041143 2:99428472-99428494 ATGAGAAAGGCAAAGTTAGCTGG + Intronic
935996407 2:108778971-108778993 CTGTGCAAGGCCAAGGTGGCAGG - Intronic
936948543 2:117953783-117953805 ATGTGGAAGGCTGAGGTGGAAGG + Intronic
937153369 2:119701327-119701349 TTGAGCCAGGCTAAGGTTCCTGG + Intergenic
938193211 2:129301184-129301206 CTGAGCATGGCCAAGATGGCTGG - Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
940835421 2:158515935-158515957 ATTAGAGAGGCTGAGGTGGCAGG + Intronic
941191564 2:162390522-162390544 ATGAGCATTGTTAAGATGGCTGG - Intronic
941367496 2:164624944-164624966 ATTTGGAAGGCTGAGGTGGCTGG - Intergenic
941563489 2:167078686-167078708 ATTAGCAAGGGCATGGTGGCGGG + Intronic
941754740 2:169173088-169173110 ATGAGCAAGGCTGTGGTAGGAGG - Exonic
941876227 2:170436226-170436248 ATGAGCAATGCTTAGCTGGGAGG + Intronic
942034063 2:171993792-171993814 CTTTGGAAGGCTAAGGTGGCAGG + Intronic
942156073 2:173129070-173129092 ATCAGCTAGGCCATGGTGGCGGG - Intronic
943069590 2:183124768-183124790 ATGGGCCAGTCTAACGTGGCTGG - Intronic
943483643 2:188454038-188454060 CTGAGCAAGGCTCAGGCAGCAGG - Intronic
943594313 2:189837370-189837392 ATTCACAAGGCTAAGGTGGGAGG - Intronic
944562641 2:200956336-200956358 ATGAGTGAGGCTGAGGTGGGAGG - Intronic
944805955 2:203281398-203281420 GTAAGGAAGGCTAAGGTGGGAGG + Intronic
946593777 2:221282564-221282586 ATGAGTATGGCCAAGGGGGCAGG - Intergenic
947566289 2:231196002-231196024 ATGAGGGAGGCTGAGGTGGGAGG + Intergenic
947639978 2:231701874-231701896 ATGAGCATAGGTAAGGAGGCTGG - Intergenic
947856527 2:233328163-233328185 GTCAGCAAGGCTAAGGTGTGAGG - Intronic
948358672 2:237401926-237401948 CTTAGGAAGGCTAAGGTGGAAGG - Intronic
1168961878 20:1875645-1875667 ATGAGCAAAGGTAAGGAGGGAGG - Intergenic
1170164143 20:13344704-13344726 ATGAGGAAGGCAAAGGATGCCGG - Intergenic
1170926390 20:20728461-20728483 AGGAGGGAGGCTAAGGTGGGAGG - Intergenic
1171505368 20:25628647-25628669 ATGACAAAGACAAAGGTGGCTGG + Intergenic
1172325159 20:34028931-34028953 AAGAGCAAGGCTGAGGTGACTGG + Intronic
1174412759 20:50346552-50346574 TTGAGCAAGGGTAAGGAGGTGGG - Intergenic
1175895442 20:62333806-62333828 ATGAGCCAGAGGAAGGTGGCGGG + Intronic
1176196766 20:63840452-63840474 ATGAGCAAGCATACGCTGGCAGG - Intergenic
1179137554 21:38693534-38693556 ATGTGCCAGGCAAAGGTAGCAGG - Intergenic
1179465408 21:41568377-41568399 CTGGGCAAGGCAAAGGTGCCAGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181430947 22:22881430-22881452 GTGAGCCAGGCCGAGGTGGCTGG - Intronic
1183222682 22:36526883-36526905 ATGGAAAAGACTAAGGTGGCTGG - Intronic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1183948504 22:41339951-41339973 ATGACCAAGCCGAAGGAGGCGGG - Exonic
949466957 3:4353957-4353979 AGGAGTAAGACTGAGGTGGCAGG - Intronic
950677126 3:14561081-14561103 ATGAGCAAGCTTCAGATGGCTGG - Intergenic
952405356 3:33000046-33000068 ATGTGGGAGGCTAAGGTGGGAGG - Intronic
952498329 3:33935700-33935722 GTGAGGAAGGCTGATGTGGCTGG + Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953011786 3:39033002-39033024 ATTAGCCAAGCTATGGTGGCGGG + Intergenic
953213650 3:40897979-40898001 AGGAGCAGGGCTGAGGTGGTGGG + Intergenic
953606707 3:44417314-44417336 TTGAGCAAAGCTATGGAGGCTGG - Intergenic
953625471 3:44567342-44567364 ATGTTCTAGGCTAAGGTGGGAGG - Intronic
954043727 3:47910966-47910988 ATGACTCAGCCTAAGGTGGCAGG - Intronic
955565424 3:60239319-60239341 ATTTGGAAGGCTAAGGTGGGAGG + Intronic
957662376 3:83177431-83177453 ACTAGGAAGGCTAAGGTGGGAGG - Intergenic
960991469 3:123314347-123314369 AGAAGCCAGGCTCAGGTGGCAGG + Intronic
961335171 3:126171757-126171779 ATGAGAAAGGCTAGAGGGGCTGG - Intronic
961703085 3:128762259-128762281 ATGAAAAAGGCTAAGGAGGAGGG + Intronic
962782342 3:138731359-138731381 ATGAGGGAGGCTGAGGTGGGAGG - Intronic
963451344 3:145485237-145485259 ATGAGGAAGGCCAAAGTGGGAGG + Intergenic
963880867 3:150526649-150526671 ATTAGGAAGGCTGAGGTGGGAGG + Intergenic
963914843 3:150849564-150849586 ATTCGGAAGGCTAAGGTGGGAGG - Intergenic
964516545 3:157515584-157515606 ACGAGCCAGGCTGAGGTGGGAGG - Intronic
964703315 3:159592547-159592569 ATGTGCAAAGACAAGGTGGCAGG - Intronic
966184933 3:177218727-177218749 ATTAGCCGGGCTCAGGTGGCGGG - Intergenic
966866243 3:184260485-184260507 GGGAGGAAGGCTCAGGTGGCAGG - Intronic
967020054 3:185514913-185514935 ATGAGGAAGGCTGAGTAGGCTGG - Intronic
968901055 4:3432014-3432036 ATGAGAAAGCCTGAGGTGCCTGG + Intronic
969528181 4:7714799-7714821 ATGAGGAGGGGTGAGGTGGCAGG - Intronic
970314800 4:14819068-14819090 ATTAGGGAGGCTAAGGTGGAAGG - Intergenic
970360405 4:15303578-15303600 ATGAGACAGGCTGAGGAGGCAGG + Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
971320703 4:25603648-25603670 ATGAGGGAGGCTGAGGTGGGAGG - Intergenic
974592546 4:63972577-63972599 ATGAAGAAAGCAAAGGTGGCTGG - Intergenic
975618816 4:76275221-76275243 ATGAGCAAGGCTAAGGTGGCAGG - Intronic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
977092457 4:92695073-92695095 ACTAGGAAGGCTAAGGTGGGAGG - Intronic
977177862 4:93837810-93837832 AGAAGCAAGTATAAGGTGGCTGG - Intergenic
980203454 4:129685942-129685964 ACTAGGAAGGCTAAGGTGGGAGG + Intergenic
983450336 4:167902063-167902085 AGGAACAAGGCAAAGATGGCTGG + Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
988778125 5:34495600-34495622 ATGTGGAAGGCTGAGGTGGGAGG + Intergenic
989192034 5:38679819-38679841 ATGTGGGAGGCTAAGGTGGGAGG + Intergenic
990251955 5:53925302-53925324 ACGAGGGAGGCTAAGGTGGGAGG - Intronic
990568027 5:57049682-57049704 ATTAGCCAGGCTGTGGTGGCAGG + Intergenic
990661268 5:58018161-58018183 ATGTGTAAGGCTAAGGTAACTGG - Intergenic
992502252 5:77354730-77354752 AGGAGCAAGGCTGAGTTGGTGGG - Intronic
993387379 5:87275862-87275884 ATGAAGAAGGCCAAGCTGGCTGG - Intronic
993552893 5:89296693-89296715 ATGAGCAAAGGAAAGGTGTCAGG + Intergenic
994870236 5:105338676-105338698 ATGTTCAAGGCTAATGTAGCTGG - Intergenic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
996940385 5:128998181-128998203 ATGGGGGAGGCTGAGGTGGCAGG + Intronic
998015683 5:138730208-138730230 ATTAGCCAGGCCATGGTGGCGGG + Intronic
998601078 5:143585699-143585721 ATGAGAAATGCTAAGATTGCTGG + Intergenic
999799527 5:155019909-155019931 ATGAGCTGGGCTGAGTTGGCGGG - Intergenic
1001776814 5:174335093-174335115 TGGAGCAGGGCTTAGGTGGCTGG - Intergenic
1003913666 6:10765701-10765723 ATTGGCAAGGCTGAGGTGGGTGG - Intronic
1004407494 6:15347858-15347880 ATTTGCAAGGCTGAGGTGGCAGG - Intronic
1005033140 6:21530063-21530085 ATGAACAAGCCCAAAGTGGCTGG - Intergenic
1007182245 6:39937773-39937795 GTGGGCAAGGTTAAGGTGGGCGG - Intergenic
1007250308 6:40490738-40490760 AGGAGCAAGTCTCTGGTGGCAGG - Intronic
1007652436 6:43431906-43431928 ATGAGTTAGGTTCAGGTGGCCGG + Intronic
1011705988 6:90002183-90002205 AGGAGCAAGCCTGAGGTGGGAGG - Intronic
1014230675 6:118898659-118898681 TTGTGGGAGGCTAAGGTGGCTGG - Intronic
1014398414 6:120955723-120955745 ATGAGCAAGGACAAAGTGGCAGG + Intergenic
1015452180 6:133383269-133383291 ATGGCCAAGGCCAAGGTGGGTGG + Intronic
1015954291 6:138583853-138583875 ATGAGGGAGGCCAAGGTGGGAGG + Intronic
1016054619 6:139566161-139566183 ATTAGCCAGGCAATGGTGGCAGG - Intergenic
1016505854 6:144778172-144778194 ATGATCAAAGCTGAGCTGGCTGG + Intronic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1020185045 7:5952513-5952535 ATGGGGAAGGCTGAGGTGGGAGG + Intronic
1020276772 7:6629374-6629396 ATGAGCCGGGATGAGGTGGCAGG - Intergenic
1020297871 7:6772231-6772253 ATGGGGAAGGCTGAGGTGGGAGG - Intronic
1020786566 7:12580698-12580720 ATGAGCAAGGCAAAGATTTCAGG - Intronic
1021265375 7:18514694-18514716 ATTTGGAAGGCTAAGGTGGGAGG + Intronic
1022171612 7:27837315-27837337 ATGAGCAGGGCAAGGGTGGTGGG + Intronic
1022637951 7:32154963-32154985 GGGAGTAAGGCCAAGGTGGCTGG + Intronic
1022669305 7:32440954-32440976 AGGAGCAAGGCCAAGGGGGCAGG + Intergenic
1024975980 7:55113937-55113959 ATGGGCACGGCCATGGTGGCAGG + Intronic
1024976943 7:55122190-55122212 ATGAGCAAGGCTGAGAGTGCTGG - Intronic
1025637358 7:63334317-63334339 ATGAGCTGGGCTGTGGTGGCCGG - Intergenic
1025645337 7:63413782-63413804 ATGAGCTGGGCTGTGGTGGCCGG + Intergenic
1025911626 7:65833293-65833315 CTCAGGAAGGCTGAGGTGGCAGG - Intergenic
1026616781 7:71912166-71912188 AAGAGAAAGGCTTAAGTGGCCGG + Intronic
1027115705 7:75478206-75478228 AACAACAAGGCTAAGGTGGGCGG - Intronic
1028093567 7:86733016-86733038 ATAAGAAAGGCTGAGATGGCCGG + Intronic
1029572643 7:101380537-101380559 AGGAGGGAGGCTAAGGTGGGTGG - Intronic
1030226647 7:107159203-107159225 ATGAGCAATGCTAAGTTGGTGGG - Intronic
1032248993 7:130236860-130236882 ATTAGCAAGGCTCACGTGGCTGG + Intergenic
1033273447 7:139953390-139953412 ATGAGCCAGGAGAAGGTCGCAGG - Exonic
1033283270 7:140020812-140020834 ATTAGCCAGGCTGTGGTGGCGGG + Intergenic
1034952621 7:155310656-155310678 GTGAGGAGGGGTAAGGTGGCAGG - Intergenic
1037298975 8:17431626-17431648 CTCAGCAAGGCTGAGGTGGGAGG + Intergenic
1039407861 8:37328286-37328308 ATTAGAAAAGCTAAGGGGGCAGG - Intergenic
1039557046 8:38484067-38484089 ATAAGGAAGGCAAAGGGGGCAGG - Intergenic
1041447175 8:57965065-57965087 ATGAGGAAGGGTCAGCTGGCAGG + Intergenic
1042556620 8:70038716-70038738 ATCAGGAAGGCTAAGGTGGGAGG + Intergenic
1043053964 8:75413706-75413728 ATGAGCATGGGCATGGTGGCGGG + Intronic
1047319364 8:123765092-123765114 ACAAGCAAGGCTAAGGTGTCTGG + Intergenic
1047778993 8:128096691-128096713 ATGAACAAGGCAAAGGGGCCTGG - Intergenic
1051566989 9:18510985-18511007 ATGAGCAAAGCTAAATTAGCTGG - Intronic
1051583202 9:18699431-18699453 ACCAGGAAGGCTAAGGTGGGAGG - Intronic
1052164556 9:25309117-25309139 ATTAGCCGGGCTATGGTGGCGGG - Intergenic
1052774964 9:32723992-32724014 ATTAGCCAGGCCAAGGAGGCTGG + Intergenic
1053176899 9:35932352-35932374 ATGTGGGAGGCTAAGGTGGGAGG + Intergenic
1054359371 9:64098959-64098981 CTTTGCAAGGCCAAGGTGGCTGG - Intergenic
1056218682 9:84429901-84429923 ATGTGGAAGGCTGAGGTGGGAGG - Intergenic
1057413278 9:94838155-94838177 ATGAGCCAGGCATGGGTGGCGGG - Intronic
1058851414 9:109014623-109014645 ATGATCCAGGCCAAGGTGTCCGG - Intergenic
1059266644 9:113038672-113038694 ACTAGGAAGGCTAAGGTGGGAGG + Intronic
1060929007 9:127476437-127476459 ACGAGGGAGGCTAAGGTGGGAGG + Intronic
1062113157 9:134793364-134793386 AGAAGGAAGGCTAAGGAGGCTGG + Intronic
1062707531 9:137953681-137953703 ATGAGCCAGGCTAAGGAAGGAGG + Intronic
1186676459 X:11822445-11822467 AAGAGGAAGTCTAAGGAGGCTGG + Intergenic
1187928630 X:24273828-24273850 ATGCGGAAGGCTGAGGTGGGAGG - Intergenic
1189169769 X:38897828-38897850 GTGAGAAAGGACAAGGTGGCCGG + Intergenic
1189661219 X:43302016-43302038 AGGAGCAAGACCAAGGTGGCAGG - Intergenic
1191011371 X:55762942-55762964 AGCAGCAAGGCCAATGTGGCAGG + Intergenic
1191690543 X:63933868-63933890 ATGAGGAAAGCTGAGGAGGCCGG - Intergenic
1192410179 X:70927102-70927124 ATGAGGAAGGTTAAGCTGCCTGG - Intronic
1192419466 X:71016412-71016434 ATGAGCAAGGCTGTGGCGGGTGG - Intergenic
1194956270 X:100184531-100184553 ATAAGCAAGGCAAAGGTGAATGG - Intergenic
1195418417 X:104645555-104645577 ATGAGAAAGACAAAGGTGTCTGG - Intronic
1196025664 X:111039184-111039206 GTGAGCAAGGGAAGGGTGGCAGG - Intronic
1196116314 X:112003440-112003462 AAAAGCAAGGCCAGGGTGGCTGG + Intronic
1196791117 X:119465822-119465844 ATTTGGAAGGCTAAGGTGGGAGG + Intergenic
1196851398 X:119942363-119942385 ATGAGGGAGGCTGAGGTGGGAGG + Intronic
1199276446 X:145949020-145949042 AGCAGAGAGGCTAAGGTGGCTGG + Intergenic
1199444410 X:147905088-147905110 CTTTGCAAGGCTAAGGTGGGAGG - Intergenic
1200939776 Y:8769353-8769375 ATGAGGAAGGCTTGGGTGCCTGG + Intergenic