ID: 975631710

View in Genome Browser
Species Human (GRCh38)
Location 4:76410588-76410610
Sequence CAGTCTCAGGTTTCTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 571}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975631710_975631716 24 Left 975631710 4:76410588-76410610 CCTTCCACAGAAACCTGAGACTG 0: 1
1: 0
2: 2
3: 45
4: 571
Right 975631716 4:76410635-76410657 TTCTTCTAGAACCAGTCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975631710 Original CRISPR CAGTCTCAGGTTTCTGTGGA AGG (reversed) Intronic
900518073 1:3092623-3092645 CATCCTCAGGGCTCTGTGGAGGG + Intronic
902118382 1:14140735-14140757 AAGTTTCAGGCTTCTCTGGAAGG + Intergenic
902896094 1:19481220-19481242 CAGATTCATGTTTCAGTGGAAGG - Intronic
903377113 1:22873755-22873777 ATGTCTCAGGTTGCAGTGGAAGG + Intronic
904253579 1:29240713-29240735 CAGTCTCAGGCTTTTGTGATGGG + Intronic
904443439 1:30548699-30548721 TAGTCTTAGCTTTCTTTGGAAGG + Intergenic
905167468 1:36091437-36091459 CTGACACAGGCTTCTGTGGAGGG - Intronic
905656147 1:39687207-39687229 CAGCCTCAGGTTCCTGAAGATGG - Intronic
907707293 1:56843824-56843846 ATTTCTCAGGATTCTGTGGAAGG - Intergenic
907805931 1:57820083-57820105 CAGTCACTGGTTTCTGTTAATGG - Intronic
908583507 1:65543666-65543688 CAGTCTCAGTTTTCTGCATATGG + Intronic
909434192 1:75621031-75621053 CAGTTTCAGTTTTCTGTATATGG + Intergenic
909454363 1:75833727-75833749 CAGTTTCAGGTTTCTACGTATGG - Intronic
909535903 1:76735815-76735837 CAGTTTCAGTTTTCTGTATATGG + Intergenic
909672859 1:78208363-78208385 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
909891659 1:81015110-81015132 CAGTTTCAGTTTTCTGTATATGG - Intergenic
910016411 1:82530320-82530342 CAGTTTCAATTTTCTGTGTATGG + Intergenic
910650571 1:89562026-89562048 AAGTCTCAGGGATATGTGGATGG + Intronic
910713106 1:90202279-90202301 CAGTCTCAGGTTATGGTGGCAGG - Intergenic
911027593 1:93450786-93450808 CAGACTCAGGTTTAAGTGCATGG - Intronic
911261361 1:95690214-95690236 CCATCTCAGGTTTGTGTGCAGGG - Intergenic
912299178 1:108496137-108496159 CAGTTTCAATTTTCTGTGTATGG - Intergenic
912880927 1:113413075-113413097 CAGTTTCAGCTTTCTGTATATGG + Intronic
912885939 1:113474461-113474483 CAGTTTCAGCTTTCTGTATATGG + Intronic
914208267 1:145554512-145554534 CAGTTTCAGCTTTCTGCGTATGG + Intergenic
914372728 1:147043968-147043990 CAATCTCAGCTATTTGTGGAGGG - Intergenic
914401956 1:147329522-147329544 CAGTTTCAGTTTTCTGTATATGG - Intergenic
914576770 1:148978792-148978814 CAATCTCAGCTATTTGTGGAGGG + Intronic
915649561 1:157299174-157299196 CAGTTTCAGTTTTCTGTATATGG - Intergenic
915653847 1:157341487-157341509 CAGTTTCAGCTTTCTATAGATGG + Intergenic
916645386 1:166779762-166779784 CAGTTTCAGTTTTCTGTATAAGG + Intergenic
918389414 1:184042573-184042595 CAGTTTCAAGCTTCTGTGTATGG - Intergenic
918853834 1:189725323-189725345 CAGTTTCAGTTTTCTGTATATGG + Intergenic
919063481 1:192664157-192664179 CAGTTTCAGCTTTCTATGTATGG + Intergenic
919145709 1:193632139-193632161 CAGAGTCAGGTATCTGTGGGAGG + Intergenic
919255095 1:195110588-195110610 CAGTCTCAGCTTTCTGTATATGG - Intergenic
920496722 1:206460216-206460238 CAGACACAGGTTTATGGGGAGGG + Intronic
920974524 1:210773449-210773471 CCTTCTCAGGTCTCTGTGCAGGG + Intronic
921094809 1:211877226-211877248 CAGTTTCAGCCTTCAGTGGAGGG + Intergenic
921271813 1:213476529-213476551 CTGACTCAGGTTTATGGGGAGGG + Intergenic
921734563 1:218612330-218612352 AAGACTCAGGTTTCTGTGCCAGG + Intergenic
922574797 1:226654559-226654581 CAGACCCAGGGTTCTGTGGCAGG + Intronic
923340509 1:233002948-233002970 CAGTTTCAGTTTTCTGCGTATGG - Intronic
923871775 1:238003003-238003025 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
923981825 1:239333122-239333144 TTGTCTGAGGTTTGTGTGGAGGG + Intergenic
1062954272 10:1529908-1529930 CAGTGGCAGGGTTCAGTGGATGG - Intronic
1062987672 10:1784526-1784548 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1064523098 10:16224207-16224229 CAGTTTCAATTTTCTGTGTATGG + Intergenic
1065391651 10:25188576-25188598 CAGTTTCAGCTTTCTATGTATGG - Intronic
1066545190 10:36492121-36492143 CTGTCTCAGGTCCCTGGGGAGGG + Intergenic
1066617894 10:37314412-37314434 CAGTCTCAGGACACTGTTGATGG + Intronic
1066707042 10:38191762-38191784 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1067161746 10:43831752-43831774 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1067282781 10:44885547-44885569 CAGTTTCAGTTTTCTGAGCATGG + Intergenic
1067349065 10:45459290-45459312 GAGGCTCAGGCTTCTGGGGAAGG + Intronic
1067829951 10:49605834-49605856 CACTCACAGGTTTCTGGGAAAGG + Intergenic
1067996283 10:51277159-51277181 CAGTTTCAGCTTTCTGTATATGG + Intronic
1068296151 10:55074913-55074935 CAGTTTCAGTTTCCTATGGATGG + Intronic
1068623248 10:59209862-59209884 CAGTTTCAGTTTTCTGTATATGG - Intronic
1069489525 10:68849532-68849554 CAGTCTCAGGGAGCTGTGGAAGG + Intronic
1069573698 10:69509781-69509803 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1070850112 10:79556665-79556687 CACTCTGAGGTCTCTGTGGCAGG - Exonic
1070854366 10:79594756-79594778 CACTCTGAGGTCTCTGTGGCAGG - Intergenic
1070857106 10:79614624-79614646 CACTCTGAGGTCTCTGTGGCAGG + Exonic
1071061242 10:81572057-81572079 CAGTTTCAGTCTTCTGTGTATGG - Intergenic
1071337079 10:84609278-84609300 CAATCTCAGGTCCCTGTGGGTGG + Intergenic
1071454319 10:85832913-85832935 GAGTCCCAGGTTGGTGTGGAGGG - Intronic
1071848659 10:89545984-89546006 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1071991793 10:91106933-91106955 CAGTTTCAATTTTCTGTGTATGG + Intergenic
1072356915 10:94620660-94620682 CAGTCTCAGCTTTCTGCATATGG + Intergenic
1074648048 10:115486935-115486957 CAGTTTCAGCTTTCTGTATATGG + Intronic
1074742037 10:116494707-116494729 CAGTTTCAATTTTCTGTGTATGG + Intergenic
1075096465 10:119474761-119474783 CAGTCGTTGGTCTCTGTGGAGGG - Intergenic
1075268395 10:121026074-121026096 CAGTGTCAGGTACCTCTGGAAGG - Intergenic
1075661479 10:124199961-124199983 CAATCTCAGGACTCTGGGGAGGG + Intergenic
1075785199 10:125044652-125044674 CCGTCTCAGCCTTCTGAGGAGGG - Intronic
1076116244 10:127903679-127903701 CAGTCTCAGGTATGTCTGAACGG - Intergenic
1077783714 11:5359937-5359959 CAGTTTCAGCTTTCTGCGTATGG - Intronic
1077988049 11:7375116-7375138 CAGTCTCAGTTTTCTGCATATGG + Intronic
1079119757 11:17673489-17673511 AAGTCTCAGGTTTCTGACTATGG - Intergenic
1079259498 11:18864506-18864528 CAGACTAGGGTTTCTGTGCATGG - Intergenic
1079918052 11:26395738-26395760 CAGTTTCAGTTTTCTGTATATGG - Intronic
1081243763 11:40738164-40738186 CAGTTTCAGTTTTCTGTATATGG - Intronic
1081339727 11:41913265-41913287 CAGTTTCAGTTTTCTGAGTATGG + Intergenic
1081387042 11:42484172-42484194 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1081532944 11:43976649-43976671 GAGTCTCCATTTTCTGTGGAAGG + Intergenic
1081752210 11:45519148-45519170 CACTCTGAGGGTTCTGGGGAAGG + Intergenic
1081798282 11:45837960-45837982 CAGTTTCAGCTTTCTGCGTATGG - Intergenic
1082903177 11:58278512-58278534 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1083207709 11:61162475-61162497 AAGTATCAGGTTTTTGTAGAGGG + Intergenic
1083894929 11:65615153-65615175 AAGTCTCAGGTTTCTGCCAATGG - Intronic
1085127364 11:74010926-74010948 TATTCACAGGTCTCTGTGGAGGG + Intergenic
1085599492 11:77842277-77842299 CAGTATCTGGTTTCTATGGTTGG + Intronic
1086220886 11:84441815-84441837 CAGTTTCAGTTTTCTGTATATGG + Intronic
1086328700 11:85731527-85731549 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1086985636 11:93246113-93246135 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1087337388 11:96861959-96861981 CAGTTTCAGGTGGCTGGGGAAGG - Intergenic
1087703339 11:101462015-101462037 CAGTTTCAGTTTTCTGCGTATGG + Intronic
1088161542 11:106877570-106877592 CAGTTTCAGTCTTCTGTGTATGG - Intronic
1088959126 11:114643454-114643476 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1089244902 11:117111627-117111649 CAGTTTCAGCTTTCTATGTATGG + Intergenic
1089703950 11:120263834-120263856 CGTGTTCAGGTTTCTGTGGATGG + Intronic
1089765571 11:120761646-120761668 CAGTTTCAGTTTTCTGTATATGG + Intronic
1090250893 11:125250978-125251000 CACACCCAGGTTTCTGTGGCTGG + Intronic
1091327614 11:134703009-134703031 CAGGCTCAGGCTGCTGAGGAAGG + Intergenic
1092493253 12:8966131-8966153 CAGTTTCAGCTTTCTATGTATGG - Intronic
1092532493 12:9356269-9356291 CAGTTTCAGCTTTCTATGTATGG + Intergenic
1092587519 12:9914657-9914679 CAGTTTCAGTTTTCTGTGTATGG - Intronic
1093018546 12:14180893-14180915 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1093521833 12:20060003-20060025 CAGTTTCAGTTTTCTGTGTATGG + Intergenic
1094060625 12:26311559-26311581 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1095393298 12:41734493-41734515 CAGTTTCAGCTTTCTATGTATGG + Intergenic
1095404603 12:41854201-41854223 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1095921136 12:47532538-47532560 CAATCTCAGGCATCTGTGGGAGG + Intergenic
1095939335 12:47716002-47716024 CAGTCTCAGGGTTCTCTGCCAGG - Intronic
1096820487 12:54230030-54230052 CAGTCTCAGGCTTCCATGGTAGG + Intergenic
1097129304 12:56798657-56798679 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1097452162 12:59750008-59750030 CAGTTTCAGTTTTCTGTATATGG - Intronic
1098053676 12:66480855-66480877 CAGTTTCAGTTTTCTGTGTATGG - Intronic
1098193162 12:67972220-67972242 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1098574575 12:72026703-72026725 CTGTCTTTGGTTTTTGTGGAAGG + Intronic
1098803182 12:74986953-74986975 CAGTTTAAGGTTTCTGATGATGG + Intergenic
1099404620 12:82245213-82245235 CAGTTTCAGTTTTCTGCGTATGG + Intronic
1099540270 12:83899593-83899615 CAGTCTCAGTTTTCTGCATATGG + Intergenic
1099962410 12:89409320-89409342 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1100381800 12:94069195-94069217 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1101362259 12:104039088-104039110 CAGTTTCAGCTTTCTATGTATGG - Intronic
1101761497 12:107662466-107662488 CAGTCCCAGATTTTTCTGGAGGG - Intergenic
1102498097 12:113333264-113333286 GAGTCTCAGGCTTCTGGGGCAGG + Intronic
1103039303 12:117681730-117681752 CAGTTTCAGTTTTCTGCGTATGG + Intronic
1103942749 12:124509874-124509896 GAGGCTCAGGTTACTGTGGGGGG - Intronic
1104171336 12:126284489-126284511 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1104488683 12:129175270-129175292 CAGTTTCAGTTTTCTGTATATGG + Intronic
1105283902 13:18988640-18988662 CAGTTTCAGCTTTCTGTATATGG - Intergenic
1106914480 13:34497891-34497913 CAGTTTCAGCTTTCTGTGTATGG - Intergenic
1108029615 13:46215814-46215836 CAGTTTCAGTTTTCTGTGTATGG + Intronic
1108137643 13:47383057-47383079 CAGTTTCAGCTTTCTGTTTATGG - Intergenic
1108644580 13:52414322-52414344 CAGCCTCAGGTTTATTTTGAGGG - Exonic
1108815215 13:54282524-54282546 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1108903654 13:55444242-55444264 AAGTCTCAGGTTTGTGAGGATGG + Intergenic
1110972773 13:81787345-81787367 CAGTTTCAGGTTTCTGCTTATGG - Intergenic
1111348782 13:86998767-86998789 CAGTTTCAGTTTTCTGCAGATGG - Intergenic
1112410383 13:99157832-99157854 CAGTCTCATTTATCTGTTGATGG + Intergenic
1113276485 13:108736341-108736363 CAGTTTCAGCTTTCTATGTATGG + Intronic
1113542477 13:111119767-111119789 CAGTGTCAGGATTCTGGGGTTGG + Intronic
1114795976 14:25715217-25715239 CAGTTTCTGGTTTCTGTTTAAGG + Intergenic
1115477567 14:33830695-33830717 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1115578868 14:34738423-34738445 CAGTTTCAGTTTTTTGTGTATGG + Intergenic
1115720654 14:36157589-36157611 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1115928401 14:38463254-38463276 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1116364876 14:44047445-44047467 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1116571995 14:46530269-46530291 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1116792074 14:49349777-49349799 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1117071715 14:52063405-52063427 CAGGCTCTGGTTTCTGCAGAGGG - Intronic
1117246972 14:53896174-53896196 GAGTATCAGGGTTCTTTGGAAGG - Intergenic
1117341890 14:54798706-54798728 CAGTCTCAGGGAGGTGTGGAAGG + Intergenic
1117624913 14:57625744-57625766 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1118088667 14:62447554-62447576 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1119120910 14:72076179-72076201 CAGGCTAAGGTGCCTGTGGAGGG - Intronic
1119993112 14:79221950-79221972 CAGTTTCAGTTTTCTGCGTATGG + Intronic
1120118730 14:80652136-80652158 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1120221046 14:81733982-81734004 CAGTTTCAGTTTTCTGTATACGG + Intergenic
1121830856 14:97050877-97050899 GAGTCTCAGGATACTGGGGAGGG + Intergenic
1122449826 14:101796715-101796737 CAGTCTCAGCTCTCTCTGGGTGG + Intronic
1123475717 15:20591779-20591801 CTGTCAGAGGTTTCTGTGGGGGG + Intergenic
1123642294 15:22408584-22408606 CTGTCAGAGGTTTCTGTGGGGGG - Intergenic
1123774159 15:23561773-23561795 CAGTCACAGGATTCTTTGGGTGG + Intergenic
1123813866 15:23956398-23956420 CAGTCTCAGGCTCCTGAGGCCGG - Intergenic
1123822828 15:24048131-24048153 CAGTTTCAGCTCTCTATGGATGG - Intergenic
1124790923 15:32725834-32725856 CAGTTTCAGTTTTCTGCGTATGG + Intronic
1124893201 15:33751927-33751949 CAGTTTCAGCTTTCTGCGTAGGG + Intronic
1126363311 15:47868597-47868619 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1126381722 15:48055166-48055188 CAGTTTCAGCTTTCTGCGTATGG - Intergenic
1127168851 15:56277371-56277393 CAGTTTCTGTTTTCTGTGTATGG + Intronic
1128821761 15:70662805-70662827 CAGTTTCAGCTTTCTGCGTATGG - Intronic
1129507494 15:76094313-76094335 CAGTTTCAGTTTTCTGCAGATGG + Intronic
1129694500 15:77733013-77733035 CAGACACAGGCTTCAGTGGAAGG - Intronic
1129844055 15:78760167-78760189 CAGTCTCTGGTTTCCGCTGACGG - Intronic
1130677991 15:85971010-85971032 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1130763495 15:86845980-86846002 CAGTCTCAGGCATGTGTCGAAGG - Intronic
1131968883 15:97872879-97872901 CAGTTTCTGTTTTCTGTGTATGG - Intergenic
1202961742 15_KI270727v1_random:129664-129686 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1132603639 16:784683-784705 AAGTCTCAGAGCTCTGTGGAAGG - Intergenic
1133175458 16:4010941-4010963 CAGGTTCAGGTGTCTGGGGAGGG - Intronic
1133285781 16:4690094-4690116 CTGTCTCAGGCTTCTGTGGCAGG + Exonic
1133374613 16:5274018-5274040 CCCTCTCAGGTTTGTGGGGAAGG + Intergenic
1133550017 16:6845377-6845399 CAGTTTCAATTTTCTGTGTATGG + Intronic
1134055258 16:11166001-11166023 GAGTCTCAGGCTTCTGCTGATGG - Intronic
1134786393 16:16947864-16947886 CAGTCTCAGTTTTCTGCATATGG + Intergenic
1135896940 16:26414608-26414630 CAGTCACAAGATTCTTTGGAGGG + Intergenic
1136781843 16:32909457-32909479 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1136887951 16:33944390-33944412 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1137552838 16:49452399-49452421 AAGTCTCAAGGTTTTGTGGAGGG + Intergenic
1138784425 16:59829450-59829472 CAGGATCCGGTTTCTTTGGATGG + Intergenic
1140760215 16:78102865-78102887 CAGCCGCAGGCTTCTGTGGGTGG + Intronic
1140835642 16:78791331-78791353 CAGTCTCAGGTTTATGTATTAGG + Intronic
1142126132 16:88411566-88411588 CAGCCTCAGGTGTGTTTGGAAGG + Intergenic
1203084498 16_KI270728v1_random:1173448-1173470 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1142530140 17:573912-573934 CAGCCTCAGGATTCTTTGAAGGG + Intronic
1142733688 17:1880595-1880617 GAGTCTCTGATTTCGGTGGACGG + Exonic
1143152232 17:4814797-4814819 CAGTCTGAGGCTTCAGGGGAGGG + Intronic
1143947047 17:10602452-10602474 CAGTCTGTGGTTTCTCTGGCTGG + Intergenic
1143974490 17:10820034-10820056 CAGGCTCAGGGCTCTGGGGATGG + Intergenic
1144872378 17:18379176-18379198 CAGCCTCAGCTCTCTGTGGATGG + Intronic
1144873586 17:18384828-18384850 CAGCCTCAGCTCTCTGTGGATGG + Intronic
1146002777 17:29141113-29141135 CAGTCCCTGGCGTCTGTGGAGGG - Intronic
1146310662 17:31765815-31765837 CTGTCTCAGGATTCCTTGGATGG - Intergenic
1146608287 17:34281972-34281994 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1147534897 17:41314230-41314252 CAGTCTCACTTTTCTGTGCTAGG - Intergenic
1148981486 17:51579601-51579623 CAGTCTCAGCTTTCTGCATATGG - Intergenic
1151123372 17:71818096-71818118 AAATCTCATATTTCTGTGGAAGG + Intergenic
1151748887 17:76025846-76025868 CAGCCTCAGCAATCTGTGGATGG - Intronic
1152860297 17:82692470-82692492 CAGACTCTGTCTTCTGTGGATGG - Intronic
1152908922 17:82986044-82986066 CGGTGTCAGGTTTCTGAGCAGGG - Intronic
1153438199 18:5088792-5088814 CTGTCCCAGGATTCTTTGGATGG - Intergenic
1154114869 18:11604473-11604495 CAGTCTCAGGTATTTCTGTATGG + Intergenic
1155554348 18:27001669-27001691 CATTCTGAGGTCTCTGAGGAAGG - Intronic
1155825829 18:30441407-30441429 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1156085022 18:33387654-33387676 CAGTCTCAGTTTTCTGCATATGG - Intronic
1156128560 18:33938974-33938996 CAGTTTCAGCTTTCTGAGTATGG + Intronic
1156144963 18:34164034-34164056 CAGTTTCAGCTTTCTATGTATGG - Intronic
1156355442 18:36336520-36336542 CAATCTAAGGTTGCTGAGGATGG - Intronic
1158099088 18:53809114-53809136 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1158210477 18:55043763-55043785 CAGTTTCAGGTTTCTGCATATGG - Intergenic
1159225225 18:65524805-65524827 CAGTTTCAATTTTCTGTGTATGG + Intergenic
1159903308 18:74067932-74067954 CAGTCTCAGGTATCTCTTCATGG - Intergenic
1160020931 18:75180705-75180727 CAGGCTCAGGGTGCAGTGGAGGG - Intergenic
1160591275 18:79945882-79945904 CAGCCTCAGGTCTCTGTGGGTGG - Intronic
1164353008 19:27375788-27375810 CAGTTTCAGCTTTCTCTGTATGG + Intergenic
1165509525 19:36257922-36257944 CAGCCTCAGGTGTGTGCGGACGG + Intergenic
1165934594 19:39381479-39381501 AAGTGTGAGATTTCTGTGGAGGG + Intronic
1166588602 19:43974195-43974217 CAGTTTCAATTTTCTGTGCATGG - Intronic
1166906712 19:46115564-46115586 CAGGCTGAGGTTTCTGGGGTTGG - Intergenic
1167421120 19:49403995-49404017 CTGTCTCAGGTTACTGCAGAAGG + Intronic
1168166942 19:54555060-54555082 CAGACTCAGCGTTCTGTGAAGGG + Intergenic
1168713866 19:58516184-58516206 CAGGCACTGGCTTCTGTGGAGGG - Intronic
1202649584 1_KI270706v1_random:168582-168604 CAGTTTCAGTTTTCTGCGTAAGG - Intergenic
925053800 2:839517-839539 CAGTCTCAGTTTTCTGCATATGG - Intergenic
925657128 2:6161826-6161848 CAGTTTCAGCTTTCTATGTATGG - Intergenic
926237940 2:11062484-11062506 CAGTTTCAGTTTTCTGTATATGG - Intergenic
929293678 2:40222319-40222341 CAGTTTCAGTTTTCTGCGTATGG - Intronic
930103005 2:47617639-47617661 CAGTCTCTAGTTTCTGTCTAAGG + Intergenic
933603618 2:84358763-84358785 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
934481163 2:94646321-94646343 CAGTTTCAGTTTTCTGTATATGG + Intergenic
935448629 2:103185000-103185022 CATTCAAAAGTTTCTGTGGAAGG + Intergenic
936256420 2:110918352-110918374 CAGTTTCAGTTTTCTGTATATGG - Intronic
936438033 2:112524988-112525010 CAGTTTCAGCTTTCTATGTATGG + Intronic
936628536 2:114174975-114174997 CAGTTTAATGTTTCTTTGGAAGG + Intergenic
937260153 2:120580248-120580270 CTCTCTGGGGTTTCTGTGGATGG + Intergenic
937419894 2:121745454-121745476 CAGTTTCAGTTTTCTGTATATGG + Intronic
938138896 2:128780841-128780863 CAGTCTCAGGTATGTGAGGAAGG + Intergenic
939112411 2:138024337-138024359 GAGTCTCAAGTTTCTATAGAGGG + Intergenic
939700977 2:145390153-145390175 CAGTTTCAATTTTCTGTGTATGG + Intergenic
941235005 2:162960793-162960815 CAGTTTCAGTTTTCTGTGAATGG - Intergenic
942407716 2:175673583-175673605 CAGTTTCAGTTTTCTGTATATGG - Intergenic
942456277 2:176140590-176140612 CAGCCTCAGGTTTCCGGGGCTGG + Intergenic
942899218 2:181094161-181094183 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
943274430 2:185848627-185848649 CAGTTTCAGCTTTCTGTATATGG + Intergenic
943539578 2:189195758-189195780 CAGTTTCAGCTTTCTTTGTATGG - Intergenic
944210231 2:197199114-197199136 GAGGCTCTGGTTTCTGTGGTGGG - Intronic
944327755 2:198426820-198426842 CAGTTTCAGCTTTCTGCGTATGG + Intronic
944590736 2:201215451-201215473 TAGTCTCATTTTTCTGTGTATGG + Intronic
944709363 2:202321849-202321871 CAGTCTGAGGAAACTGTGGAGGG + Intergenic
945029573 2:205650761-205650783 CCGTTTGAGGTTTCTGTGGAGGG - Intergenic
945490616 2:210450287-210450309 CAGTTTCAGTTTTCTGTATATGG - Intronic
946064859 2:216977916-216977938 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
946878987 2:224158964-224158986 CAGTGTCAGAAATCTGTGGAAGG - Intergenic
948745816 2:240093032-240093054 CAGTTTCAGTTTTCTGTATATGG + Intergenic
948924485 2:241086167-241086189 CTGTCTGGGGTTTCTATGGATGG + Intronic
1169339567 20:4786104-4786126 GAGTCTCGGCTTTCTTTGGAGGG - Intronic
1169862170 20:10164337-10164359 CAGTTTCAGCTTTCTATGTACGG - Intergenic
1170497034 20:16935569-16935591 CAGTTTCAGTTTTCTGCAGATGG - Intergenic
1171083188 20:22209778-22209800 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1171193979 20:23182467-23182489 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1171417534 20:24993028-24993050 TCGTCTCACGTTTCTGAGGACGG + Intergenic
1173137358 20:40450717-40450739 CATTCGCAGGTATCTGTGGAGGG - Intergenic
1173150734 20:40564761-40564783 CAGACTCAGGGTTTAGTGGATGG + Intergenic
1173214117 20:41064108-41064130 CAGTTTCAGTTTTCTGCGTATGG + Intronic
1173497073 20:43527478-43527500 AAGTCTCAGGGTCCTGGGGAGGG - Intronic
1173589990 20:44217228-44217250 CAGCCTCCTGTTTTTGTGGATGG + Intergenic
1173806218 20:45927080-45927102 CAGGCTCTGGTTTCTGTGGTGGG - Intergenic
1176045830 20:63092154-63092176 CAGTCTGGGGTTTCTGGAGAAGG + Intergenic
1177039256 21:16086393-16086415 CATTTCTAGGTTTCTGTGGATGG + Intergenic
1177045436 21:16163050-16163072 CAGTGTGATGTTTCTGTGGTAGG + Intergenic
1177384587 21:20392237-20392259 CAGTTTCAGTTTTTTGTGTATGG + Intergenic
1177689649 21:24488789-24488811 CAGTTTCAGTTTTCTGCAGACGG - Intergenic
1177705599 21:24699973-24699995 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1178057303 21:28813870-28813892 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1178700836 21:34833006-34833028 CACTGTTAGGTTTCTGGGGAAGG - Intronic
1179091290 21:38268307-38268329 CAGTTTCAAGTTTCTTTGGCTGG + Intronic
1180073465 21:45450167-45450189 CAGTCTCTGGTCCCTGGGGAAGG + Intronic
1180262016 21:46677605-46677627 CAGTTTCAATTTTCTGTGTATGG + Intergenic
1181506175 22:23359467-23359489 CATTCCCAGGTGTGTGTGGATGG - Intergenic
1181629125 22:24141288-24141310 CAGTCTTTGGTGCCTGTGGATGG + Intronic
1182289291 22:29266160-29266182 CAGTCGCAGGTCTCTGAGTATGG - Intronic
1182852841 22:33490991-33491013 CAGGCTCAGGTTTGTCTGGCTGG - Intronic
1184636434 22:45835673-45835695 CAGCCTCAGCTTTCAGTGCAGGG + Intronic
1184839731 22:47045759-47045781 CACTCACAGGTTGCTGTGGTTGG - Intronic
1185266548 22:49907046-49907068 CAGGCTCAAGGTCCTGTGGAGGG - Intronic
949303841 3:2616934-2616956 CAGTTTCAGTTTTCTGCGTATGG - Intronic
949593087 3:5514067-5514089 CAGTTTCAGGTTTCTGCATATGG - Intergenic
949800064 3:7894024-7894046 CAGTTTCAGCTTTCTATGTATGG + Intergenic
951919891 3:27842727-27842749 CAGTCTCAGGTAAGTGTAGATGG + Intergenic
952079916 3:29745492-29745514 CAGTCTCATGTTTCTGGAAATGG - Intronic
952260616 3:31736553-31736575 CAGTTTGAGGTTTCTGAGGCGGG - Intronic
952290987 3:32015389-32015411 CAGTTTCAGCTTTCTATGTATGG - Intronic
952517198 3:34117263-34117285 CAGTTTCAGCTTTCTATGTATGG + Intergenic
953043942 3:39278885-39278907 CAGGCTCAGGTTTGTGTGGGTGG - Intronic
954488879 3:50882059-50882081 CAGTTTCAGCTTTCTATGTATGG - Intronic
955958911 3:64319036-64319058 CACTCTCAGGTTGCTGTGTGTGG + Intronic
956372814 3:68582319-68582341 CAGTTTCAGCTTTCTATGTATGG + Intergenic
957626575 3:82660183-82660205 CAGTTTCAGTTTTCTGTATATGG + Intergenic
957851523 3:85813736-85813758 CAGTTTCAGTTTTCTGTATATGG + Intronic
958578909 3:95990613-95990635 CAGTCTCAGGTTTCTACATATGG - Intergenic
958649737 3:96923827-96923849 CAGTTTCAGTTTTCTGTATATGG + Intronic
958742432 3:98091287-98091309 CAGTTTCAGCTTTCTATGTATGG + Intergenic
959216984 3:103463721-103463743 CAGTTTCAGTTTTCTGTATATGG - Intergenic
959387402 3:105727740-105727762 CAGTTTCAGTTTTCTGCGTATGG + Intronic
959454210 3:106538988-106539010 CAGTTTCAGTTTTCTGTATATGG - Intergenic
959921925 3:111877764-111877786 CAGTTTCAGTTTTCTGTATATGG + Intronic
960265158 3:115613150-115613172 CAGTTTCAATTTTCTGTGTATGG - Intergenic
960786334 3:121376430-121376452 CAGTTTCAGTTTTCTGTATACGG + Intronic
960828328 3:121816213-121816235 CAGTTTCAGTTTTCTGCGTATGG - Intronic
961285493 3:125798986-125799008 CCCTCTCAGGTTTGTGGGGAAGG + Intergenic
962633951 3:137310205-137310227 CAGTTTCAGCTTTCTGTATATGG + Intergenic
963980709 3:151533597-151533619 CAGTTTCAGCTTTCTGCGTATGG - Intergenic
964029200 3:152116898-152116920 CAGTTTCAGTTTTCTGTCTATGG + Intergenic
964439024 3:156685412-156685434 AAGTCACTGGTTTCTGTAGAAGG - Intronic
965110176 3:164410951-164410973 CAGTTTCAGTTTTCTGTATATGG + Intergenic
965885958 3:173447262-173447284 CAGTTTCAGCTTTCTATGTATGG + Intronic
966280467 3:178220684-178220706 CAGTCTCAGTTTTCTGCATATGG + Intergenic
966639601 3:182175068-182175090 CAGCATCAGGTGTCTGTGGTGGG + Intergenic
967228249 3:187313572-187313594 CAGCCAGAGGTTTCTGTTGAGGG - Intergenic
967758593 3:193198387-193198409 CAGTTTCAGTTTTCTGTATATGG + Intergenic
967833155 3:193939476-193939498 CAGTCACAGGTCTCAATGGATGG + Intergenic
968374803 4:30684-30706 CAGTTTCAGCTTTCTATGTATGG - Intergenic
969218322 4:5741287-5741309 CAGTCTCCTGTTTCAATGGATGG - Intronic
969540163 4:7783798-7783820 CAGTCACAGGTTCGTGTGTAAGG + Intronic
969801220 4:9567049-9567071 CCCTCTCAGGTTTGTGGGGAAGG + Intergenic
970727671 4:19065545-19065567 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
971460249 4:26888517-26888539 CAGTTACAGTTTTCTGTGGCTGG + Intronic
971493671 4:27240905-27240927 CAGTTTCAGCTTTCTATGTATGG - Intergenic
971586606 4:28412198-28412220 CAGTTTCAGCTTTCTATGTATGG - Intergenic
971740662 4:30516354-30516376 CAGTTTCAGTTTTCTGCAGATGG - Intergenic
972085196 4:35206920-35206942 CAGTCCCAGGTTGCTGTTCAAGG + Intergenic
972118087 4:35663711-35663733 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
972454323 4:39238466-39238488 AAATCTCAGGCTCCTGTGGAAGG + Intronic
972921985 4:43954966-43954988 AAATCTCTGGTTTCTGTGAAAGG + Intergenic
973075186 4:45916322-45916344 CAGTTTCAGCTTTCTATGTATGG - Intergenic
973563107 4:52156407-52156429 CAATTTCAGTTTTCTGTGTATGG - Intergenic
973714773 4:53664980-53665002 CAGTCTCAGTTTTCTGCATATGG + Intronic
974444109 4:61956734-61956756 CAGTCTCAGTTTTCTGCATATGG + Intronic
974538815 4:63206091-63206113 CAGTTTCAGCTTTCTATGTATGG - Intergenic
974623850 4:64397157-64397179 CATTTTCAGGTTTCTATGTAGGG + Intronic
974885720 4:67814610-67814632 CAGTTTCAGTTTTCTGTCTATGG - Intergenic
975063422 4:70033999-70034021 CAGTTTCAGTTTTCTGTATATGG - Exonic
975104777 4:70555189-70555211 CAGTTTCAGTTTTCTGTATATGG - Intergenic
975479756 4:74864745-74864767 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
975519150 4:75279798-75279820 CAGTTTCAGTTTTCTGTATATGG - Intergenic
975524735 4:75336483-75336505 CAGTTTCAGTTTTCTGTATATGG - Intergenic
975631710 4:76410588-76410610 CAGTCTCAGGTTTCTGTGGAAGG - Intronic
975765130 4:77659628-77659650 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
977273802 4:94950487-94950509 CAGTTTCAGTTTTCTGCAGATGG + Intronic
977469039 4:97419056-97419078 CAGTTTCAATTTTCTGTGAATGG - Intronic
977552886 4:98460808-98460830 CAGTCTCAGCTTTCTGCATATGG - Intergenic
978185569 4:105853306-105853328 CAGTTTCAGTTTTCTGTGTATGG + Intronic
978236454 4:106466754-106466776 CAGTTTCAGTTTTCTGTGTATGG + Intergenic
978913144 4:114089496-114089518 CAGTCTCAGGTATTTCTTGATGG + Intergenic
978977316 4:114893936-114893958 CAGTTTCAGTTTTCTGCGTATGG + Intronic
979362479 4:119781183-119781205 CAGTCTCTGGTTTCTCTATAAGG - Intergenic
979581820 4:122369717-122369739 CAGTTTCAGGTTTCTGCTTATGG - Intergenic
979587755 4:122441283-122441305 CAGTTTCAGGTTTCTGCATATGG + Intergenic
980039678 4:127925035-127925057 CAGTCTCAGTTTTCTGCGTATGG - Intronic
981432689 4:144679570-144679592 CAGTTTCAGTTTTCTGTATATGG + Intronic
983051727 4:163055846-163055868 CAGTTTCAGTTTTCTGTATATGG + Intergenic
983125236 4:163943385-163943407 CAGTATCAGTCTTCTGTGTATGG + Intronic
983602152 4:169543185-169543207 CAGTCTCAGCTTTCTGCATATGG + Intronic
983958445 4:173724001-173724023 CAGTTTCAGTTTTCTGTATATGG + Intergenic
984136205 4:175942574-175942596 CAGTTTCAGTTTTCTGCGTATGG + Intronic
984689289 4:182707393-182707415 GACTCTCAGGTCTCTGAGGATGG - Intronic
984941236 4:184934051-184934073 CATTTTCAGGTTTCTGAGGCTGG + Intergenic
985460236 4:190098361-190098383 CAGTTTCAGCTTTCTATGTATGG + Intergenic
985641729 5:1066554-1066576 CATTCTCAGGTTCCTGGGGCTGG - Intronic
985984034 5:3498728-3498750 CAGTTTCAGTTTTCTGTATATGG - Intergenic
986484791 5:8224968-8224990 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
987013854 5:13796994-13797016 CAGTTTCAGCTTTCTATGTATGG - Intronic
987355756 5:17061979-17062001 CAGTCCCATGATTCTGTGGGAGG - Intergenic
987431330 5:17837373-17837395 CAGTTTCAATTTTCTGTGTATGG + Intergenic
987514770 5:18891166-18891188 CAGTTTCAGTTTTCTGTATATGG - Intergenic
987817327 5:22919577-22919599 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
987833145 5:23124804-23124826 CAGTTTCAGTTTTCTGTATATGG + Intergenic
988357921 5:30200952-30200974 CTGTCTCAGGATTCCTTGGATGG - Intergenic
988738802 5:34049262-34049284 GAGACTCAGGCTTCTGAGGAGGG - Intronic
989511416 5:42292144-42292166 CAGTCACAGGTTGCTATTGAGGG - Intergenic
990668569 5:58101317-58101339 CAGTTTCAGGTTTCTGCATATGG + Intergenic
991224015 5:64248051-64248073 CAGTTTCAGTTTTCTGCGTATGG - Intronic
991530251 5:67606774-67606796 CAGGCTGAGGTTTCTCTGAAGGG + Intergenic
992028962 5:72701574-72701596 CAGTTTCAGCTTTCTATGTATGG + Intergenic
992254299 5:74906100-74906122 CAGTTTCAGGTTTCTGCATATGG + Intergenic
992358676 5:76012802-76012824 CAGTTTCAGTTTTCTGTATATGG + Intergenic
992422565 5:76621225-76621247 CAATCTCAGGTTTACGTGGAGGG - Intronic
993221264 5:85100420-85100442 CAGTTTCAGTTTTCTGTATATGG + Intergenic
993476801 5:88376470-88376492 CAGTTTCAGTTTTCTGCGTAAGG - Intergenic
994326140 5:98447948-98447970 CATTCTCTGGGCTCTGTGGAAGG + Intergenic
995112521 5:108443438-108443460 CAGTCTCAGCTTTCTGTATATGG - Intergenic
995263102 5:110128505-110128527 CAGTTTCAGTTTTCTGTGAATGG + Intergenic
995419711 5:111950340-111950362 CAGTTTCAGTTTTCTGTATATGG - Intronic
995778693 5:115753260-115753282 CAGTTTCAGTCTTCTGTGTATGG + Intergenic
996043887 5:118848819-118848841 CAGTTTCAGTTTTCTGTGTATGG - Intronic
996730739 5:126715221-126715243 CAGTCTCAGGAGTCTATGGGAGG + Intergenic
997859312 5:137401979-137402001 TAGTCTCATGTTTCTCTGTAAGG + Intronic
1000596106 5:163216910-163216932 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1000623909 5:163517076-163517098 CAGTCTCATCTTTCTTTGTATGG - Intronic
1001318134 5:170658877-170658899 CATTCTCAGGTTCCTGTTGGGGG + Intronic
1001345937 5:170898717-170898739 CAGTTTCAGTTTTCTGTATATGG + Intronic
1002181287 5:177432378-177432400 CAGTGTCAGGCTTCTGAGGGTGG + Intronic
1002858032 6:1055477-1055499 CAGTCTCAGGTGACCGTGCAGGG - Intergenic
1003249204 6:4410678-4410700 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1005963808 6:30712302-30712324 AAGCATCAGGTGTCTGTGGAGGG - Exonic
1006059797 6:31411577-31411599 CAGGCTCAGGATTCTGTCGGAGG - Intronic
1007188957 6:39997443-39997465 CAGCCTCAGGCTTCTCTGTATGG + Intergenic
1007820586 6:44557997-44558019 CAGCCACGGGTTTCTGAGGAAGG + Intergenic
1008407180 6:51131570-51131592 CAGTTTCAGTTTTCTGTGTATGG + Intergenic
1008577986 6:52879646-52879668 CATTCTCAGGGTGCTGGGGATGG + Intronic
1008911147 6:56734838-56734860 TGGCCTCAGGTTTATGTGGATGG - Intronic
1009385824 6:63083451-63083473 CTGTCCCAGGATTCCGTGGATGG + Intergenic
1010375358 6:75162453-75162475 CAGTTTCAGCTTTCTGTGTATGG - Intronic
1010537660 6:77050925-77050947 CAGTCTCAGTTTTCTGCATATGG - Intergenic
1010822239 6:80429069-80429091 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1011235910 6:85216741-85216763 CGGTTTCAGTTTTCTGTGTATGG - Intergenic
1011858485 6:91725185-91725207 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1012096231 6:94965740-94965762 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1012687262 6:102267532-102267554 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1013357226 6:109356737-109356759 CTGCCTCAGGTCTCTATGGAGGG + Intergenic
1013891253 6:115030557-115030579 CTGTCTCAGGTGGCAGTGGAGGG - Intergenic
1014113814 6:117650475-117650497 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1014180577 6:118379962-118379984 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1014338747 6:120175203-120175225 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1014427427 6:121325567-121325589 CAGTTTCAGCTTTCTGCGTATGG - Intronic
1014515928 6:122378424-122378446 CAGTTTCAGGTTTCTACGTATGG + Intergenic
1015369104 6:132430530-132430552 GAGACTCAGGTCTCAGTGGAAGG + Intergenic
1015694928 6:135969565-135969587 CAGTTTCAGTTTTCTGTATATGG - Intronic
1016691209 6:146940127-146940149 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1017968221 6:159285701-159285723 CAGTTTCAGTTTTCTTTGTATGG + Intergenic
1018251601 6:161877286-161877308 CAGCCTCAGGCTCCTGTGAAGGG + Intronic
1020390952 7:7657510-7657532 CAGTTTCAGTTTTCTGTATATGG + Intronic
1020575650 7:9923801-9923823 CAGTTTCAGGTTTCTGCATATGG + Intergenic
1020806450 7:12795698-12795720 CAGGGTCAGGTTTCTGCTGATGG - Intergenic
1020810422 7:12844472-12844494 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1020923823 7:14298499-14298521 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1021041188 7:15864407-15864429 CTGACTCAGGCTTCTCTGGAAGG - Intergenic
1021060238 7:16102250-16102272 CAGTTTCAGTTTTCTGTATATGG - Intronic
1021276143 7:18653917-18653939 CTCTCTTAGGTTACTGTGGATGG - Intronic
1021836083 7:24676573-24676595 CAGTTTCAGCTTTCTATGTATGG + Intronic
1022781984 7:33594986-33595008 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1023365086 7:39456123-39456145 CAATCTCAGGTTTCTATGGAGGG - Intronic
1024183676 7:46925326-46925348 CAGTCTCAGTTTTCTGCATACGG + Intergenic
1024675027 7:51630657-51630679 CTGTCCCCGGTTTCTGTGGCAGG + Intergenic
1025026070 7:55517393-55517415 CATCCACAGGTGTCTGTGGAGGG - Intronic
1025600747 7:62994404-62994426 CAGTTTCAGGTTTCTATATATGG + Intergenic
1025894026 7:65682240-65682262 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1026731599 7:72916367-72916389 CAGTTTCAGCTTTCTGTATATGG + Intronic
1026740424 7:72975552-72975574 AAGTCTCAGGACTCTGTGTAAGG - Intergenic
1026797726 7:73377037-73377059 AAGTCTCAGGACTCTGTGTAAGG - Intergenic
1026845537 7:73697080-73697102 CTGTCTCTGGTTTCTACGGATGG + Intronic
1027103307 7:75389518-75389540 AAGTCTCAGGACTCTGTGTAAGG + Intergenic
1027112444 7:75451463-75451485 CAGTTTCAGTTTTCTGTATATGG - Intronic
1027284689 7:76636069-76636091 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1027451920 7:78341753-78341775 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1028282196 7:88945286-88945308 CAGTTTCAGTTTTCTGTAGATGG + Intronic
1028945164 7:96571401-96571423 CAGTTTCAGTTTTCTGCAGACGG + Intronic
1028955192 7:96681582-96681604 CAGTTTCAGCTTTCTATGTATGG + Intronic
1029875490 7:103746210-103746232 CAGTTTCAGCTTTCTGTGTATGG - Intronic
1029883859 7:103846370-103846392 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1030789943 7:113712065-113712087 AAGTCTCATGTTTATTTGGAAGG - Intergenic
1031381464 7:121091217-121091239 CTGTATTAGGTTTCTATGGATGG - Intronic
1031805005 7:126297191-126297213 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1031818606 7:126471388-126471410 CAGTTTCAGCTTTCTATGTATGG + Intronic
1032074007 7:128827706-128827728 CAGGCTCAGGTTTCTGAGGACGG + Intergenic
1032312097 7:130797504-130797526 CAGTCTCAGTTTTCTGCATATGG + Intergenic
1032568085 7:132969244-132969266 AAGTGTCAGGTTTGTGGGGAAGG - Intronic
1032895544 7:136246768-136246790 CAGTGACAGGTTTCCATGGATGG - Intergenic
1033127385 7:138718005-138718027 CAGTCACAGATGTCTGCGGAGGG + Intronic
1033127399 7:138718055-138718077 CAGTCACGGGTGTCTGTGGAGGG + Intronic
1033127426 7:138718159-138718181 CAGTCACGGATGTCTGTGGAGGG + Intronic
1033127456 7:138718371-138718393 CAGTCACGGATGTCTGTGGAGGG + Intronic
1035372693 7:158389487-158389509 CAGACTCTGGTGTCTGTGCAAGG - Intronic
1035492132 7:159289454-159289476 CAGTCTCAGTTTTCTATATATGG - Intergenic
1036624044 8:10451123-10451145 CAGTTTCAGCTTTCTGCGTATGG + Intergenic
1037429165 8:18791522-18791544 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1037436996 8:18873252-18873274 CATTGTTGGGTTTCTGTGGAGGG + Intronic
1038242889 8:25826386-25826408 CAGTCTCAGTTTTCTGCATATGG + Intergenic
1038419451 8:27423030-27423052 CAGGCTCAGGGATCAGTGGAAGG + Intronic
1040321516 8:46310503-46310525 CAGTTTCAGCTTTCTATGTATGG + Intergenic
1040617354 8:49050408-49050430 CAGTTTCATTTTTCTGTGTATGG + Intergenic
1040657601 8:49529703-49529725 CAGTTTCAGCTTTCTATGTATGG + Intergenic
1040753331 8:50738856-50738878 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1040910302 8:52511404-52511426 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1041305704 8:56456305-56456327 GAGTCTAAAGTTTATGTGGATGG + Intergenic
1041608761 8:59818471-59818493 CAGTTTCAGCTTTCTGTATATGG - Intergenic
1041900188 8:62973862-62973884 CAGTTTCAGTTTTCTGCGTATGG + Intronic
1042116203 8:65434227-65434249 CAGTTTCAGCTTTCTGCAGATGG + Intergenic
1042196508 8:66235578-66235600 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1042253175 8:66776239-66776261 GAGACTGAAGTTTCTGTGGATGG - Intronic
1042265808 8:66908267-66908289 CAGTTTCTGTTTTCTGTGTATGG + Intronic
1042957712 8:74269709-74269731 GAGTCTCAGGTCTCTATAGAAGG - Intronic
1043271053 8:78334191-78334213 AAGGCTCTGGTTTCTGTTGAGGG + Intergenic
1044270275 8:90234359-90234381 CAGTCTCAGATTACTGTTGCTGG + Intergenic
1044473393 8:92598579-92598601 CAGTTTCAGGCTTCTGTATATGG - Intergenic
1044531915 8:93316822-93316844 CAGCCTCAGGATTCTGTGAAGGG + Intergenic
1045241544 8:100406735-100406757 CAGTTTCAGCTTTCTATGTATGG - Intronic
1045789910 8:105971132-105971154 CAGTTTCAGTCTTCTGTGTATGG - Intergenic
1045877967 8:107004667-107004689 CAGTTTCAGTTTTCTATGTATGG - Intergenic
1046159892 8:110347725-110347747 CAGACTCATGTTTCTCTGGAAGG + Intergenic
1046171612 8:110515470-110515492 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1046298741 8:112258074-112258096 CAGTTTCAGTTTTCTGCGTATGG - Intronic
1046329457 8:112696518-112696540 CAGTTTCAGCTTTCTATGTATGG - Intronic
1047474384 8:125212529-125212551 CAGGCTGAGGTTTGAGTGGAGGG + Intronic
1048550679 8:135431050-135431072 CAGTCTCAGGACAGTGTGGATGG - Intergenic
1049042413 8:140122724-140122746 CTGCCTCAGGTGTCTGAGGAGGG + Intronic
1049710956 8:144063088-144063110 CTGCCTCTGGTTGCTGTGGAGGG - Intronic
1049965046 9:771655-771677 CAGTTTCAGTTTTCTGTGTATGG - Intergenic
1050225627 9:3451691-3451713 CACTATCAGGTTACTCTGGAAGG - Intronic
1050699737 9:8325289-8325311 CAGTCTCAGTTTTCTGCATATGG + Intronic
1050700787 9:8336394-8336416 CAGTCTCAGTTTTCTGCATATGG - Intronic
1050947458 9:11544167-11544189 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1051045304 9:12866011-12866033 CAGTTTCAGTTTTCTGCAGATGG + Intergenic
1051373421 9:16378950-16378972 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1052270339 9:26621866-26621888 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1052753202 9:32513521-32513543 CAGTTTCAGTTTTCTGTATATGG - Intronic
1053571187 9:39309563-39309585 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1053676675 9:40437653-40437675 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1053837077 9:42150176-42150198 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1053926441 9:43063746-43063768 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1054092753 9:60868266-60868288 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1054114224 9:61144172-61144194 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1054125958 9:61309449-61309471 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1054287044 9:63187257-63187279 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1054289743 9:63273177-63273199 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1054318783 9:63631111-63631133 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1054387774 9:64577717-64577739 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1054507947 9:65938651-65938673 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1054593528 9:67038340-67038362 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1055044064 9:71907178-71907200 CTATGTCAGGTTTCTGTTGATGG - Intronic
1055342904 9:75304184-75304206 CAGTTTCAGGGTTCTGTATATGG + Intergenic
1056124183 9:83518935-83518957 CAGTTTCAGGTTTCTGCATATGG - Intronic
1057354964 9:94325260-94325282 CAGTGTCAGGACTCTGGGGAAGG + Exonic
1057652788 9:96932374-96932396 CAGTGTCAGGACTCTGGGGAAGG - Exonic
1058353747 9:104058134-104058156 CAGTTTCAGCTTTCTGCGTATGG - Intergenic
1058548528 9:106087497-106087519 CAGTCTCAGTTTTCTGCATATGG + Intergenic
1058549298 9:106096678-106096700 CAGTTTCAGTTTTCTGCAGAAGG - Intergenic
1058865734 9:109160680-109160702 CAGGCTCTGGTTTCTGAGGTAGG - Intronic
1059965247 9:119607491-119607513 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1061228583 9:129297298-129297320 CAGTTTCAGTTTTCTGCGTATGG + Intergenic
1203574419 Un_KI270744v1:163467-163489 CAGTTTCAGCTTTCTATGTATGG + Intergenic
1185803334 X:3033172-3033194 CATTGTCAGGGTTCAGTGGAAGG - Exonic
1185819863 X:3192024-3192046 CAGTCTCAGATTTCAGGGAATGG + Intergenic
1186259052 X:7756377-7756399 CAGTTTCAGCTTTCTGCAGATGG - Intergenic
1187794382 X:22986215-22986237 CACTCTTGGGTATCTGTGGAAGG - Intergenic
1188202144 X:27304457-27304479 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1188560772 X:31466364-31466386 CAGTTTCAGTTTTCTGTAGATGG + Intronic
1189538104 X:41957355-41957377 CAGTCTCAAGTGCCTGTGAAGGG - Intergenic
1190172290 X:48121387-48121409 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1190180215 X:48185387-48185409 CAGTCTCATGCTTCTGTCCAGGG + Intergenic
1190183904 X:48218682-48218704 CAGTCTCATGCTTCTGTCAAGGG - Intronic
1190189829 X:48268134-48268156 CAGTCTCATGCTTCTGTCCAGGG - Intronic
1190199202 X:48345590-48345612 CAGTCTCATGCTTCTGTCCAGGG + Intergenic
1190204763 X:48394157-48394179 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1190205773 X:48401246-48401268 CAGTCTCATGCTTCTGTCCAGGG + Intergenic
1190210603 X:48443785-48443807 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1190658579 X:52634634-52634656 CAGTCTCATGCTTCTGTCCAGGG - Intergenic
1191005539 X:55707373-55707395 CAGTTTCAGTTTTCTGCGTATGG - Intergenic
1191872509 X:65760632-65760654 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1191888348 X:65913548-65913570 CAGTTTCAGTTTTCTGTGAATGG + Intergenic
1192887394 X:75349647-75349669 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1192964636 X:76164253-76164275 CAGTTTCAGCTTTCTGCGTATGG - Intergenic
1193030317 X:76891106-76891128 CAGTTTCAGTTTTCTATGTATGG - Intergenic
1193249946 X:79279152-79279174 CAGTCTCAGTTTTCTGCATATGG - Intergenic
1193264658 X:79454102-79454124 CAGTTTCAGCTTTCTGTATAGGG + Intergenic
1193353659 X:80490868-80490890 CAGGTTCAGCTTTCTGTGTATGG + Intergenic
1193493889 X:82186965-82186987 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1193623615 X:83789009-83789031 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1193793675 X:85847071-85847093 CAGTTTCAGTTTTTTGTGTATGG - Intergenic
1193991476 X:88313280-88313302 CAGTTTCAGTTTTCTGGGTATGG - Intergenic
1194085061 X:89516262-89516284 CAGGATCAGTTTTCTGTGAAAGG - Intergenic
1194563288 X:95449106-95449128 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1194662286 X:96640407-96640429 GAGTCTTAGGTTTCTGTCTAGGG - Intergenic
1194909519 X:99623592-99623614 CAATCTCAGGTTTCAATGAAAGG + Intergenic
1195124791 X:101797229-101797251 CAGTTTCAGTCTTCTGTGTATGG - Intergenic
1195179950 X:102348398-102348420 CAGTTTCAGTCTTCTGTGTATGG + Intergenic
1195247532 X:103008339-103008361 CAGTTTAAGGTTTCTCTGGCAGG - Intergenic
1195414675 X:104607182-104607204 CAGTTTCAGTTTTCTGTGTCTGG - Intronic
1195978197 X:110550588-110550610 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1196606831 X:117666721-117666743 CAGTCTCAGTTTTCTGCATATGG + Intergenic
1197302535 X:124798886-124798908 CAGTTTCAGTTTTCTGTGTATGG + Intronic
1197711364 X:129671952-129671974 CAGTTTCAGCTTTCTATGCATGG + Intergenic
1198671065 X:139081468-139081490 CAGTCTCATATCTCTATGGATGG + Intronic
1199186962 X:144926459-144926481 CAGTTTCAGTTTTCTGTATATGG - Intergenic
1199398356 X:147367224-147367246 AACTCTAAGCTTTCTGTGGACGG - Intergenic
1199567753 X:149233584-149233606 CAGTTTCAGTTTTCTGCAGATGG - Intergenic
1200437710 Y:3172146-3172168 CAGGATCAGTTTTCTGTGAAAGG - Intergenic
1200889383 Y:8306891-8306913 CAGTTTCAGCTTTCTATGTATGG + Intergenic
1200895115 Y:8367546-8367568 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1200955812 Y:8944239-8944261 CAGTTTCAGTTTTCTATGTATGG + Intergenic
1201259393 Y:12143668-12143690 CAGTCTCAGATTTCAGGGAATGG - Intergenic
1201464769 Y:14268463-14268485 CAGTTTCAGCTTTCTGTATATGG + Intergenic
1201537786 Y:15069440-15069462 CAGTCTCAGTTTTCTGAATATGG - Intergenic
1201606121 Y:15787386-15787408 CAGTGTCAGCTTTCTATGTATGG + Intergenic
1201609107 Y:15821065-15821087 CAGTTTCTGATTTCTGTGTATGG - Intergenic
1201704333 Y:16918979-16919001 CAGTTTCAGTTTTCTGTATATGG + Intergenic
1201716737 Y:17052784-17052806 CAGACTCAAGTTTCTGTGATAGG - Intergenic
1201887251 Y:18898708-18898730 CAGTTTCAGCTTTCTATGTATGG - Intergenic
1201915970 Y:19181478-19181500 CAGTATCAGGGTCCTGTGGTGGG + Intergenic
1202173499 Y:22075954-22075976 CAGTTTCAGGTTTCTGCATATGG + Intronic
1202177898 Y:22114416-22114438 CATTTTCAGGTTTCTCTGGAGGG + Intergenic
1202213463 Y:22471979-22472001 CATTTTCAGGTTTCTCTGGAGGG - Intergenic
1202217861 Y:22510429-22510451 CAGTTTCAGGTTTCTGCATATGG - Intronic
1202325324 Y:23685630-23685652 CAGTTTCAGGTTTCTGCATATGG + Intergenic
1202545447 Y:25984424-25984446 CAGTTTCAGGTTTCTGCATATGG - Intergenic