ID: 975637775

View in Genome Browser
Species Human (GRCh38)
Location 4:76467444-76467466
Sequence ACTTAAAGTCAGACAGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975637775_975637781 25 Left 975637775 4:76467444-76467466 CCCAGTCCTGTCTGACTTTAAGT 0: 1
1: 1
2: 1
3: 12
4: 265
Right 975637781 4:76467492-76467514 TGTGAAGGCTAAGCAAATACTGG 0: 1
1: 0
2: 0
3: 9
4: 121
975637775_975637780 10 Left 975637775 4:76467444-76467466 CCCAGTCCTGTCTGACTTTAAGT 0: 1
1: 1
2: 1
3: 12
4: 265
Right 975637780 4:76467477-76467499 GAATGATTTTGGAACTGTGAAGG 0: 1
1: 0
2: 0
3: 25
4: 344
975637775_975637779 -1 Left 975637775 4:76467444-76467466 CCCAGTCCTGTCTGACTTTAAGT 0: 1
1: 1
2: 1
3: 12
4: 265
Right 975637779 4:76467466-76467488 TTGTGGATAAAGAATGATTTTGG 0: 1
1: 0
2: 2
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975637775 Original CRISPR ACTTAAAGTCAGACAGGACT GGG (reversed) Intronic
900730031 1:4251923-4251945 ACTTAAACTCACACAAAACTGGG - Intergenic
901456382 1:9365271-9365293 AATAAAAATCAGCCAGGACTTGG - Intronic
901735902 1:11312043-11312065 TTTTGAGGTCAGACAGGACTGGG - Intergenic
902235996 1:15057814-15057836 ATTTGAAGGCAGACAGGGCTTGG + Intronic
902670122 1:17967428-17967450 ACTAAGAGTGAGACAGGTCTGGG - Intergenic
903060602 1:20666129-20666151 TTTTGAAGTCAGACAGGCCTGGG - Intronic
903267443 1:22166381-22166403 TTTTAAAGACAGACAGGCCTGGG - Intergenic
903377240 1:22874539-22874561 CCTTACAGTCAGACAGACCTGGG + Intronic
903770089 1:25758362-25758384 ATTCCAAGTCAGACAGGCCTGGG + Intronic
904002642 1:27347672-27347694 ACTGAAAGACACACAGTACTGGG - Intronic
904423679 1:30409986-30410008 CCTTATAGTCAGAGAGGTCTGGG + Intergenic
905538694 1:38743408-38743430 ATTTGAAGTCAGACAGCTCTGGG - Intergenic
905581186 1:39083443-39083465 ACTTGAAGTAAGACAGACCTGGG - Intronic
905586719 1:39125654-39125676 ATTTAAAAACAGACAGGACCTGG - Intronic
907246867 1:53114324-53114346 CCTTGGAGTCAGACAGGACTAGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
911193361 1:94969671-94969693 ATCCAAAGTCAGGCAGGACTAGG + Intergenic
912569758 1:110612884-110612906 ACTTGAAGTCAGACAGGCCTGGG + Intronic
912656437 1:111490116-111490138 ACTGAAGGTCAGACAGAGCTGGG + Intronic
914600883 1:149204369-149204391 ACCTAAAGCCAGACAGAATTAGG + Intergenic
916781210 1:168031841-168031863 ACTGAAAGTGAGATAGGAATAGG + Intronic
917388888 1:174510447-174510469 ACCCAAAGTCAGAAAGGAATAGG - Intronic
917775388 1:178328774-178328796 ATTTAAAGTCATACAGACCTGGG - Intronic
918533638 1:185550653-185550675 TCTTAAATACAGATAGGACTTGG + Intergenic
920272756 1:204778668-204778690 ATTTAAAATCAGCCAGGGCTGGG + Intergenic
921965857 1:221088325-221088347 CTTTAGAGTCAGACAGTACTAGG + Intergenic
922018688 1:221680961-221680983 TCTGAAAGTCTGAAAGGACTAGG - Intergenic
922349801 1:224725897-224725919 AGTAAAAATAAGACAGGACTTGG + Intronic
922657395 1:227397758-227397780 ACTTATTGTAAGACAGGCCTTGG - Intergenic
922944258 1:229497516-229497538 CTTTAAATTCAGACAGGCCTGGG + Intronic
924427810 1:243969816-243969838 ACTTAAATTGAGATAAGACTGGG - Intergenic
1063454995 10:6176753-6176775 AGTTAGAGACAGCCAGGACTAGG - Intronic
1063815693 10:9768686-9768708 ATTTGAAGTCAGCCAGGCCTGGG + Intergenic
1063847499 10:10147235-10147257 CCTTGAAGTCAGCCAGTACTTGG + Intergenic
1064604005 10:17019390-17019412 AATGAAAGTCAGACAGGGATGGG - Intronic
1064811472 10:19204373-19204395 ACTTTCAGCCAGACAGGACCTGG + Exonic
1064815346 10:19255061-19255083 ACGTAAAGACAGACTGGCCTTGG - Intronic
1065491684 10:26288677-26288699 ACTTGAAGTAAGAGAGAACTTGG - Intronic
1066729830 10:38427383-38427405 AATTAAAGTAAGACAGGCATAGG + Intergenic
1067271079 10:44791688-44791710 TCTCAAAGTCAGTCAGGACCAGG - Intergenic
1068611598 10:59066347-59066369 ACTTACAGTTCCACAGGACTGGG - Intergenic
1068636629 10:59355307-59355329 CTTTAAAGTCAGAGAGGCCTGGG + Intronic
1069892856 10:71662722-71662744 GCTCACAGTCAGAAAGGACTTGG - Intronic
1071329518 10:84545979-84546001 TCTTATAGTCAGACTGAACTTGG - Intergenic
1071519041 10:86317670-86317692 TCTTTAAGTCAGTCAGGAATGGG - Intronic
1071890552 10:90001738-90001760 ACTTAAAAGCAGAAAGGACCAGG - Intergenic
1072484301 10:95840227-95840249 ACTTGAAGTCGGGCAGAACTTGG - Intronic
1074166911 10:110888406-110888428 ACTTAATGACAGACAATACTCGG + Intronic
1074671973 10:115801218-115801240 ATTTAAAGTCAGACGAGACAGGG - Intronic
1075246405 10:120825865-120825887 ATTTAGAGTCAGACAGGTTTAGG + Intergenic
1078128430 11:8592069-8592091 ACTTTGAGTCAAACAGGGCTTGG - Intronic
1078140282 11:8687527-8687549 ACTAAAAGTCACACAGGTATTGG - Exonic
1078222336 11:9362369-9362391 ACTTACAGGCAGAGAGGACAGGG - Intergenic
1079475470 11:20825065-20825087 ACATAAAGTCTGCCAAGACTTGG - Intronic
1079612233 11:22447504-22447526 ACTTAAAGTTCCACATGACTGGG + Intergenic
1079759996 11:24317562-24317584 ACTTATTGTGAGACAGGTCTGGG + Intergenic
1082002036 11:47398559-47398581 ACTTGGAGTTAGACAGGATTGGG - Intergenic
1082139011 11:48585105-48585127 ACTTACAGTTCGACAGGGCTGGG + Intergenic
1088735963 11:112727873-112727895 CCTTAGAGTCAGACAGAGCTGGG + Intergenic
1089218116 11:116848017-116848039 ACTTAAAGTGTGACTGGGCTGGG + Intronic
1089744044 11:120604515-120604537 AGTTAAAGTCAGATAGGAGAGGG + Intronic
1090458203 11:126867536-126867558 ACTTCAAGTCAGCAATGACTGGG + Intronic
1090539410 11:127684277-127684299 ATGTAAAGTAAGACTGGACTGGG - Intergenic
1090996922 11:131875035-131875057 ACTTAAGCTGAGACAGAACTGGG + Intronic
1091894668 12:4091597-4091619 ATTTAAAGTGACATAGGACTGGG + Intergenic
1093723830 12:22479524-22479546 ACTGAAATTCAGAAAGGACAGGG + Intronic
1094009723 12:25794579-25794601 ATTTCGAGTCAGACAGAACTAGG + Intergenic
1094597579 12:31879217-31879239 ACTTAAAGTCAGGCCGGGCGTGG + Intergenic
1095513073 12:42975006-42975028 ACTTAAAGTAAGAAAGCACAGGG + Intergenic
1096834937 12:54344117-54344139 ACTTTAAGTCAGACAGATATGGG - Intronic
1097064391 12:56310081-56310103 ACATAAAGTAAGACAGGGCTTGG - Intronic
1097221418 12:57453353-57453375 ATTTAAAGCCAGTGAGGACTGGG + Intronic
1097302091 12:58029721-58029743 CCTTACAGTCAGACACGTCTGGG - Intergenic
1098377974 12:69837641-69837663 ACTGCAAGTCAGGCAGGCCTGGG - Intronic
1100434292 12:94558005-94558027 ACCTAAAGTCAGCCTGGGCTGGG + Intergenic
1101004520 12:100388888-100388910 ACTATAAGTCAAACAGGACATGG + Intronic
1101460713 12:104890454-104890476 ATGTCAAGCCAGACAGGACTTGG - Intronic
1101744746 12:107531013-107531035 CCTTAGAGTCAGACAGACCTAGG + Intronic
1101825481 12:108217196-108217218 GCTTTAAGTCAGACAGACCTGGG - Intronic
1104118199 12:125771248-125771270 ATTTAGAGTCAGAGAGGAATGGG - Intergenic
1107667969 13:42712495-42712517 ACTTACAGTTCCACAGGACTGGG + Intergenic
1109550730 13:63895833-63895855 ATTTAAAGTTAGATAGGAATAGG + Intergenic
1111347831 13:86984724-86984746 ACTTCAAATTAGACAGGAATGGG + Intergenic
1111373885 13:87353182-87353204 ATTTAAAGGCAAACAGGAATTGG + Intergenic
1112246447 13:97738870-97738892 ATTGAAAGCCAGACAGGACTTGG + Intergenic
1115449419 14:33528988-33529010 ATTTGAAGTCAGACAGCTCTGGG - Intronic
1116129673 14:40838863-40838885 TCCCAAAGTCAGAAAGGACTTGG + Intergenic
1116371217 14:44135645-44135667 ACATAAAGACAGAAAGCACTTGG + Intergenic
1116701448 14:48248413-48248435 ACTGGATGACAGACAGGACTTGG - Intergenic
1117653630 14:57931946-57931968 ACTTAAAGCAATACAGGAATAGG + Intronic
1117674121 14:58138757-58138779 ACTGAAAGTCAGGAAGGAGTTGG - Exonic
1118798906 14:69171316-69171338 AATTGAAGTCAGAGAGGCCTGGG + Intergenic
1119086640 14:71745300-71745322 ACTTAAAGAAAGACAAGACCTGG + Intergenic
1119323092 14:73743083-73743105 TCTTAGAGTCAGACAGATCTGGG - Intronic
1119653925 14:76403282-76403304 TTCTAGAGTCAGACAGGACTAGG - Intronic
1120102495 14:80461401-80461423 GCTTAAAGTCAGAAAGCACCGGG + Intergenic
1121841064 14:97134247-97134269 ACTAAATGTCAGACAGAAGTGGG - Intergenic
1121926912 14:97935262-97935284 ACTTATAGTCAGACAAGCCTGGG + Intronic
1122812860 14:104297595-104297617 TCTTCAAGGCAGACAGGACCTGG - Intergenic
1123970941 15:25507392-25507414 ACTTAAAGTCAGGCAGATCCTGG + Intergenic
1127076012 15:55326327-55326349 AATTAAAGTCAGGCAGACCTGGG + Intronic
1129194602 15:73956369-73956391 TCTAAAAGTGAGACAGGACATGG - Intergenic
1129588581 15:76893953-76893975 ACATAAAGACAGACAGGGCCAGG + Intronic
1129663531 15:77566619-77566641 TCCTAAAGGCAGACAGGACTTGG + Intergenic
1130024248 15:80257586-80257608 ACTTGGAGTCAGACAGGTCTGGG + Intergenic
1130571190 15:85045411-85045433 AATTAAATTCAGACAGAACTGGG + Intronic
1131465899 15:92654878-92654900 GATTAAAGTTAGACAGGCCTGGG + Intronic
1131557635 15:93413538-93413560 ACTTAAAGACAGAAAGGAAAGGG - Intergenic
1134264527 16:12681832-12681854 ACTTAGAATCAGAAAGGACATGG + Intronic
1134809328 16:17153947-17153969 CCTTAAAGTCAGACGGAACCAGG + Intronic
1135154127 16:20037718-20037740 ACAGAAAGTCAGACAGAGCTGGG - Intronic
1135615982 16:23911525-23911547 ACTTAAAGTCACTCAGGAAATGG - Intronic
1139140463 16:64255917-64255939 ATTTAATATCAGTCAGGACTTGG - Intergenic
1140953930 16:79845136-79845158 ACTCAAAGACAGAAATGACTGGG - Intergenic
1146642469 17:34551532-34551554 ACTTACAATCTGACAGGCCTGGG + Intergenic
1147512275 17:41081307-41081329 ACTTGAGGTCAGAAAGGGCTTGG + Intergenic
1147788098 17:42994804-42994826 ACTTAGGGTGAGACAGGACAAGG + Intergenic
1147925633 17:43943765-43943787 GCTTAGAGTCAGACAGACCTGGG + Intergenic
1148749255 17:49935300-49935322 CCTTCAAGTCAGAAAGGACAGGG + Intergenic
1149813861 17:59704448-59704470 GTTTAAAGTCAGAAAGGTCTGGG + Intronic
1149927134 17:60712548-60712570 ATTTGAATTCAGACAGAACTAGG - Intronic
1150832674 17:68538134-68538156 ACTTAAAGGCTGGCAGTACTGGG - Intronic
1153052525 18:913471-913493 ACTTGAAGTCAGCCAAGTCTGGG - Intergenic
1154093740 18:11390174-11390196 TCTTCAAGTCAGAGAGAACTTGG - Intergenic
1155069033 18:22296916-22296938 AGTTACAATCAGATAGGACTTGG - Intergenic
1157136432 18:45061344-45061366 ACATAAAGACAGACAGGCATTGG + Intronic
1160029032 18:75242739-75242761 ACTTAAAGTGAGAGAGGGTTGGG + Intronic
1160064178 18:75559784-75559806 CCTTTAAGTCAGACAAAACTAGG - Intergenic
1160424635 18:78771561-78771583 ACCTGAACTCAGACAGGGCTGGG + Intergenic
1165223071 19:34333334-34333356 ACTGAAAGTCAAACCAGACTGGG - Intronic
1165721899 19:38085033-38085055 ACTTGGAGTCAGACAGCCCTCGG + Intronic
925624592 2:5829978-5830000 ACTTAAGGTAAGATGGGACTTGG + Intergenic
925746474 2:7048094-7048116 GCTTGAAAACAGACAGGACTGGG - Intronic
926780232 2:16463903-16463925 ACTTTGAGTCAGACAGACCTAGG + Intergenic
928812353 2:35244450-35244472 ATTTGAAGTCAGACATAACTGGG + Intergenic
930572877 2:53109118-53109140 ACTTAAAGCTAGAAAGGAGTGGG + Intergenic
934580232 2:95431942-95431964 ACTCAAAGTCAGAGAGACCTGGG - Intergenic
934599214 2:95644772-95644794 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
936532566 2:113286770-113286792 ACTCAAAGTCAGAGAGACCTGGG + Intergenic
939115219 2:138052992-138053014 ACTGAAAGTCAGATACGACAAGG - Intergenic
943424700 2:187716336-187716358 ATTTGAAATCAGTCAGGACTGGG - Intergenic
943767128 2:191675291-191675313 ATTTAAAATCAAACAGTACTTGG + Intergenic
947851127 2:233289023-233289045 ATTTAAAGTCAGACTAGACAAGG - Intronic
948087561 2:235264317-235264339 CTTTGGAGTCAGACAGGACTGGG - Intergenic
1173931833 20:46827302-46827324 CTTTAAAGTCAGAGAGGCCTGGG - Intergenic
1174124657 20:48294994-48295016 ACTTGACTTCAGACAGGACCCGG + Intergenic
1175136481 20:56828150-56828172 ACTTATAGTAAGACAGGATTTGG + Intergenic
1176272984 20:64246183-64246205 ACTCAGAGTCACACAGGGCTTGG + Intergenic
1176302024 21:5102972-5102994 CCTTAGAGACAGACAGGCCTGGG + Intergenic
1177226288 21:18261001-18261023 GCTTGAAGTCAAACAGGAGTGGG + Intronic
1178145311 21:29732828-29732850 GCTTACAGTCACACAGAACTAGG - Intronic
1178704589 21:34862711-34862733 AGATAAAGTCATACTGGACTTGG - Intronic
1178964399 21:37102631-37102653 ACCCACAGTCAGACAGAACTGGG + Intronic
1179855005 21:44158928-44158950 CCTTAGAGACAGACAGGCCTGGG - Intergenic
1181118449 22:20649292-20649314 ACCTAAAGATAGACAGAACTCGG - Intergenic
1183515351 22:38262382-38262404 CTTGAAAGTCAGACAGGACCTGG + Intronic
1184109838 22:42388170-42388192 CTTTAAAGTCAGACAAGAGTAGG + Intronic
1184818492 22:46890691-46890713 ACTTGAAGTCAGAAAGGGCCAGG - Intronic
1184827115 22:46959782-46959804 ACTTACTGTCAGCCTGGACTTGG + Intronic
1185133535 22:49055443-49055465 ACGTAAAGTGAGACAGGGCCAGG + Intergenic
950312750 3:11973537-11973559 ACTTAAAGCCAGACAGGACTGGG - Intergenic
950334647 3:12183711-12183733 AGATAAAGTCACACTGGACTTGG - Intronic
950816859 3:15713295-15713317 ACTCAAAGTGAGAAAGAACTGGG + Intronic
952746738 3:36788571-36788593 ATTTGGAGTCAGACAGGCCTGGG + Intergenic
953128036 3:40110499-40110521 ACTTAAAGTTGGAGAGGAATGGG + Intronic
953658400 3:44872095-44872117 ACTTTGGGTCAGACAGAACTGGG - Intronic
956208433 3:66778214-66778236 ACCTAAGGCCAGATAGGACTTGG + Intergenic
959145958 3:102544782-102544804 ACATTAAGTCAGACAGGGCACGG - Intergenic
959515756 3:107264974-107264996 ACTGGAATTCAGACAGGTCTGGG - Intergenic
961518680 3:127454746-127454768 GCTGAGAGTCAGACAGGGCTTGG + Intergenic
961836530 3:129665726-129665748 ATTTGAAGTCAGACAAAACTGGG + Intronic
961890897 3:130129574-130129596 ACCTATGGTCAGACAGGGCTAGG + Intergenic
965927304 3:173997513-173997535 GCTTTAATTCAAACAGGACTAGG - Intronic
966212256 3:177465522-177465544 ACTTAAGGTCACACAGCTCTAGG + Intergenic
966540912 3:181088659-181088681 ATTTTAGGTCAGACAGGACATGG + Intergenic
970526122 4:16933945-16933967 AGTTAAAATCAGACTGGAGTAGG - Intergenic
970730679 4:19100029-19100051 ACTTAAAGTTCAACATGACTGGG - Intergenic
971224662 4:24740201-24740223 ACTTCAAGTGATACAGGACAGGG + Intergenic
971554318 4:27993945-27993967 AATTAAGGTCAGGCAGGAATGGG + Intergenic
972447911 4:39164345-39164367 ACTTACAGTCCCACAGGGCTGGG - Intergenic
972840975 4:42929650-42929672 ACTTAAAGTCACACAAGTGTAGG + Intronic
972905243 4:43737679-43737701 ACCTAATGTCACACAGTACTTGG - Intergenic
973321242 4:48812408-48812430 ACTTTGACTCAGACAGGCCTTGG - Intronic
973338221 4:48977494-48977516 ATGTAAACTCAGACAGCACTGGG + Intergenic
974446933 4:61996415-61996437 AATTAAAGACAGTCAGTACTGGG - Intronic
975198541 4:71556120-71556142 TTTTAAAGTCAGATAGAACTGGG + Intronic
975637775 4:76467444-76467466 ACTTAAAGTCAGACAGGACTGGG - Intronic
977845157 4:101759368-101759390 ACTCACATACAGACAGGACTTGG - Intronic
978581502 4:110236131-110236153 GCTTAAGGTCAGAGAGGGCTGGG - Intergenic
979126472 4:116979448-116979470 CCTTAATTTCAGACAGGAATGGG - Intergenic
981101459 4:140833809-140833831 GCTTTATGTCAGCCAGGACTAGG - Intergenic
981336255 4:143572033-143572055 ACTTACAGTCTTACAGTACTTGG + Intergenic
981790107 4:148526788-148526810 GCATAAAGTCAAACAGGCCTCGG - Intergenic
984958307 4:185068340-185068362 ACTTAAAGTTAGACACCTCTGGG - Intergenic
985071553 4:186170758-186170780 ACTGAAGGTCAGACAGTGCTGGG - Intronic
985156160 4:186988992-186989014 ACTTATAGTTACACAGGGCTGGG + Intergenic
986069519 5:4268567-4268589 ACTCACAGTCACACATGACTGGG + Intergenic
987178299 5:15339421-15339443 ACTTGAAGTCAGATACCACTGGG - Intergenic
990009871 5:50984156-50984178 ACTTGAAGTCAGCAAGCACTTGG + Intergenic
990099965 5:52170245-52170267 ATTTAAAGCCATACAGGAGTAGG - Intergenic
990396763 5:55390031-55390053 ACTCAAAGTCAGACAGGGCAAGG - Intronic
994042293 5:95272904-95272926 ATACAAGGTCAGACAGGACTGGG + Intronic
994241686 5:97429803-97429825 CCTAAGAGTCAGACAGAACTGGG - Intergenic
995210263 5:109529919-109529941 AGTTAAAGTCAGACATGCCGTGG - Intergenic
995462071 5:112414052-112414074 ACTGAAACTCAGAAACGACTCGG + Intronic
996390092 5:122950975-122950997 ATTTAAAGTCAGGCCGGGCTTGG + Intronic
997743785 5:136280584-136280606 ACTAAAAGGCAGACAGGAAGAGG + Intronic
997967119 5:138366711-138366733 ACATAAACTCAGATAGGTCTAGG + Intronic
998319083 5:141211852-141211874 ACTTAGAGTCAGGCAGATCTAGG - Exonic
999368806 5:151040368-151040390 ACTAAAGGTCACACAGGGCTGGG - Intronic
1000557032 5:162738921-162738943 CCTTAGAGTCAAACAGCACTGGG - Intergenic
1004592893 6:17070563-17070585 GCTCATAGTCAGAAAGGACTTGG + Intergenic
1005395123 6:25374285-25374307 CCTAAAAGTCATACAGGAGTAGG + Intronic
1006380242 6:33693061-33693083 ACTTGGAGTCAGAAAGGAGTGGG + Intronic
1006931216 6:37689681-37689703 ACTGGAAGTCAGACAGGTTTGGG - Intronic
1009944459 6:70326498-70326520 CTTTGAAGTCAGACAGAACTAGG - Intergenic
1010008466 6:71022950-71022972 ACTGAAAGTCAAACATGTCTTGG + Intergenic
1010249817 6:73696044-73696066 ATCTAAATTGAGACAGGACTTGG - Intronic
1012417855 6:99029005-99029027 CCTTGGAGTCAGACAGAACTGGG - Intergenic
1013404760 6:109832725-109832747 ACTTACAGTTAGACATGGCTGGG - Intergenic
1013448661 6:110257095-110257117 ACATAAATTCTGACAGGACTTGG + Intronic
1013647415 6:112159283-112159305 AGTAGAAATCAGACAGGACTAGG - Intronic
1013979176 6:116109570-116109592 ACTAAAGGTTAGCCAGGACTTGG - Intronic
1014287468 6:119516791-119516813 ACTTAAGTACAGACAAGACTGGG + Intergenic
1014955491 6:127610288-127610310 ACTTAAAGACAAACATGACTTGG + Intergenic
1015102591 6:129499084-129499106 AGTTGTAGGCAGACAGGACTTGG - Intronic
1015161693 6:130159327-130159349 ACTTACAGTTACACATGACTGGG - Intronic
1016858128 6:148692640-148692662 ACTTAAAGGCAGTCATCACTGGG + Intergenic
1016992522 6:149940046-149940068 ACCTAAAGTCAGAATGGACCAGG + Intergenic
1016999366 6:149985442-149985464 ACCTAAAGTCAAACTGGACCAGG + Intergenic
1017502480 6:155038359-155038381 ACTGAAATGCAGGCAGGACTGGG - Intronic
1017963228 6:159240199-159240221 ACTTAAAGTCAGATTTAACTGGG + Intronic
1018384018 6:163286514-163286536 ACTTTAAGTCAGTCAAGAATTGG + Intronic
1020754000 7:12178302-12178324 ACTGAAATTCAGCCAGAACTTGG + Intergenic
1023547686 7:41336047-41336069 TTTTGAAGTCAGCCAGGACTTGG - Intergenic
1027601522 7:80246323-80246345 CCTTAATCTCAGACAGGACCAGG + Intergenic
1028387443 7:90273140-90273162 ACTGAATGACAAACAGGACTTGG + Intronic
1028430230 7:90737718-90737740 ATTTAAAGTCAAACCTGACTGGG - Intronic
1028791776 7:94861623-94861645 ACTTAAAATCTGACAGGCATGGG + Intergenic
1031023194 7:116650567-116650589 AATTAAAGTCATACAGGAGTAGG - Intergenic
1033662713 7:143413500-143413522 ACTGGGAGTCAGACAGAACTAGG - Intergenic
1035890353 8:3336413-3336435 ACTTAAATTCATATAGCACTTGG + Intronic
1036589631 8:10157092-10157114 AATTAGAGTCAGAAAGAACTGGG - Intronic
1036915982 8:12804103-12804125 CTTCAAAGTCAGACAGGTCTAGG - Intergenic
1037751714 8:21686632-21686654 ACTGAAACTCAGACTGGACGTGG + Intergenic
1039200029 8:35081180-35081202 ACTGAAAGTCAGGTAGCACTAGG + Intergenic
1039339090 8:36627154-36627176 ACTTGAAGTCAGGAAGGAGTTGG - Intergenic
1039575199 8:38617809-38617831 AGATAAAGTCATACAGGAGTAGG - Intergenic
1039780101 8:40776703-40776725 TATTAAAGTCAGAGAAGACTGGG + Intronic
1040034506 8:42856776-42856798 CTTTAAAGTCAGACAGATCTGGG + Intronic
1041133883 8:54735280-54735302 TCTTAGAGTCAGAGAGCACTGGG + Intergenic
1041595881 8:59651471-59651493 GCTTAAAGTAAGAAAGGACATGG + Intergenic
1042704020 8:71647758-71647780 AGTAAAAATCAGACAGGAATTGG - Intergenic
1042737822 8:72008651-72008673 GCTAAAAGACAGAGAGGACTTGG - Intronic
1043173216 8:76991690-76991712 ATTTAAAATCAAACAGGCCTGGG + Intronic
1044845019 8:96372012-96372034 CCTCAAAGGCAGACAGGGCTGGG - Intergenic
1044858403 8:96498130-96498152 ACTTAGAGGCAGACTGGACGTGG - Intronic
1044877092 8:96680531-96680553 ACTTACAGTTACACAGGGCTGGG - Intronic
1045723352 8:105140253-105140275 ACCTAATGCCAGACAGCACTTGG - Intronic
1047115464 8:121837018-121837040 ACTTACAGTCCCACATGACTGGG - Intergenic
1047181689 8:122594606-122594628 ACTGAGAGTCAGGCAGGCCTGGG - Intergenic
1047556052 8:125931561-125931583 AGATGAAGTCAGAGAGGACTTGG + Intergenic
1047574372 8:126136721-126136743 TCTTTAAGTCATGCAGGACTTGG - Intergenic
1047636147 8:126764590-126764612 GCTCAAAGGCAGACAGGCCTGGG + Intergenic
1047657543 8:126994649-126994671 ACTAAGAGTCAGACAGGCTTGGG + Intergenic
1048458018 8:134595688-134595710 ACTTACAGTCAGAGATGTCTTGG - Intronic
1048620843 8:136131423-136131445 ACTAGAAGCCAGACAGCACTTGG - Intergenic
1051072708 9:13191981-13192003 ATTTAAAGTCAGACAAATCTGGG - Intronic
1054954179 9:70889114-70889136 ACTGAAACTCAGATAGGCCTAGG + Intronic
1054968762 9:71060511-71060533 ACTGAGAGTCTGACAGGCCTGGG - Intronic
1061515389 9:131087018-131087040 AGTTAAAATCAGCCAGGGCTGGG - Intronic
1186629117 X:11329423-11329445 ACTTAAAGTCAGGCAGGTGAGGG - Intronic
1190526641 X:51334727-51334749 ACCTAATGTCAGACATGGCTGGG - Intronic
1190776201 X:53554105-53554127 CTTTAAAGTCAGACAGATCTGGG + Intronic
1193236294 X:79111760-79111782 GCTTCAAGGCAGAGAGGACTAGG + Intergenic
1193767879 X:85553919-85553941 ACTTAAAATCAGAAAGGAAAAGG - Intergenic
1193864554 X:86715105-86715127 ACTTATAGTCAGACAGATTTGGG + Intronic
1196484734 X:116192646-116192668 CCTAAAAGTCAGAAAGGATTAGG - Intergenic
1197523741 X:127534248-127534270 ATTTGAGGTCAGACAGAACTGGG - Intergenic
1199160843 X:144609287-144609309 TCTTAAAGTCAGACAAATCTAGG + Intergenic