ID: 975629022

View in Genome Browser
Species Human (GRCh38)
Location 4:76380964-76380986
Sequence CTTCCATGTGGTGTTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975629019_975629022 -8 Left 975629019 4:76380949-76380971 CCCAAGACTAGGCAGCTTCCATG 0: 1
1: 16
2: 533
3: 913
4: 1382
Right 975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG No data
975629020_975629022 -9 Left 975629020 4:76380950-76380972 CCAAGACTAGGCAGCTTCCATGT 0: 1
1: 17
2: 549
3: 894
4: 1368
Right 975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG No data
975629018_975629022 -7 Left 975629018 4:76380948-76380970 CCCCAAGACTAGGCAGCTTCCAT 0: 1
1: 15
2: 595
3: 1481
4: 1557
Right 975629022 4:76380964-76380986 CTTCCATGTGGTGTTGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975629022 Original CRISPR CTTCCATGTGGTGTTGAGCC TGG Intronic
No off target data available for this crispr