ID: 975629561

View in Genome Browser
Species Human (GRCh38)
Location 4:76386777-76386799
Sequence AGGGAGAGCACAGCAACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975629544_975629561 27 Left 975629544 4:76386727-76386749 CCCCTTCCACCATCCCCCAGCAG 0: 1
1: 0
2: 15
3: 151
4: 1924
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629546_975629561 25 Left 975629546 4:76386729-76386751 CCTTCCACCATCCCCCAGCAGTG 0: 2
1: 5
2: 34
3: 136
4: 746
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629548_975629561 21 Left 975629548 4:76386733-76386755 CCACCATCCCCCAGCAGTGGCTG 0: 2
1: 12
2: 42
3: 135
4: 682
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629545_975629561 26 Left 975629545 4:76386728-76386750 CCCTTCCACCATCCCCCAGCAGT 0: 2
1: 1
2: 13
3: 126
4: 1169
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629550_975629561 14 Left 975629550 4:76386740-76386762 CCCCCAGCAGTGGCTGTGCAGAG 0: 1
1: 0
2: 3
3: 43
4: 311
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629551_975629561 13 Left 975629551 4:76386741-76386763 CCCCAGCAGTGGCTGTGCAGAGA 0: 1
1: 1
2: 4
3: 35
4: 361
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629543_975629561 30 Left 975629543 4:76386724-76386746 CCACCCCTTCCACCATCCCCCAG 0: 1
1: 1
2: 21
3: 183
4: 1314
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629549_975629561 18 Left 975629549 4:76386736-76386758 CCATCCCCCAGCAGTGGCTGTGC 0: 1
1: 2
2: 15
3: 81
4: 461
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629552_975629561 12 Left 975629552 4:76386742-76386764 CCCAGCAGTGGCTGTGCAGAGAA 0: 1
1: 0
2: 5
3: 29
4: 256
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data
975629553_975629561 11 Left 975629553 4:76386743-76386765 CCAGCAGTGGCTGTGCAGAGAAT 0: 1
1: 0
2: 2
3: 24
4: 222
Right 975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975629561 Original CRISPR AGGGAGAGCACAGCAACTGG GGG Intronic
No off target data available for this crispr