ID: 975640889

View in Genome Browser
Species Human (GRCh38)
Location 4:76499232-76499254
Sequence TAGCCACAGCAGCTAGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975640889 Original CRISPR TAGCCACAGCAGCTAGGAAG TGG (reversed) Intronic
900695945 1:4010525-4010547 GAACCACAGCAGCCAGGGAGAGG - Intergenic
902304589 1:15526513-15526535 TAGCAACAGTTGCTAGGATGGGG - Intronic
903184881 1:21623162-21623184 TGGCCACAGCACCTAGGGAGGGG + Intronic
903646327 1:24898284-24898306 TAGCCACAGCAGCCTGCAGGTGG - Intergenic
904450880 1:30610706-30610728 CAGCCACAGCAGCCAGGACAGGG + Intergenic
904953847 1:34266682-34266704 TATCCCAAGCAGCCAGGAAGAGG - Intergenic
905582224 1:39090902-39090924 TAGCCACAGCAACCAGAAAAAGG - Intronic
908650791 1:66330618-66330640 AATCCCCAGCAGCTGGGAAGTGG + Intronic
908912289 1:69086018-69086040 TAGCCAAAGCAGAAAGGAAATGG - Intergenic
910171303 1:84379962-84379984 TAACAACAGCAGCTAGGATTAGG - Intronic
911276856 1:95871030-95871052 TAGACACAGTGGTTAGGAAGCGG - Intergenic
912852863 1:113142019-113142041 AAGCCTCAACAGCTAGGAAGTGG - Intergenic
913063760 1:115231170-115231192 CAGCAACAGCAGCAAGGAAGGGG + Intergenic
915999992 1:160606324-160606346 AAGCCACAGCAGGCAGGGAGGGG - Intergenic
916498038 1:165362722-165362744 TGGCTACAACAGCTAGGAACAGG + Intergenic
916615393 1:166434066-166434088 CAGCAACAGAAGCTAGCAAGAGG + Intergenic
916757523 1:167787061-167787083 CAGCCTCAGCAGTAAGGAAGAGG - Intronic
918658210 1:187055196-187055218 TAGCAAGAGCAGATAGAAAGGGG - Intergenic
919794230 1:201311609-201311631 TAGCCACACAAGCTGGGGAGGGG - Intronic
920591303 1:207221160-207221182 TAGTCACAACAGCTGCGAAGTGG + Intergenic
921278539 1:213543118-213543140 TAGCCACGGGAGCTGGAAAGTGG + Intergenic
921702603 1:218284905-218284927 ACGCCGCAGCAGCTAGGACGCGG - Intergenic
922027183 1:221761244-221761266 TAGCAAGAGCAGGCAGGAAGGGG - Intergenic
922479328 1:225928130-225928152 TGGCCACAGCACCAAGGAAATGG - Intergenic
923040886 1:230319096-230319118 TGCCCACAGCAGTTAGGACGCGG + Intergenic
1065765000 10:29020688-29020710 TGGCCAGACCATCTAGGAAGAGG - Intergenic
1067518331 10:46974248-46974270 GAGCCAGAGCAGCCAGGATGTGG + Intronic
1067643918 10:48077580-48077602 GAGCCAGAGCAGCCAGGATGTGG - Intergenic
1069636621 10:69929142-69929164 GAGCCACAGCAGCTGGGAGGTGG - Intronic
1070817691 10:79335664-79335686 GAGCCACTGCCCCTAGGAAGAGG - Intergenic
1072683405 10:97522796-97522818 AAGACAAAGCAGCTTGGAAGAGG + Intronic
1074777663 10:116778136-116778158 TGGCCACAGCAGCTTGGGAAAGG + Intergenic
1074828602 10:117232421-117232443 AAGCCAAACCAGGTAGGAAGAGG + Intergenic
1074922313 10:118028058-118028080 TAGCCACACCAGCTATGGAGAGG - Intronic
1076425522 10:130364715-130364737 TAGCTGCAGAAGCTGGGAAGAGG + Intergenic
1077444996 11:2586739-2586761 TAGACACAGCAGCTGGCGAGGGG - Intronic
1077994012 11:7437882-7437904 AAGCCACAGAAGGAAGGAAGAGG + Intronic
1078478698 11:11657322-11657344 AAGCACCAGAAGCTAGGAAGAGG + Intergenic
1080737869 11:35034933-35034955 TACCAACATCAGCTAGGTAGAGG - Intergenic
1080890136 11:36402028-36402050 GAGCCACAGGTGCTTGGAAGAGG + Intronic
1081923008 11:46796829-46796851 TGTCCACATCAGCTAGGAATGGG + Exonic
1082803373 11:57430841-57430863 GAGCCACAGTAGACAGGAAGGGG + Intergenic
1082935079 11:58647590-58647612 AAGCCACAGCAGGTGGGAAGGGG - Intronic
1083031838 11:59599697-59599719 TAGCCACAGCAGAAAAAAAGTGG + Intronic
1083407203 11:62465817-62465839 GAGCACCAGCAGCTAGAAAGAGG + Intronic
1084339125 11:68481938-68481960 TGGCCATAGCGGTTAGGAAGAGG + Intronic
1084508722 11:69588098-69588120 TAACCACAGCAGGGAGGGAGAGG - Intergenic
1085226412 11:74925024-74925046 TAGCCAAAGCAGCTAGAATGAGG - Intronic
1085736895 11:79046713-79046735 AACCCACTGGAGCTAGGAAGAGG + Intronic
1085879851 11:80453771-80453793 TACCAAAAGAAGCTAGGAAGAGG - Intergenic
1086835310 11:91613682-91613704 CAGCCACATAAGCTTGGAAGTGG + Intergenic
1087614744 11:100474948-100474970 AAGCGCCAGAAGCTAGGAAGAGG + Intergenic
1087793697 11:102433230-102433252 TAGTGACAGCATCTGGGAAGGGG + Intronic
1087815327 11:102652300-102652322 TAGCCACAGCAATTAGGCAAGGG - Intergenic
1089763922 11:120749323-120749345 TAGCCACAGAAGAGAGGAGGGGG - Intronic
1090224040 11:125057974-125057996 TAGCCACAGGACCAAGGAAGGGG - Intergenic
1090408230 11:126490311-126490333 TGGACACAGCCGCTAGGGAGAGG + Intronic
1091160605 11:133416241-133416263 CATACACAGCAGCTAGGGAGAGG + Intronic
1093881249 12:24406506-24406528 CAGCAACAGCAACTAGGAAGTGG + Intergenic
1093974858 12:25410451-25410473 CAACCACAGAAACTAGGAAGAGG + Intronic
1094357140 12:29589938-29589960 CAGCCCCAGAAGCTAGGAATGGG + Intronic
1094365259 12:29673005-29673027 GAGCCACAAGAGCTAGAAAGTGG + Intronic
1098509563 12:71295740-71295762 AAGCCACAGCATCTAGAAAATGG + Intronic
1101513382 12:105412375-105412397 TAGCCACGGCAGAGTGGAAGGGG - Intergenic
1101816265 12:108148349-108148371 TAGCCCCAGTACCTAGAAAGGGG + Intronic
1102013608 12:109633852-109633874 TCACCTCAGAAGCTAGGAAGAGG + Intergenic
1103966543 12:124643575-124643597 TATCCATAGCAGCCAGGAACTGG + Intergenic
1105722491 13:23130815-23130837 TACCCACAGAAGCAGGGAAGAGG - Intergenic
1107058770 13:36132886-36132908 TAGGTACAACAGCTAGGAAGAGG - Intergenic
1109319356 13:60790826-60790848 GAGCCACAGCAGTAAGTAAGAGG - Intergenic
1109811596 13:67520061-67520083 GAGCCAGAGCAGCTGGGATGTGG - Intergenic
1110535579 13:76647198-76647220 CAGCATCAGAAGCTAGGAAGAGG + Intergenic
1112094762 13:96120183-96120205 CAGCCCCAGAAGCTAGGAAGAGG + Intronic
1112332868 13:98490099-98490121 CAGCAACAGCAGGTAGGTAGGGG + Intronic
1114619314 14:24085594-24085616 TGGCCTCAGAAGGTAGGAAGTGG - Intronic
1115510245 14:34131215-34131237 CAGCCACAGCAGCTACAAAGGGG - Intronic
1115882253 14:37932830-37932852 TACCCTCAGAAGCTAGGAAGAGG + Intronic
1116627760 14:47287951-47287973 TACCCCCAGAAGCTGGGAAGAGG + Intronic
1116772518 14:49143835-49143857 AAGCCAAAGAAGCTTGGAAGAGG + Intergenic
1118844120 14:69533494-69533516 AAGCCACAGGAGCCAGCAAGTGG - Intergenic
1118907206 14:70031713-70031735 TAGGCACAGCACCTGGGCAGAGG - Intronic
1118922781 14:70165354-70165376 GAGCCATAGAAGCTAGGGAGAGG - Intronic
1118986740 14:70762170-70762192 TAGTCACAGTAGCCAGAAAGTGG - Intronic
1119019718 14:71098798-71098820 TAGCCACAGCAATCAGGCAGCGG - Intronic
1120780095 14:88479288-88479310 AATCCACAGCAGCGAGGAGGAGG - Exonic
1121171150 14:91855403-91855425 GACCAACAGAAGCTAGGAAGAGG - Intronic
1121688126 14:95854945-95854967 TAGCCACAGCAGCCTGGAGTGGG - Intergenic
1122253150 14:100454759-100454781 TAACCACAGCAGCTGGAAAGTGG + Intronic
1122635095 14:103126067-103126089 CAGCCCCAGAAGCAAGGAAGAGG - Intronic
1123213674 14:106785603-106785625 TAACCAAAACAGCTTGGAAGTGG - Intergenic
1123392244 15:19888515-19888537 TAGCCACTGCAACAAGGCAGCGG - Intergenic
1123771924 15:23537627-23537649 TAGCCTCAGCACCAAGGTAGGGG - Intergenic
1124421736 15:29529027-29529049 TAGCCACAGTGGCTGGGGAGGGG - Intronic
1124946099 15:34268201-34268223 AAGCCAGAGCTGCTAGGAGGTGG - Intronic
1125406620 15:39358860-39358882 GAGCCACTGCTGCTAGGAAGTGG + Intergenic
1125733146 15:41905470-41905492 TATCCCCAGCATCTAGGACGTGG - Intronic
1126044794 15:44629209-44629231 TAAGAATAGCAGCTAGGAAGGGG - Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1126864488 15:52922325-52922347 GAGCCACAGCAGATACAAAGAGG + Intergenic
1129561747 15:76577767-76577789 TAGCCACCACAGCTGGGAATGGG - Intronic
1129856999 15:78831576-78831598 TCGCCACGGCAGCTAGGGTGGGG + Intronic
1130969697 15:88722167-88722189 TGGCCATGGGAGCTAGGAAGTGG + Intergenic
1131967958 15:97865512-97865534 TAGCCAGTGCAGCTATGCAGTGG - Intergenic
1133943120 16:10326949-10326971 TAGCCTCAGAAGCAAGAAAGCGG - Intronic
1133985156 16:10662753-10662775 TAACCACTCCAGCTAGGAAATGG - Intronic
1133987691 16:10681109-10681131 TCGTCACAGCAGCTATGAGGTGG - Intronic
1135635307 16:24070720-24070742 AAGCCTCCGCAGCCAGGAAGTGG + Intronic
1135840331 16:25870251-25870273 TATCCACAGCACCTAGAAAGGGG - Intronic
1136176936 16:28523720-28523742 TAGGGGAAGCAGCTAGGAAGGGG - Intergenic
1138441460 16:57037429-57037451 TATCCACAGCAGCTAGGAAGAGG - Intronic
1138794654 16:59953299-59953321 GAGCCACAGCAGATGGGCAGAGG + Intergenic
1140254539 16:73323666-73323688 GAGGAACAGCAGATAGGAAGGGG + Intergenic
1141212188 16:81991771-81991793 CAGCGTCACCAGCTAGGAAGTGG - Exonic
1143081719 17:4386447-4386469 TAGCCACTGCAGCTCAAAAGTGG - Intergenic
1144647756 17:16987150-16987172 TAGTCAGAGCAGCTGGGGAGTGG - Intergenic
1145790198 17:27621826-27621848 TGGCCAGAGCAGCTGGGCAGGGG - Intronic
1145915398 17:28571141-28571163 TGGCCACCGCAGCGAAGAAGAGG + Exonic
1145964736 17:28908698-28908720 TACCCACAGAAGTTAGAAAGGGG - Intronic
1146016837 17:29240453-29240475 AGGCCACATAAGCTAGGAAGTGG - Intergenic
1148693414 17:49545632-49545654 TAGCCAGAGCAGCTGGTGAGAGG - Intergenic
1149141072 17:53434455-53434477 TATCCAAAGCAGCTAGCAAGAGG - Intergenic
1149638710 17:58189975-58189997 TAGCCACAGCACTTAGCAGGCGG - Intergenic
1150113882 17:62527477-62527499 TAGCCACAGCGGCAGGGAGGGGG - Intronic
1150159987 17:62889022-62889044 TAACTACAGCAGCTAGCAAGTGG - Intergenic
1150856408 17:68757415-68757437 TACCCATAGGAGCTAGAAAGAGG - Intergenic
1151117301 17:71751889-71751911 TAGTCACAACATCTAGAAAGTGG - Intergenic
1151621605 17:75248909-75248931 TAGCGACAGCTGCCAGGCAGAGG + Intronic
1152270057 17:79319296-79319318 GATCCACAGCAGAAAGGAAGAGG + Intronic
1152383837 17:79957015-79957037 TGGCCACAGCAGCAGGGAGGGGG + Intronic
1154230638 18:12553139-12553161 TAGCCACCACAGCGGGGAAGGGG - Intronic
1155400188 18:25429652-25429674 TAGCCAATGCAGTTAGGAATGGG + Intergenic
1155921003 18:31602773-31602795 CACCAACAGAAGCTAGGAAGAGG - Intergenic
1156189161 18:34698397-34698419 AACCCACAGAAGCTAGGAAGAGG - Intronic
1156412912 18:36852571-36852593 TAGCAACAGCAGGGAGGAGGAGG - Intronic
1157318227 18:46611250-46611272 TAGCCACAGCAGTTGGTAAAGGG + Intronic
1157944047 18:51958887-51958909 TAGGCTCAGCAGCCAGGAGGAGG - Intergenic
1161469612 19:4449692-4449714 AAGGAACAGCAGCCAGGAAGGGG + Intronic
1163953424 19:20612209-20612231 TAGGCTCATCAGCTGGGAAGTGG + Intronic
1165569036 19:36759624-36759646 TAACTACTGCAGCTAGGAAATGG + Intronic
1166123466 19:40699815-40699837 TGGCCAAAGCAGTTAGGCAGGGG + Intronic
1166385602 19:42378870-42378892 AAGCCACCCCAGCTTGGAAGTGG - Intergenic
1167561925 19:50231204-50231226 TGGCCGCAGGAGCCAGGAAGCGG - Intronic
925058597 2:873922-873944 GAGCTACAGCAGCTCGGAAAAGG - Intergenic
927753644 2:25691503-25691525 TAGCCCCATCAGCTAGAAAAAGG + Intergenic
927930630 2:27041283-27041305 TAGCCACAGCAGAAGGAAAGGGG + Exonic
928709446 2:33987774-33987796 TAGCTAGAGCAGCCAGGATGTGG + Intergenic
929243214 2:39673949-39673971 TACCCAGAGCAGTGAGGAAGGGG + Intronic
929643286 2:43603214-43603236 TGGCCCAAGCAGCTGGGAAGAGG - Intergenic
930289041 2:49470089-49470111 TAGCTAGAGCAGTTAAGAAGGGG + Intergenic
931122519 2:59235678-59235700 CAACCACAGAAGCTAGGAAGAGG - Intergenic
931902668 2:66806857-66806879 TACCACCAGAAGCTAGGAAGAGG + Intergenic
932196021 2:69784762-69784784 AACCCCCAGAAGCTAGGAAGAGG - Intronic
934056779 2:88258009-88258031 TAGCGTCAGCAGGTAAGAAGAGG + Intergenic
935271658 2:101439945-101439967 TAGCCACAGCAATCAGGATGGGG - Intronic
935504301 2:103881249-103881271 TAGCCAGGGCAGTCAGGAAGGGG - Intergenic
935856063 2:107275360-107275382 TAGCCACAGCATCTTAGAACAGG - Intergenic
936491579 2:112977222-112977244 TGGCTACAGCAGATAGGATGGGG + Intronic
937134979 2:119544564-119544586 TCGCCTCAGCAGCTAGGCTGCGG - Intronic
937365454 2:121257705-121257727 CTGCCACTGCAGCCAGGAAGCGG + Intronic
937792543 2:125977888-125977910 CAGCCACAGCAGCTGGGAGATGG - Intergenic
938289657 2:130142528-130142550 TTGCCACAGCGGCTAGGGAAGGG + Intronic
938386916 2:130873130-130873152 CAGTCACACCAGCTAGGGAGTGG - Intronic
938466873 2:131530410-131530432 TTGCCACAGCGGCTAGGGAAGGG - Intronic
939249055 2:139662687-139662709 AAGCCAGAGCAGCTGGGATGTGG + Intergenic
941505250 2:166336163-166336185 TAGCCAAACCTGCTAGAAAGAGG + Intronic
942189290 2:173455057-173455079 AACCCCCAGCAGCTCGGAAGAGG - Intergenic
944682088 2:202086278-202086300 GGGCCACAGCATCTTGGAAGAGG + Intronic
947459695 2:230292993-230293015 TAGACTCAGCAGCTTGGAGGAGG + Intronic
947469994 2:230392437-230392459 TAGACTCAGCAGCTTGGAGGAGG + Intronic
947475659 2:230445800-230445822 TGGGCACTGGAGCTAGGAAGGGG - Intronic
948193566 2:236078685-236078707 CAGCCACAGGAGCCAGGTAGGGG - Intronic
948774766 2:240278366-240278388 TAAACACAGCAGCCAGGCAGTGG + Intergenic
948961231 2:241339693-241339715 TAGCAAAAGCAGCGAGCAAGGGG - Intronic
1168962452 20:1878474-1878496 TAGCCACAGCAGGTCTGAATGGG - Intergenic
1169681623 20:8220622-8220644 GAGCCACAGAAGCTAGGAAGAGG + Intronic
1173126882 20:40345525-40345547 TAGCCACAACAGCTAGGGATGGG - Intergenic
1174074336 20:47921952-47921974 TAACGACAGCAGCTTGCAAGTGG - Intergenic
1174143880 20:48436850-48436872 TAACGACAGCAGCTTGCAAGTGG + Intergenic
1174518104 20:51108846-51108868 TCGGCACAGCAGCTAAGGAGGGG + Intergenic
1175166853 20:57050090-57050112 TATCCACAGCAGCTGAGATGGGG + Intergenic
1175692493 20:61075634-61075656 CAGCCACAGCTGGAAGGAAGTGG + Intergenic
1179245191 21:39627128-39627150 TAGCCACAGTAGCTTGGCTGAGG + Intronic
1179337485 21:40471376-40471398 CAGCCACCACAGCTAGGCAGTGG + Intronic
1181108893 22:20590121-20590143 TTGCCACCGCAGCTAGGGAAGGG + Intergenic
1181725695 22:24809491-24809513 GAGCCACTGCAGCCACGAAGGGG + Intronic
1182811806 22:33123095-33123117 TAGCTGGAGCAGCTAGGAAGGGG + Intergenic
1184255088 22:43281938-43281960 TAACCACAGCTGCTGGGACGAGG + Intronic
1184913636 22:47552184-47552206 TGGCCTCTGCAGCTGGGAAGTGG - Intergenic
1184921970 22:47612425-47612447 CAGGCACAGCAGGTAGAAAGAGG + Intergenic
951467700 3:23020143-23020165 AAGCCACAGCAGGCAGGGAGGGG + Intergenic
951565003 3:24004368-24004390 TAACCACCTCAGCCAGGAAGTGG - Intergenic
951890132 3:27560850-27560872 AACCCACAGCAGCTGGGATGGGG - Intergenic
953500120 3:43425007-43425029 TAGCCACAGTCCTTAGGAAGGGG - Intronic
953747635 3:45587217-45587239 TATCCCCAGCACCTAGGAAAGGG + Intronic
956216666 3:66856701-66856723 TCGCCACAGCAGTGAGAAAGAGG + Intergenic
956319846 3:67984632-67984654 TATCACCAGAAGCTAGGAAGAGG - Intergenic
956763696 3:72466020-72466042 TAGCTAAAGCAGGGAGGAAGAGG + Intergenic
957262883 3:77922981-77923003 TAAAAACAGCAGCTAGGAAAGGG + Intergenic
957541335 3:81573369-81573391 TAGCCAAACCAGCTTGGAATAGG - Intronic
957689750 3:83552744-83552766 TAGCAACAGCAGGCAGGAAAAGG - Intergenic
958010779 3:87876323-87876345 TATTCACAATAGCTAGGAAGTGG + Intergenic
958965997 3:100558763-100558785 TTGTCAGAGCAGCTGGGAAGTGG + Intronic
959439863 3:106361702-106361724 TAGTGAAAGCAGCCAGGAAGGGG + Intergenic
959644296 3:108680288-108680310 TAGCCAGAGCAGTTAGGCAAGGG + Intronic
960982548 3:123244260-123244282 AAGCCACAGAACCTGGGAAGTGG + Intronic
961793562 3:129393730-129393752 AAGACTCAGCAGCCAGGAAGTGG - Intergenic
966287634 3:178316105-178316127 CAACCACATGAGCTAGGAAGAGG + Intergenic
969158685 4:5236015-5236037 CAGCCAGAGCAGCCAGGAGGGGG + Intronic
969946185 4:10785445-10785467 TATCCACAGGAGGTAGGGAGAGG + Intergenic
970678362 4:18477995-18478017 TAGCCACAACAGCTTTGAAAAGG + Intergenic
970840784 4:20465862-20465884 TAGCCCCAGCTGTTGGGAAGGGG + Intronic
971783116 4:31064572-31064594 CACCCACAGAAGCTGGGAAGAGG - Intronic
971823525 4:31591162-31591184 TAGTCACAGCAGAAGGGAAGAGG + Intergenic
971911341 4:32800553-32800575 TAGGGGGAGCAGCTAGGAAGGGG - Intergenic
972453582 4:39229998-39230020 CAGACAGAGCAGTTAGGAAGTGG - Intronic
972957607 4:44411826-44411848 CACCACCAGCAGCTAGGAAGAGG + Intronic
973582532 4:52358446-52358468 TAGCCAGAGACGCTGGGAAGAGG + Intergenic
975640889 4:76499232-76499254 TAGCCACAGCAGCTAGGAAGTGG - Intronic
975918251 4:79350427-79350449 ATGCCACTGCTGCTAGGAAGTGG + Intergenic
976775914 4:88705913-88705935 TAGCCAATGCAGCCAGGCAGAGG - Intronic
978267650 4:106845552-106845574 TACCAACAGAAGCTAGGAAGAGG + Intergenic
980882733 4:138729399-138729421 TAGCCAGAGCAATTAGGAAAAGG + Intergenic
981230317 4:142346041-142346063 TAGTCACAACAACAAGGAAGTGG + Intronic
981335340 4:143562924-143562946 GAGCCAAAGCAGCTAGGATTCGG - Intergenic
981752009 4:148101994-148102016 TAGCCATAGCAACTGGGAGGTGG - Intronic
983078475 4:163355177-163355199 TAGCCCCAGAAGCCAGAAAGGGG - Intergenic
984710101 4:182877709-182877731 TATTCACAGCAGCCAGGAGGGGG - Intergenic
986762876 5:10896156-10896178 TATCTACAGCACCTAGGAAGTGG + Intergenic
986790487 5:11154803-11154825 CAACACCAGCAGCTAGGAAGAGG - Intronic
987663321 5:20905185-20905207 GAGCTACAGCAGCTGGGATGGGG + Intergenic
990269185 5:54116277-54116299 TACCCACAGCAGCTGGGAGATGG + Intronic
990753542 5:59042933-59042955 GAGCCACAGCAGTTAGCTAGAGG + Intronic
991700467 5:69312244-69312266 AAGCATCAGAAGCTAGGAAGAGG + Intronic
992267613 5:75034140-75034162 TGCCCACCGCAGCTGGGAAGAGG - Intergenic
996399012 5:123039705-123039727 AACCCCCAGAAGCTAGGAAGAGG + Intergenic
997177881 5:131797421-131797443 AAGCCGCAGAAGCTAGGGAGGGG - Intergenic
997599830 5:135131681-135131703 TAGCCAGAGCAGCTGGGGACTGG - Intronic
998217238 5:140246465-140246487 TAGCCACTGCAGCTATAAAATGG + Intronic
999202747 5:149827910-149827932 GAGCCACAGCACCAAGGGAGGGG - Intronic
999337460 5:150734687-150734709 AAGCCACAGCAGTCGGGAAGGGG + Intronic
999636579 5:153629223-153629245 TACCCAAAGCAGGGAGGAAGGGG - Intronic
1000500002 5:162036461-162036483 TAAACAAAGCAGCCAGGAAGCGG - Intergenic
1001682104 5:173565684-173565706 CAGCCACACCTGCTGGGAAGTGG + Intergenic
1003838818 6:10099201-10099223 AGGCCACAGCAGCGAGCAAGCGG + Intronic
1005228534 6:23671820-23671842 TAGCCAGAGCAGCCAGGATGTGG + Intergenic
1006189789 6:32200897-32200919 CAGCCATCGCAGCAAGGAAGCGG + Exonic
1010338458 6:74718779-74718801 CAGCAAAAGCAGCTATGAAGTGG - Intergenic
1011605145 6:89096230-89096252 TAGGAACAGCAGTCAGGAAGAGG + Exonic
1012093274 6:94927245-94927267 TAACCACAGCAGCTTGGTACTGG - Intergenic
1013648804 6:112172620-112172642 GGGCCACAGCAGCCAGGCAGCGG - Exonic
1013854247 6:114552619-114552641 TAGAAACATCACCTAGGAAGTGG - Intergenic
1014081696 6:117294301-117294323 TAGCCAGAGCAACCAGGCAGGGG + Intronic
1015294042 6:131570076-131570098 AACCTCCAGCAGCTAGGAAGAGG + Intergenic
1016219724 6:141653746-141653768 AACCGCCAGCAGCTAGGAAGAGG - Intergenic
1016529443 6:145041735-145041757 AACCCCCAGAAGCTAGGAAGAGG - Intergenic
1016822648 6:148361119-148361141 AGCCCCCAGCAGCTAGGAAGTGG + Intronic
1017014412 6:150088701-150088723 TGGCCACAGCAGCGAAGAGGGGG + Intergenic
1017691622 6:156971683-156971705 CAACCACAGGAGCTTGGAAGAGG - Intronic
1018284836 6:162226339-162226361 TATCCACAGCACCCAGGAAGGGG - Intronic
1018662612 6:166102170-166102192 CAGCCAGAGCAGCCAGGATGTGG + Intergenic
1018738704 6:166710901-166710923 TAGCCACAGGACCAGGGAAGGGG + Intronic
1019505144 7:1386807-1386829 TGGCCACAGCACCCAGGCAGCGG + Intergenic
1022235239 7:28454542-28454564 TATCCACAGGTGCTAGGAGGTGG - Intronic
1022818555 7:33936487-33936509 AAGCCACATCAGCTAGCATGTGG + Intronic
1023418290 7:39951346-39951368 CAGCCACAGCGGCGAGGAACGGG + Exonic
1023633171 7:42183518-42183540 TGGGGACAGCAGATAGGAAGGGG + Intronic
1023684186 7:42718028-42718050 TATTACCAGCAGCTAGGAAGAGG - Intergenic
1029503933 7:100950630-100950652 CAGCCACAGCAGATGGGAAGTGG - Intronic
1030412855 7:109203587-109203609 AAGCACCAGAAGCTAGGAAGAGG + Intergenic
1031147386 7:118012011-118012033 TTGTGACAGGAGCTAGGAAGTGG + Intergenic
1032276497 7:130460921-130460943 TAGCCAGAGCAGGTGGGAAGAGG - Intergenic
1032543528 7:132724003-132724025 TAGCCACAGAAACAAGGAATAGG + Intronic
1033483893 7:141769064-141769086 AAACCACAGCAGCAAAGAAGTGG - Intronic
1037683344 8:21117016-21117038 CAGCCACAGCATCAAGGGAGTGG - Intergenic
1038215288 8:25556338-25556360 TATCCACAGCACCTAGTTAGTGG - Intergenic
1041036170 8:53792892-53792914 TTGCCAAAATAGCTAGGAAGTGG - Intronic
1043520207 8:81036780-81036802 GAGCCAAAGCAGCTGGGGAGTGG - Intronic
1043533658 8:81176617-81176639 GAGCCAGAGCAGCCAGGATGTGG + Intergenic
1044233403 8:89804621-89804643 CAGCCACATCACATAGGAAGAGG - Intergenic
1048217919 8:132513701-132513723 AAGCACCAGAAGCTAGGAAGAGG + Intergenic
1048847953 8:138617376-138617398 TGGCCACAGGAACAAGGAAGGGG - Intronic
1050250344 9:3737028-3737050 TAGCCACAGGAGCTATTGAGAGG + Intergenic
1050529637 9:6577131-6577153 AAGGCACAGCAGCAAGGATGAGG + Intronic
1051494475 9:17703939-17703961 TAGCCAGAGCAGTCAGCAAGAGG + Intronic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1054834552 9:69662721-69662743 AAGAGACAGCAGCTAGGAAGAGG + Intronic
1056548060 9:87629328-87629350 AAGCCCCAGAAGCTGGGAAGTGG + Intronic
1057987222 9:99729676-99729698 TATTCACAGCAGCTGGGAAAGGG - Intergenic
1060407212 9:123378766-123378788 AACCCACAGGAGCCAGGAAGAGG - Intronic
1061120777 9:128641025-128641047 GACCCACAGCAGCAAGGAGGGGG - Intronic
1061569430 9:131467642-131467664 GAGCAACAGCAGTGAGGAAGAGG + Exonic
1062088130 9:134659060-134659082 GAGGCCCTGCAGCTAGGAAGTGG + Intronic
1186584627 X:10859584-10859606 GAACCACAGCAGGGAGGAAGTGG - Intergenic
1187376904 X:18763795-18763817 TAGAGCCAGCACCTAGGAAGAGG + Intronic
1187626013 X:21114625-21114647 TAGACGAAGCAGCCAGGAAGTGG - Intergenic
1188886518 X:35557409-35557431 AAGACAAAGCAGCTAGTAAGAGG - Intergenic
1189656657 X:43251529-43251551 CGGCCACAGCAGCCAGGATGTGG + Intergenic
1190553212 X:51606541-51606563 TTGCCACAGGATCTAGGGAGAGG + Intergenic
1194919828 X:99751018-99751040 GAGCCAGAGCAGCTGGGATGTGG - Intergenic
1194993203 X:100567283-100567305 GAGCCACAAGAGCTAGGAAAAGG + Intergenic
1196118132 X:112019341-112019363 TAGCCACAGGAACTGTGAAGGGG + Intronic
1196225247 X:113158292-113158314 TAGCCAGAGGAGCTGGGAAAAGG - Intergenic
1196950829 X:120874863-120874885 TAGCGGCAGCAGCGGGGAAGCGG - Intronic
1196971128 X:121109841-121109863 AAGCCACAGCAGGCAGGGAGGGG + Intergenic
1198160832 X:134006383-134006405 TATCCACAGTAGCCAGGAGGTGG + Intergenic
1200054161 X:153450049-153450071 GAGCCACAGGGGCTGGGAAGAGG + Intronic
1201342791 Y:12952476-12952498 TAGGAGGAGCAGCTAGGAAGAGG - Intergenic
1202276252 Y:23123283-23123305 TAGCCACAGCAATTAGGCAAGGG + Intergenic
1202289776 Y:23297407-23297429 TAGCCACAGCAATTAGGCAAGGG - Intergenic
1202429245 Y:24757008-24757030 TAGCCACAGCAATTAGGCAAGGG + Intergenic
1202441546 Y:24913082-24913104 TAGCCACAGCAATTAGGCAAGGG - Intergenic