ID: 975622141

View in Genome Browser
Species Human (GRCh38)
Location 4:76306496-76306518
Sequence CCGGCCTTGCCAGTTGCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 123}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975622141_975622148 21 Left 975622141 4:76306496-76306518 CCGCTGGCAACTGGCAAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 975622148 4:76306540-76306562 AAGAGCGCTGGAGTCTTCCCCGG 0: 1
1: 0
2: 0
3: 14
4: 128
975622141_975622144 -7 Left 975622141 4:76306496-76306518 CCGCTGGCAACTGGCAAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 975622144 4:76306512-76306534 AGGCCGGGAACAGAAAGTGTAGG 0: 1
1: 0
2: 1
3: 11
4: 145
975622141_975622149 22 Left 975622141 4:76306496-76306518 CCGCTGGCAACTGGCAAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 975622149 4:76306541-76306563 AGAGCGCTGGAGTCTTCCCCGGG 0: 1
1: 0
2: 2
3: 13
4: 131
975622141_975622151 26 Left 975622141 4:76306496-76306518 CCGCTGGCAACTGGCAAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 975622151 4:76306545-76306567 CGCTGGAGTCTTCCCCGGGAGGG 0: 1
1: 0
2: 1
3: 4
4: 110
975622141_975622145 -6 Left 975622141 4:76306496-76306518 CCGCTGGCAACTGGCAAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 975622145 4:76306513-76306535 GGCCGGGAACAGAAAGTGTAGGG 0: 1
1: 0
2: 0
3: 11
4: 134
975622141_975622150 25 Left 975622141 4:76306496-76306518 CCGCTGGCAACTGGCAAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 975622150 4:76306544-76306566 GCGCTGGAGTCTTCCCCGGGAGG 0: 1
1: 0
2: 1
3: 5
4: 83
975622141_975622147 9 Left 975622141 4:76306496-76306518 CCGCTGGCAACTGGCAAGGCCGG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 975622147 4:76306528-76306550 GTGTAGGGACAGAAGAGCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975622141 Original CRISPR CCGGCCTTGCCAGTTGCCAG CGG (reversed) Intronic
901534695 1:9874606-9874628 CTGGCCTTGGCAGTGGGCAGTGG - Intronic
901940386 1:12657358-12657380 CGGGACTTACCAATTGCCAGTGG + Intronic
903364670 1:22798635-22798657 CCGGAATTGGAAGTTGCCAGGGG + Intronic
904521486 1:31099478-31099500 CAGGCCTTGCCACTCTCCAGAGG - Intergenic
905519626 1:38587923-38587945 TGGGCCTGGCCAGTTGCCAGTGG - Intergenic
907781599 1:57572043-57572065 CCGTCCTGGCCAGCTGCGAGTGG + Intronic
910090303 1:83454694-83454716 AAGGGCTTGCCAGTTGCCAGTGG - Intergenic
919273124 1:195376765-195376787 CTGGCAATGCCAGTTGCCATGGG + Intergenic
921329223 1:214019114-214019136 CAGGCCTTGTCACCTGCCAGTGG - Intronic
922769223 1:228173195-228173217 CAGTCCTTGCCAGTTGCCCAGGG - Intronic
922791801 1:228315002-228315024 CCGGCCTTGCCCTGTGACAGTGG + Intronic
923671070 1:236041973-236041995 CAGGTCTTTCCAGTTGGCAGTGG - Exonic
924515311 1:244760715-244760737 CAGGCTCTGACAGTTGCCAGGGG + Intergenic
1064185935 10:13161764-13161786 CCGGCCATGCCAGCTCCGAGCGG - Intronic
1065993082 10:31031767-31031789 CCGGGACTGCCAGCTGCCAGCGG + Intronic
1066656835 10:37704714-37704736 CTGGCATTGCCAGTTCCCACAGG + Intergenic
1067041365 10:42954952-42954974 CTGGCATTGCCAGTTCCCACAGG + Intergenic
1074780580 10:116799163-116799185 CAGGGCTGGCCAGTTGCCTGAGG - Intergenic
1076784888 10:132744963-132744985 CGGGCCTCGCAAGCTGCCAGGGG - Intronic
1077376869 11:2209340-2209362 CCGGCCATGCCTGGGGCCAGAGG - Intergenic
1081658699 11:44874725-44874747 CCGGGCCTGGCAGTTCCCAGTGG + Intronic
1083470966 11:62883683-62883705 TAGGCCTTGCCAGTTACTAGGGG + Intronic
1083592759 11:63904968-63904990 CCGGCCCTGGCTGTGGCCAGAGG - Exonic
1084960519 11:72713900-72713922 CCGGCTTTGCCAGTTACCCATGG - Intronic
1089690367 11:120183286-120183308 CCATCCTTGCCATTTGACAGAGG - Intronic
1091097800 11:132840415-132840437 CCAGGCTTGCCAGTTCCCACTGG + Intronic
1091178016 11:133579309-133579331 CCGGCCTTCCCAGCTTCCAGAGG - Intergenic
1102030211 12:109735997-109736019 CCAGCCAGGCCTGTTGCCAGTGG + Intronic
1103913210 12:124363215-124363237 CTGGCCTTCCCAGTTGCAACTGG - Intronic
1103925991 12:124423563-124423585 CCGGCCTTGCCAGCCGCCCGAGG - Intronic
1104195959 12:126538299-126538321 CCTGCCTTACCAATTGCGAGGGG + Intergenic
1104951356 12:132442030-132442052 CCGGCTCTGCCAGAGGCCAGTGG + Intergenic
1107469884 13:40681956-40681978 CCAGCCCAGCCAGTTCCCAGTGG - Intergenic
1111529186 13:89514772-89514794 CCAGCCATGCCAGGTGGCAGTGG + Intergenic
1112707176 13:102083601-102083623 ACGGCCTTACAAGTTGTCAGTGG - Intronic
1112713884 13:102161349-102161371 CCTGCCGTTCCAGTTGCCACTGG + Intronic
1112715701 13:102182289-102182311 CTTGCCTTGCCAGTTGTCAGAGG - Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1122075284 14:99231528-99231550 CAGGCCTGCCCAGCTGCCAGCGG - Exonic
1122313284 14:100810893-100810915 TGGGCCTTGCCAGTTGCCTGTGG + Intergenic
1123014635 14:105367874-105367896 CCGACCTGGACCGTTGCCAGTGG + Intronic
1132752973 16:1467331-1467353 CCAGCCTTGCCACATGCCAGTGG + Intronic
1132756274 16:1487024-1487046 CCGCCCTTTCCAGCTTCCAGAGG + Intronic
1134818111 16:17222872-17222894 GCGGCCGTCACAGTTGCCAGAGG - Intronic
1136705275 16:32182675-32182697 CAGTGCTTGCCAGTTGGCAGTGG - Intergenic
1136762638 16:32746732-32746754 CAGTGCTTGCCAGTTGGCAGTGG + Intergenic
1136805462 16:33123654-33123676 CAGTGCTTGCCAGTTGGCAGTGG - Intergenic
1138438242 16:57018636-57018658 CCAGCCTTCCCAATTCCCAGAGG - Intronic
1141342786 16:83218526-83218548 CTGGCCTTGACAGTAACCAGAGG + Intronic
1203064794 16_KI270728v1_random:1007051-1007073 CAGTGCTTGCCAGTTGGCAGTGG + Intergenic
1143071271 17:4295830-4295852 CCTGCCTAGCCAGCTGCCACTGG - Intronic
1143349554 17:6277381-6277403 GCCTCCTTGCCAGCTGCCAGAGG + Intergenic
1143786135 17:9257065-9257087 TCTGCCTCGCCAGGTGCCAGCGG - Intronic
1144947311 17:18976550-18976572 CCAGCCCTGACAATTGCCAGGGG + Intronic
1146372820 17:32275875-32275897 CTGGCCTGGCCAGATCCCAGGGG + Intronic
1146949342 17:36894842-36894864 CCAGCTTGGCCAGTGGCCAGTGG + Intergenic
1148133438 17:45276198-45276220 CCGGACCTGCCATTTGGCAGTGG - Intronic
1148159739 17:45443211-45443233 CCAGCCTTGGCAGGGGCCAGAGG - Intronic
1150391025 17:64790083-64790105 CCAGCCTTGGCAGGGGCCAGAGG - Intergenic
1150409808 17:64934135-64934157 CCAGCCTTGGCAGGGGCCAGAGG - Intergenic
1153734294 18:8048411-8048433 CCTGCCATTCCAGTTGTCAGTGG + Intronic
1160810921 19:1012625-1012647 CCTGCCTTGCCTGCTGGCAGTGG - Intronic
1160840258 19:1143603-1143625 CCTGCCTTTCCAGTGTCCAGAGG + Intronic
1161907458 19:7167713-7167735 CCGGACTGGCCAGTTTCCTGGGG - Intronic
1164139819 19:22449093-22449115 ATGGCCTTGCCAATTACCAGCGG + Intronic
1166740898 19:45114267-45114289 CAGGCTTTGCCTGTTCCCAGGGG + Intronic
1167628521 19:50608217-50608239 CACGCCTTGCCAATCGCCAGGGG + Intergenic
927104221 2:19810122-19810144 CCAGCCTTGCCCTTTCCCAGGGG - Intergenic
931198524 2:60075280-60075302 CAGGCCTTGAGAGTTGGCAGAGG - Intergenic
932221582 2:70003675-70003697 CCGGCCATGACGGCTGCCAGAGG + Intergenic
938065930 2:128282054-128282076 CTGACCTTGCCAGTCCCCAGAGG + Intronic
938421071 2:131147300-131147322 TCGGCCTTGCCAGGGGCCTGTGG - Exonic
938689834 2:133777277-133777299 CCTGCCTTCCCAGTGTCCAGCGG + Intergenic
939269716 2:139921825-139921847 CCAGCTTTGCCAGTAGCCACAGG - Intergenic
944615229 2:201452208-201452230 CCGGCCGTGCCAGGTGCGCGGGG + Intronic
947950344 2:234141741-234141763 CCTGCCTTTCCAGCTTCCAGAGG + Intergenic
949020952 2:241741115-241741137 CCAGCCTTCCCTGTTGCCTGTGG + Intronic
1169084595 20:2818908-2818930 CCAGGATAGCCAGTTGCCAGTGG + Intronic
1173856332 20:46252706-46252728 CAGGTTTGGCCAGTTGCCAGGGG + Intronic
1175290104 20:57869883-57869905 CCATCCCTGCCACTTGCCAGTGG - Intergenic
1175684927 20:61021911-61021933 CGGGCCTTGCCGCTTGGCAGTGG - Intergenic
1176033350 20:63024435-63024457 CCGGGCTGGCCAGTGTCCAGCGG - Intergenic
1176983825 21:15413011-15413033 CTGGCATTGCCATTTACCAGCGG + Intergenic
1177929143 21:27258449-27258471 CTGGCCTAGCCATTTCCCAGTGG + Intergenic
1179113548 21:38468593-38468615 CCTGGCATTCCAGTTGCCAGAGG - Intronic
1179427305 21:41291882-41291904 CTGGCCATGCCAGCTGCCATGGG + Intergenic
1184470210 22:44691898-44691920 AGGGCCTTGCCAGTGTCCAGAGG + Intronic
1184507541 22:44913541-44913563 CCTGCACTGCCAGTTTCCAGTGG - Intronic
1184688008 22:46105080-46105102 CCTGCCCTTCCAGTAGCCAGAGG + Intronic
949504969 3:4719275-4719297 CCAGCGCTGGCAGTTGCCAGGGG - Intronic
950414660 3:12862029-12862051 CTGGCCTTGTCTGGTGCCAGTGG - Intronic
954107954 3:48419422-48419444 TCTGCCTTGCCAGATTCCAGAGG + Intronic
954706606 3:52484409-52484431 CCCGCCATGCCAGTAGCCTGAGG + Intronic
960754863 3:121000689-121000711 CCGGATTTTACAGTTGCCAGAGG + Intronic
962601038 3:136990971-136990993 CTGGCCCTGCCAGTTACCAAAGG - Intronic
962996509 3:140634059-140634081 CCTGCTTTGCCATTTGCCAGGGG - Intergenic
964179489 3:153865929-153865951 CTGGCTTTGCCAGTTGCTAATGG + Intergenic
967074024 3:185986387-185986409 ACGGCCTTGCCGGTAGCCTGAGG - Intergenic
967820041 3:193831847-193831869 CCTGCCTTGCCAGCTGCGTGTGG + Intergenic
968068040 3:195769804-195769826 CTGGCTTTGCCATTTGCCAGTGG + Intronic
968284152 3:197498566-197498588 CAGGCTTTGCCAGTGGCCAGCGG + Intergenic
968503294 4:960979-961001 CCGGCCATGGGAGTGGCCAGTGG - Intronic
969351044 4:6598085-6598107 TCTGGCTTGCCAGGTGCCAGTGG - Intronic
975622141 4:76306496-76306518 CCGGCCTTGCCAGTTGCCAGCGG - Intronic
981943673 4:150315579-150315601 CCAGCCATACCAGCTGCCAGTGG - Exonic
985608675 5:873598-873620 CAAGCCTTGCCTGTAGCCAGTGG + Intronic
985766171 5:1780603-1780625 CCGGCCTCGCCACTTCCCTGAGG + Intergenic
985965189 5:3334027-3334049 CCAGCATTGCCAGGTCCCAGAGG - Intergenic
993509367 5:88752681-88752703 CAGGTCTTGCCATTTGTCAGTGG - Intronic
996706853 5:126506631-126506653 CCTGCCTTGCCAGCTGTCACAGG + Intergenic
998014949 5:138724632-138724654 CTGTCCCTGCCAGTTGCCAGTGG - Intronic
1000773032 5:165380853-165380875 AGGCCCTTGCTAGTTGCCAGTGG - Intergenic
1006425499 6:33960519-33960541 CAGTCCTTGCCAGGTGCCAGGGG - Intergenic
1006445016 6:34075166-34075188 CCGGCCTTGACCGTGGCCTGAGG - Intronic
1013458112 6:110350438-110350460 CCAGGCTAGCCAGTTGCAAGGGG + Intronic
1013709436 6:112880004-112880026 CGGGCCTTCCCAGCCGCCAGGGG + Intergenic
1017853020 6:158322008-158322030 CCTGGCTTGCCAGTCCCCAGTGG - Intronic
1018623053 6:165750422-165750444 CTGGCCTTACCAGCAGCCAGGGG - Intronic
1018915588 6:168130629-168130651 CAGGCCTTGGCAGGTGCCGGTGG - Intergenic
1019486400 7:1291366-1291388 CCAGCGTTGCCAGTTGCAGGAGG - Intergenic
1020182344 7:5932055-5932077 CTGGCCTTGCCAGTTGCACGTGG - Intronic
1020300567 7:6792702-6792724 CCGGCCTTGCCAGTTGCACGTGG + Intronic
1023778818 7:43636567-43636589 CTGGCCTTGCTGGTGGCCAGAGG + Intronic
1024024360 7:45398791-45398813 CCTGCCTTGCCAGGTGCCTTAGG - Intergenic
1024148753 7:46544968-46544990 CAGGCCTTGCTAGGTGCCTGAGG - Intergenic
1026880223 7:73903026-73903048 CCGGTGTTGCCAGGTGCCATGGG - Intergenic
1027307157 7:76911141-76911163 AAGGGCTTGCCAGTTGCCAGTGG - Intergenic
1031008702 7:116500951-116500973 CCATCCTTGCCATCTGCCAGGGG - Intronic
1032094210 7:128929536-128929558 CCAGCCCTGCCAGGGGCCAGGGG + Intergenic
1032188995 7:129752108-129752130 CAGGCCTTCCCACTTGACAGAGG - Intronic
1032712486 7:134472832-134472854 CAGCCCTTGCCAGTTTCCAGGGG + Intergenic
1034019471 7:147626322-147626344 CTGGCCTTGCCAATTGCATGGGG + Intronic
1036930695 8:12952377-12952399 CCTGCCTTTCCAGTAGCCCGGGG + Intronic
1038660580 8:29493229-29493251 CCTGCCTTTCCATTTGCCTGTGG + Intergenic
1053000312 9:34574171-34574193 CCTGCCGGGCCAGCTGCCAGGGG - Intronic
1056841354 9:90000111-90000133 CCAGCCTTCCCAGCAGCCAGTGG - Intergenic
1059669447 9:116478641-116478663 CTTGCCTCCCCAGTTGCCAGGGG + Intronic
1189334935 X:40165282-40165304 CCCGCCCTGCCAAATGCCAGAGG + Intronic
1194018517 X:88657382-88657404 CCAGCCTAGGCACTTGCCAGTGG + Intergenic
1197790445 X:130248923-130248945 CCTGCCCTGCCTGCTGCCAGTGG + Intronic