ID: 975643984

View in Genome Browser
Species Human (GRCh38)
Location 4:76527956-76527978
Sequence GGGAGGGTGAATGGATATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 394
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975643979_975643984 -7 Left 975643979 4:76527940-76527962 CCAAGGTTCTTCACAAGGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG 0: 1
1: 0
2: 2
3: 44
4: 347
975643975_975643984 9 Left 975643975 4:76527924-76527946 CCTGTTGATTTAGACGCCAAGGT 0: 1
1: 0
2: 0
3: 1
4: 58
Right 975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG 0: 1
1: 0
2: 2
3: 44
4: 347
975643973_975643984 10 Left 975643973 4:76527923-76527945 CCCTGTTGATTTAGACGCCAAGG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG 0: 1
1: 0
2: 2
3: 44
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975643984 Original CRISPR GGGAGGGTGAATGGATATTG GGG Intronic
900649888 1:3725584-3725606 GGGTGGGTGAATGGATGGTTGGG + Intronic
901255783 1:7825198-7825220 GCGAGCTGGAATGGATATTGGGG + Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902336528 1:15757903-15757925 GGGAGGGTCACTGGATGTGGAGG + Intronic
902901067 1:19516553-19516575 GGGAGGGTGAGTGGATCCTGGGG - Intergenic
904055113 1:27664945-27664967 GGGTGGGTGAAAGGAGATGGGGG + Intergenic
904715558 1:32465170-32465192 GGGAGGCTGGCTGGAGATTGGGG + Intronic
905106860 1:35568635-35568657 GGGAGACTGAGTGGATAATGGGG + Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
905823030 1:41008859-41008881 AGGAGAGAGAATGGAAATTGTGG + Exonic
906912013 1:49963345-49963367 AGGGGAGTGAATGGATATTATGG - Intronic
907582236 1:55582706-55582728 GGGAGGGTGAAGGGATTGTGTGG + Intergenic
907722044 1:56981228-56981250 TGGAGGGTGATTGGATCATGGGG - Intergenic
908600726 1:65737088-65737110 GGGAAGGTGATTGGATCATGGGG + Intergenic
909273482 1:73654596-73654618 GTGAGGGTGATTGGATCCTGAGG + Intergenic
913092704 1:115490340-115490362 GGGAGGATGAAGGGATATGTGGG + Intergenic
913567243 1:120084759-120084781 GGGAGTGAGAATTGATCTTGGGG - Intergenic
913630890 1:120708787-120708809 GGGAGTGAGAATTGATCTTGGGG + Intergenic
914287995 1:146245465-146245487 GGGAGTGAGAATTGATCTTGGGG - Intergenic
914549030 1:148696211-148696233 GGGAGTGAGAATTGATCTTGGGG - Intergenic
914617652 1:149375507-149375529 GGGAGTGAGAATTGATCTTGGGG + Intergenic
915818234 1:158992853-158992875 GGGAGGGTAATTGGATCATGAGG + Intergenic
915868627 1:159533495-159533517 AAGAGGGTGTAAGGATATTGTGG + Intergenic
917470623 1:175323148-175323170 AGGAGGGAGAATGGAGACTGAGG + Exonic
918797222 1:188916343-188916365 GGGAGGGAGAAAGAATCTTGTGG + Intergenic
918833615 1:189431201-189431223 GGGATGGTGACTGAATTTTGAGG + Intergenic
919072112 1:192768992-192769014 TGGAGGCTGAATCAATATTGAGG - Intergenic
919616489 1:199814805-199814827 GGGAGGGCGACTGGATCATGGGG + Intergenic
919692452 1:200540252-200540274 GGGAGGGTGAATAGATAAATGGG - Intergenic
919933537 1:202236726-202236748 GGGAGAGTGAACAGATATTTTGG + Intronic
920206240 1:204294292-204294314 GGGAGGGTGAAGGGTAATTTGGG - Intronic
920363364 1:205434746-205434768 AGGAGGGAGAATGGAGACTGGGG - Intronic
921202499 1:212820997-212821019 GGGAGGGAGAAGGGATCTTGCGG + Intergenic
922991273 1:229914084-229914106 TGGAGTATGAATGGAGATTGTGG + Intergenic
923749154 1:236731020-236731042 TGGAGTGTGCATGGATTTTGTGG + Intronic
1062943660 10:1444064-1444086 TGGATGGTGAATGGATAGAGTGG - Intronic
1063167497 10:3477069-3477091 GGGTGGGTGAGTGGGCATTGAGG + Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1067926549 10:50514313-50514335 GAAAGGGAGAATGGATATTAAGG - Intronic
1068223743 10:54078930-54078952 GGGAGGAAGAGTGGATTTTGTGG - Intronic
1068257491 10:54532325-54532347 GGGAAGGAGAAGGCATATTGTGG - Intronic
1069761128 10:70812391-70812413 GGGAGGGTGATTGGATCATGGGG - Intergenic
1070340644 10:75495148-75495170 GAAGGGGAGAATGGATATTGGGG + Intronic
1070953247 10:80447518-80447540 AGAAGGGAGAATCGATATTGAGG - Intergenic
1072565177 10:96611076-96611098 GGCAGGGTGAATGGATAAACTGG + Intronic
1073580658 10:104662933-104662955 AGTAGGGAGAATGGATTTTGTGG - Intronic
1074056190 10:109924304-109924326 GGGATGGTGAGGGGATATTTGGG - Intergenic
1075696207 10:124437481-124437503 GGGAGGGTGAGTGGAGGATGAGG - Intergenic
1079592389 11:22195717-22195739 GGGAGTGTGACTGGGCATTGTGG - Intronic
1083582243 11:63832444-63832466 GGGAGTGTGAATGGGAATGGGGG + Intergenic
1084565255 11:69924920-69924942 GGGTGGGTGAATGGATAAATGGG + Intergenic
1085776776 11:79373528-79373550 GGGTGGGTGGATGGATAGTCAGG + Intronic
1086458580 11:86983421-86983443 GTGAGGGTTAATGGATGTGGAGG - Intergenic
1086996474 11:93362499-93362521 GTGGATGTGAATGGATATTGTGG - Intronic
1087015226 11:93548317-93548339 GGGAGTGGGAATGGAAACTGAGG - Intergenic
1087107271 11:94423273-94423295 GGGTGAGTGAATGGATGATGGGG + Intronic
1088774559 11:113069793-113069815 GGGAGGGAGAAAGGACATCGAGG + Intronic
1090076711 11:123584375-123584397 GGGAGGGGGAATGGAGGTTGGGG + Intronic
1090507125 11:127328105-127328127 GGGAGGGTGATTGGATCATGGGG + Intergenic
1090808803 11:130219435-130219457 GGGAGGGAGGAAGTATATTGAGG + Intergenic
1091223134 11:133942600-133942622 GGGAGGGTGAAACCATCTTGGGG - Intronic
1093760375 12:22903137-22903159 GGGAGGGGGGAGGGATAGTGGGG + Intergenic
1098624358 12:72644403-72644425 GTGAGGGAGAATGGAGATGGTGG + Intronic
1098783029 12:74711939-74711961 GGAAGGGTGAATGAATTGTGTGG + Intergenic
1099228466 12:79996163-79996185 GGGAGAGGGATTGTATATTGTGG - Intergenic
1099852651 12:88122189-88122211 GGAAGGGAGAATAGATACTGGGG - Intronic
1100001560 12:89843098-89843120 GAAAGGGAGAATGGATTTTGAGG + Intergenic
1100580499 12:95935242-95935264 AGAAGGAAGAATGGATATTGGGG - Intronic
1101538465 12:105642359-105642381 GGGAGAGTGACTGGATCTAGAGG + Intergenic
1101834723 12:108287314-108287336 GGGTGGATGAGTGGATGTTGGGG + Intergenic
1101834737 12:108287373-108287395 GGATGGGTGAATGGATCTTGCGG + Intergenic
1101834754 12:108287456-108287478 GGATGTGTGAGTGGATATTGGGG + Intergenic
1102316147 12:111889319-111889341 GGGATGGAGAATGGAAAATGTGG + Intronic
1102795310 12:115684029-115684051 GGGAGGGTGGATGGATATGTGGG + Intergenic
1102920549 12:116788749-116788771 GGATGGGTGAATGGATATATAGG + Intronic
1103100585 12:118171104-118171126 GGGAGGTTGGATGGATATGCTGG - Intronic
1103454075 12:121050999-121051021 GAAAGGGAGAAAGGATATTGAGG + Intergenic
1104290032 12:127458005-127458027 GGAGGGGAGAATGGATACTGAGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1105990724 13:25618020-25618042 GTGAGTGTGAATGGATGTTTAGG + Intronic
1106146475 13:27053943-27053965 GGGAGGATGAATTCCTATTGGGG - Intergenic
1106464986 13:30005417-30005439 TGGAGAGTGAATGGATGGTGAGG + Intergenic
1107298436 13:38939858-38939880 GAGAGGGTGATTGGATCTTGGGG - Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109147016 13:58791398-58791420 TGGAGGGTGATTGGATCATGGGG + Intergenic
1109396535 13:61766379-61766401 GGGAGGCTGAAGGGGTGTTGAGG - Intergenic
1109967149 13:69715272-69715294 TGGGGGGTGATTGGATAATGGGG + Intronic
1111897449 13:94158925-94158947 AGTAGGGTGAATTAATATTGGGG - Intronic
1112801239 13:103112047-103112069 AGAAGGAAGAATGGATATTGAGG - Intergenic
1113639808 13:111949279-111949301 GGGAGGCTGATGGCATATTGGGG + Intergenic
1115507065 14:34102803-34102825 GTGAAGTTGAATGGGTATTGGGG - Intronic
1115883436 14:37945741-37945763 GGGCTGGTGAATGGCTATAGGGG - Intronic
1116119574 14:40705512-40705534 GGGAAGGTGATTGGATCTTGGGG - Intergenic
1116378527 14:44233575-44233597 GTGAGGGTGATTGGATTATGAGG - Intergenic
1116460776 14:45170507-45170529 CAGAGTTTGAATGGATATTGTGG + Intronic
1117243571 14:53860939-53860961 GGGAGGGTGAAAGTAAATTTGGG + Intergenic
1117745414 14:58864561-58864583 AGGAGGGTGAATACATTTTGTGG + Intergenic
1117825740 14:59701689-59701711 GGAAGGGGGAATGAACATTGAGG + Intronic
1118665364 14:68063333-68063355 TGGAAGGTGATTGGATAATGGGG + Intronic
1118746225 14:68775487-68775509 GTGAGGGTGAAGGGATGTGGTGG - Intergenic
1119158010 14:72429332-72429354 GGCAGGGTGAGTGGATGTTGAGG + Intronic
1120366241 14:83574200-83574222 GAATGGGGGAATGGATATTGAGG - Intergenic
1120841783 14:89091916-89091938 GGGAGGGGGACTGCAGATTGAGG + Intergenic
1120939180 14:89930361-89930383 GGGGGAGAGAATGGATATTGGGG - Intronic
1121285137 14:92729312-92729334 GGGGGGTTGCATGGATAATGGGG - Intronic
1122218737 14:100221849-100221871 GTGAGGGAGAAGGAATATTGGGG + Intergenic
1123633081 15:22275287-22275309 GGGTGGGTGGATGGATAGTGTGG - Intergenic
1123827227 15:24094209-24094231 GGGGAGGTGATTGGATAATGGGG - Intergenic
1126308536 15:47288998-47289020 GGGAGGGTGGAGAGAGATTGAGG + Intronic
1126665000 15:51068237-51068259 GGTAGGGTGAAAGGATATAGAGG + Intronic
1128484439 15:68071105-68071127 GGGAGAGGGAGTGGACATTGAGG + Intronic
1129093850 15:73182218-73182240 GGGAGGTGGAATGGGAATTGTGG + Intronic
1129524192 15:76203783-76203805 GGGCTGGTGAATGTCTATTGCGG - Exonic
1129917788 15:79289645-79289667 AGGAGGGTGGATGGATAATCGGG - Intergenic
1130033176 15:80333997-80334019 AGGAGGGTGAGTGGATAAGGTGG + Intergenic
1130719789 15:86375414-86375436 GGGGGGGTGACTGGATCATGGGG - Intronic
1130817161 15:87448851-87448873 GGGAGGGTACTTGGATATTTGGG + Intergenic
1131084857 15:89567487-89567509 GAAGGGGAGAATGGATATTGAGG - Intergenic
1131612859 15:93983366-93983388 GAGAGGCTGAAGGGATATGGGGG - Intergenic
1131647845 15:94364660-94364682 GGGAGGTTGGATGAATATTTTGG + Intronic
1132317451 15:100900386-100900408 GGAAGGGAGAAAGGATTTTGGGG - Intronic
1134254203 16:12598378-12598400 AGGAGGAGGAATAGATATTGGGG - Intergenic
1134823121 16:17262696-17262718 AGGAGTGTGGCTGGATATTGTGG - Intronic
1135725195 16:24848826-24848848 GGAAGGAAGAATGGATATCGGGG + Intronic
1135899860 16:26447436-26447458 GGGAGAATGATTGGATCTTGGGG - Intergenic
1135933166 16:26756832-26756854 GGGTGGGTGGATGGATATGTGGG + Intergenic
1137655517 16:50154538-50154560 AGGAGAGTGAATGGATAAAGGGG - Intronic
1137971712 16:52991931-52991953 GGGAGGGTGAGAGGGGATTGAGG + Intergenic
1138777434 16:59740914-59740936 GGGAAGGTTAATGCAAATTGAGG + Intronic
1138894410 16:61185549-61185571 GTGAGGTAGAATGGAGATTGTGG + Intergenic
1138923174 16:61557300-61557322 GGGAGGGAGACTGGATCGTGGGG + Intergenic
1138979433 16:62249367-62249389 GGGTGGGTGATTGGATCATGGGG - Intergenic
1139056314 16:63189231-63189253 GGGAGGATGAAGGGCTATTGAGG - Intergenic
1140227387 16:73089580-73089602 TGCAGGGTCAATGGATAGTGTGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142255388 16:89011448-89011470 GGGTGGGTGGATGGATATATGGG - Intergenic
1142256645 16:89017264-89017286 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1142256663 16:89017314-89017336 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1142256690 16:89017393-89017415 GGGAGGGTGAATGGCCTTTGGGG + Intergenic
1142256708 16:89017443-89017465 GGGAGGGTGAATGGCCTTTGGGG + Intergenic
1142256726 16:89017493-89017515 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1142256759 16:89017583-89017605 GGGAGGGTGAATGGCCTTCGGGG + Intergenic
1143116732 17:4585383-4585405 GGGAGCGTGAATGGAGGGTGGGG - Intronic
1143456457 17:7070971-7070993 GGGGGGGTGAATGGAGGGTGTGG + Intergenic
1144388067 17:14768623-14768645 TGTAGGGTTCATGGATATTGAGG - Intergenic
1145004529 17:19329935-19329957 AGGAGGGTGAATGGAAATGCTGG - Intronic
1146609328 17:34290554-34290576 GAGAGGGAGAATTGATATTGTGG + Intergenic
1147436837 17:40421563-40421585 GGCAGGGTGGGTGGATAATGAGG - Intergenic
1147437032 17:40422804-40422826 GGCAGGGTGGGTGGATAATGAGG - Intergenic
1149118590 17:53132055-53132077 GGTAAGGGGAATGGATATAGGGG + Intergenic
1149891148 17:60391790-60391812 GGGAGGGAGAGGGGAGATTGAGG - Intronic
1149914085 17:60592445-60592467 AGAAGGGTGAATGGATGTTATGG + Intergenic
1150678329 17:67264014-67264036 GAGGGAGAGAATGGATATTGGGG - Intergenic
1150843894 17:68635241-68635263 GGGAGGGGGAAGGGGGATTGGGG + Intergenic
1151529158 17:74693327-74693349 GGGAGGGTGGATGGAGTTGGGGG + Intronic
1152767280 17:82148299-82148321 GGGTGGGTGAATGGATAAATGGG + Intronic
1153288535 18:3478501-3478523 GAAAGGGGGAATGGCTATTGGGG - Intergenic
1153778377 18:8473608-8473630 GGGGAGGTGATTGGATCTTGTGG - Intergenic
1154276728 18:12968230-12968252 GGGAGGCTGACTGAATTTTGTGG + Intronic
1154332829 18:13443659-13443681 GGGAGGGGAAATAGATATGGAGG - Intronic
1155597832 18:27509112-27509134 GGGAGGGTGAAGGGAAGGTGTGG + Intergenic
1155875391 18:31080569-31080591 GGGAAGGTGATTGGATCATGGGG + Intronic
1156401041 18:36740948-36740970 CGGAGGGTGAATTGACAATGAGG + Intronic
1157579306 18:48764214-48764236 AGGAGGGTGACTGAACATTGTGG - Intronic
1157989872 18:52482081-52482103 GGGTGGGTGAGTGGATATGGCGG - Intronic
1158296819 18:56006706-56006728 GGGAGGGAGAATAGACACTGGGG + Intergenic
1160970700 19:1766571-1766593 GGGAGGGTGAGTGGAAAAGGAGG + Intronic
1161641140 19:5424008-5424030 GGGTGGGTGGATGGATGTTTGGG - Intergenic
1161656342 19:5517876-5517898 GGGAGGGTGGATGGAAAATGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162872297 19:13595451-13595473 GGGTGGGTGGATGGATATGTGGG + Intronic
1165098211 19:33421915-33421937 GGGATGGTGAATGGTGATGGTGG + Intronic
1166297445 19:41896025-41896047 GGGAGGATGAATGGACGTGGAGG + Intronic
1166543777 19:43622602-43622624 GGGAGGGGGAAAGGAGTTTGGGG - Exonic
1167374341 19:49103083-49103105 GGGAGGGAGCATGGATTTGGAGG + Intronic
1168600467 19:57713963-57713985 GGCAGAGTAAATGCATATTGGGG + Intronic
1168711381 19:58502069-58502091 GGGCAGGTGGATGGATATGGTGG + Intronic
925098081 2:1223556-1223578 GGGAGGGTGCCAGGAAATTGAGG - Intronic
925513166 2:4649914-4649936 GGGATTGGGAATGGATGTTGGGG + Intergenic
925589433 2:5494607-5494629 TGGAGGGGATATGGATATTGGGG - Intergenic
925899781 2:8500462-8500484 GGGAGGGTGAAATGAAATAGAGG + Intergenic
927167028 2:20333819-20333841 TGGAGGGTGACTGGATCATGGGG + Intronic
927650995 2:24913678-24913700 GGGAGGGTGAGAGGAAACTGAGG - Intronic
928242403 2:29597826-29597848 GGGCAGGTGGAGGGATATTGGGG + Intronic
928580880 2:32706540-32706562 AGCAGGGAGAATGGATATTGAGG - Intronic
929226936 2:39521011-39521033 GGGAGGGTGATTAGATCATGGGG - Intergenic
929351233 2:40957887-40957909 GGGAAGGTGATTGGATCATGGGG - Intergenic
929442806 2:41978700-41978722 GGGAGGATGGATGGATCATGGGG - Intergenic
929962594 2:46507781-46507803 GGGGAGGTGAATTGATGTTGGGG + Intronic
933293251 2:80461214-80461236 AGGAGGGTGATCAGATATTGAGG - Intronic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
934538184 2:95154072-95154094 GGGAGGGTCAGTGGATATTTTGG - Intronic
934918030 2:98316698-98316720 GGGAGGGTGATTAGATCATGGGG + Intergenic
935152329 2:100449310-100449332 GGGAAGGTGAAGGGAAATTAAGG - Intergenic
936407636 2:112221220-112221242 GGGGAGGTGACTGGATAATGGGG + Intronic
938188630 2:129255104-129255126 GGGTGGGTGAGTGGATGTTTAGG - Intergenic
938188662 2:129255244-129255266 GGGTGGGTGAGTGGATGTTTAGG - Intergenic
938188804 2:129255951-129255973 GGGTGGGTGAGTGGATGTTTTGG - Intergenic
938748444 2:134304356-134304378 GGGATGGTGAATGGGTTTTCAGG + Intronic
939195209 2:138963111-138963133 GGGAAGGTGATTGGATCATGGGG + Intergenic
939644009 2:144674519-144674541 GGGAGGGAGAAAGGAAAATGGGG - Intergenic
941065076 2:160892622-160892644 GGGAGGCTGTATGGAGATTTTGG + Intergenic
942252798 2:174062106-174062128 AGGAGGGTGAATGGATAGCTTGG + Intergenic
943994419 2:194741399-194741421 GGGATGGTGTATGGATGTGGGGG + Intergenic
944226784 2:197356267-197356289 TGGTGGGTGATTGGATCTTGGGG - Intergenic
944663138 2:201937705-201937727 GGGAGAATGGATAGATATTGGGG + Intergenic
945706260 2:213236660-213236682 GGAAGGAGGAATGGAAATTGAGG + Intergenic
946897913 2:224343613-224343635 GGGAGGGTGAATTGGTTTTTTGG - Intergenic
947709937 2:232307296-232307318 GGGAGGGAGCATGGCTACTGAGG + Intronic
1168879846 20:1197045-1197067 GAAAGGGAGAAGGGATATTGAGG + Intergenic
1169560490 20:6794794-6794816 GGGAGTGGGAATGGTTATTAGGG - Intergenic
1170461867 20:16585015-16585037 GAAAGGGAGAATGAATATTGGGG + Intergenic
1172780829 20:37436201-37436223 GGGGGGGTGAATGCATGATGGGG - Intergenic
1172829412 20:37820560-37820582 TGGAAGGTGATTGGATCTTGGGG + Intronic
1173659048 20:44720321-44720343 GGGATGGGGAAAGGTTATTGGGG - Intronic
1173712965 20:45176454-45176476 GGGAGGAAGAATGGACAGTGTGG - Exonic
1174405989 20:50303788-50303810 GGGAGGGTGGATGGATTTGAGGG + Intergenic
1175237872 20:57526013-57526035 GGGTGGGGGAATGGATAAGGAGG + Intergenic
1175588451 20:60166741-60166763 GGGAGGTTGAACCCATATTGTGG - Intergenic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178178457 21:30132181-30132203 TGGAGGGTGAGTGGATCATGGGG - Intergenic
1178273839 21:31218236-31218258 GGAATAGAGAATGGATATTGGGG - Intronic
1182450660 22:30418667-30418689 GGAAGGGGGAATGGATCCTGTGG - Intronic
1183090126 22:35516664-35516686 GGGAGAGAGAATGGGTATTTAGG - Intergenic
1183678551 22:39313397-39313419 GGGAGGCTGAATTGATCGTGTGG - Intronic
1184434219 22:44460371-44460393 GGGTGGGTGAATGGATGAGGGGG - Intergenic
1184588934 22:45467965-45467987 AGGAAGGTGAATGGATCATGGGG - Intergenic
1184878076 22:47288192-47288214 GGGAAGGTGAATGGATAAGAGGG - Intergenic
1185063775 22:48620753-48620775 GGGTGGGTGGATGGATAGTGTGG - Intronic
1185063801 22:48620836-48620858 GGGTGGGTGGATGGATAGTGTGG - Intronic
1185063855 22:48621019-48621041 GGGAGGGTGGATGGATAGTGTGG - Intronic
950720600 3:14879838-14879860 GGGAGGGGGAAAGGATGCTGAGG + Intronic
950901862 3:16505210-16505232 GGGAGGATGGAGGGAGATTGAGG - Intronic
951631925 3:24731421-24731443 GGGAGGGAGAAAGGGTGTTGTGG + Intergenic
952901380 3:38114170-38114192 GGGAGGGAGAGTGGAGATGGCGG + Intronic
953295963 3:41717040-41717062 AGAAGGGTGAATGGATGTGGAGG + Intronic
953902330 3:46850301-46850323 GGAAAGGTGGATGGATCTTGAGG - Intergenic
954145306 3:48631523-48631545 GGGAGGGTTCTTGGGTATTGTGG - Intronic
956034806 3:65079441-65079463 GGGTGGGGAAATGGATATGGAGG - Intergenic
956425733 3:69132710-69132732 TGGAAGGTGAATGAATAATGGGG + Intergenic
956848431 3:73205546-73205568 GGGAGGGTGGATGGATCATGAGG + Intergenic
957319114 3:78606466-78606488 AAGAGGGAGAAGGGATATTGGGG - Intronic
957837268 3:85612009-85612031 GGGAAGGTGAATAGATATTTAGG + Intronic
958700220 3:97579551-97579573 GGTAGGGTCAATGGAGAATGAGG - Intronic
959117027 3:102190552-102190574 GGGCGGGTGAATGGCTGATGTGG + Intronic
959395029 3:105826577-105826599 GAAAGGGTGAATGGAAGTTGGGG - Intronic
959960675 3:112294529-112294551 GAAAAAGTGAATGGATATTGTGG + Intergenic
960178213 3:114542555-114542577 GGAAGGGAGAATGGAGGTTGTGG + Intronic
960293431 3:115914307-115914329 TTGAGGGTGATTGGATAGTGAGG - Intronic
960390022 3:117065893-117065915 GGTAGGGGGAAAGGATATTGAGG + Intronic
961248951 3:125483001-125483023 GGGAGGGGAAATGGATAGAGAGG + Intronic
961739291 3:129022667-129022689 GGGAGGGTGGGTGGCTACTGGGG + Intronic
962376292 3:134861418-134861440 GGGAATGTGAATGGATAGGGAGG + Intronic
962886870 3:139635747-139635769 GGATGGGAGAATGGATATTGAGG - Intronic
963034382 3:141012915-141012937 GGAAGGGAGAAAGGATATTAGGG + Intergenic
963083082 3:141412764-141412786 GGGAGGGAGAAAGAATATTAAGG - Intronic
964241510 3:154600581-154600603 GCGGGGGTGATTGGATAATGGGG - Intergenic
964396497 3:156251379-156251401 GGTAGGGTGAAAGGATAATGAGG + Intronic
965924123 3:173957485-173957507 GAAGGGGAGAATGGATATTGGGG - Intronic
968299809 3:197603851-197603873 GGGGTGGTGGATGCATATTGAGG - Intergenic
968465962 4:751379-751401 GGGAGGTTGCATGGGTTTTGTGG + Intronic
968946142 4:3665508-3665530 GGGTGGGTGAATGGATAGGTGGG - Intergenic
969054909 4:4395608-4395630 GGGAGGGTGAATCTCTATTGCGG - Intronic
969289583 4:6230141-6230163 GGGAGGGTCAGTGGACATTCAGG + Intergenic
969510880 4:7617272-7617294 AGGTGGGTGGATGGATAATGGGG - Intronic
969943164 4:10755373-10755395 GAAAGGGAAAATGGATATTGAGG - Intergenic
970801164 4:19975314-19975336 GGGAGGGTGATTGGATCATAGGG + Intergenic
971243226 4:24907324-24907346 AAGAGGGAGAATGGATGTTGAGG - Intronic
972223345 4:36982510-36982532 ATAAGGGTGAATGGATAATGGGG - Intergenic
972736239 4:41844422-41844444 GACAGGGAGAATGGTTATTGGGG - Intergenic
973246484 4:48016209-48016231 CGGAGAGTGGATGGATATAGCGG + Intronic
974645964 4:64693360-64693382 TTGAGGGTGAAAGAATATTGAGG + Intergenic
975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG + Intronic
977727979 4:100319863-100319885 GGGTGGGTGTATAGATGTTGGGG + Intergenic
977732826 4:100375787-100375809 GTGAGTGGGAATGGACATTGTGG + Intergenic
977751429 4:100614374-100614396 TGGAGGGTGGGTGGGTATTGGGG - Intronic
978272677 4:106909426-106909448 GGAAGGGTGAATGGATAAATAGG + Intergenic
979677231 4:123423271-123423293 GGGAGGGTGGGTGGAGACTGTGG + Intergenic
981777107 4:148381859-148381881 TAGAGGGTGAAGGTATATTGGGG - Intronic
982062616 4:151620011-151620033 GAGAGGGAGAATAAATATTGGGG + Intronic
982138205 4:152293002-152293024 AGGAGGGTCAAAGGATATTGGGG - Intergenic
985046738 4:185948352-185948374 GGGAGGGCTAATGTATATTAGGG - Intronic
985365476 4:189227174-189227196 GGGTGGGTGGAGGGATATTTTGG - Intergenic
985820550 5:2157288-2157310 GGGCAGGTGAATGGATATAAGGG - Intergenic
986863194 5:11952273-11952295 TGGGGGGTGATTGGATCTTGGGG - Intergenic
987366734 5:17155328-17155350 GGTAAGGTGAAGGAATATTGAGG - Intronic
989453365 5:41612954-41612976 GGGTGGGTGAATGGATATGTGGG - Intergenic
989814480 5:45719766-45719788 GGGGGGGTGAATGGAGTTAGAGG + Intergenic
990695224 5:58408919-58408941 AGGATGGTGAGAGGATATTGAGG - Intergenic
990976194 5:61564002-61564024 TGGAGGGTGACTGGATCATGGGG - Intergenic
991319854 5:65360337-65360359 TGGTGGGTGATTGGATCTTGGGG - Intronic
991560223 5:67943349-67943371 GGGGTGGTGAATGGATACTGGGG - Intergenic
993678957 5:90851510-90851532 GGGAGTGAGCAAGGATATTGAGG + Intronic
994038157 5:95226159-95226181 GGGAGGGAAAATGGACTTTGGGG - Intronic
995477926 5:112566489-112566511 TGGAGGGTGATTGGATCATGGGG - Intergenic
995655867 5:114425502-114425524 GAGAGGGTGCAAGGTTATTGAGG - Intronic
996915504 5:128707516-128707538 AGGAAGGTGATTGGATCTTGGGG - Intronic
996933904 5:128925971-128925993 GAAAGGGTAAATGGATATTCAGG - Intronic
997047119 5:130331411-130331433 TGGAGGGTGATTGGATCATGGGG + Intergenic
997065367 5:130553511-130553533 AGGTGGGTCAATGGATATTAAGG - Intergenic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
998527408 5:142855473-142855495 GGAAGGGTGGATGGATATCTAGG - Intronic
1000543051 5:162565374-162565396 GGGAAGATGAATGGGCATTGGGG - Intergenic
1000633207 5:163614487-163614509 AGGTGGGTGCATGGATTTTGGGG + Intergenic
1000828122 5:166071302-166071324 GGGAGGCTGGATGGAAAATGAGG + Intergenic
1002466813 5:179412360-179412382 GGGAGGGTGGAAGGTCATTGGGG - Intergenic
1002467044 5:179412889-179412911 GGGAGGGTGGAAGGTCATTGGGG - Intergenic
1003572001 6:7261974-7261996 GGGAGGGTGCATGGACAAAGAGG - Intergenic
1004266532 6:14152897-14152919 CGGGAAGTGAATGGATATTGTGG + Intergenic
1004294715 6:14400209-14400231 GGGAGGGAGGATGGATATCAAGG - Intergenic
1007362757 6:41370626-41370648 GGGAGGGTCAATGGAAAGTCAGG - Intergenic
1007537614 6:42607752-42607774 GGGAAGGAGAAAGGATAATGGGG - Intronic
1008266011 6:49427024-49427046 TGGAAGGTGACTGGATCTTGGGG + Intergenic
1010121371 6:72379437-72379459 GTGAGAATGAATAGATATTGGGG + Intronic
1010240183 6:73608136-73608158 GGGAGTGGGAATGGATGCTGAGG - Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1010898328 6:81393247-81393269 TGGAGGGTGATTGGATCATGCGG + Intergenic
1011554109 6:88556929-88556951 GGGAGGTTGAGTGGATGTGGGGG - Intergenic
1011708743 6:90029479-90029501 GGGAGGGAGGATGGAGAGTGAGG - Intronic
1011740507 6:90354905-90354927 AGGAGGGTGAATGGATACTGGGG + Intergenic
1012493921 6:99813304-99813326 GGGGGGGTGATTGGATCATGAGG + Intergenic
1012515605 6:100055362-100055384 GGGAAGGTGATTGGATCATGGGG + Intergenic
1013511669 6:110850362-110850384 GGGAGGGTCAAGGGAATTTGGGG - Intronic
1014290165 6:119549173-119549195 AGGAGTGTGAAAGGATATTTAGG + Intergenic
1014767158 6:125420229-125420251 GGAAGAGTGAATGTATAATGTGG + Intergenic
1016583224 6:145653214-145653236 AGGAAGGTGATTGGATAATGGGG + Intronic
1016830320 6:148427192-148427214 GGGAGGGTGAGAGGATTCTGGGG + Intronic
1019512614 7:1425681-1425703 GAGGTGGGGAATGGATATTGGGG - Intergenic
1020229488 7:6306744-6306766 GGGAGGGGGAATGGGGAATGAGG + Intergenic
1020347412 7:7181218-7181240 GGAAAGGTGGAAGGATATTGCGG + Intronic
1020347416 7:7181239-7181261 GGAAAGGTGGAAGGATATTGCGG + Intronic
1021293057 7:18869292-18869314 GGGAGGTTGATTGGATCATGGGG + Intronic
1021772817 7:24022171-24022193 TGGAAGGAGAATGGATATTGGGG - Intergenic
1022253893 7:28636282-28636304 GGGAGGGAGGAGGGATATGGAGG + Intronic
1023629616 7:42150928-42150950 GGGAGGGTGAGTGGAAATGAGGG + Intronic
1024433865 7:49324877-49324899 GGGAGGCTGAATGGACAATTTGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026656016 7:72257219-72257241 TGGAAGGTGATTGGATAATGGGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1029154187 7:98503294-98503316 GAGAAGGTGAATGAATGTTGTGG + Intergenic
1029704391 7:102268402-102268424 AGGAGGGTCAATGAATATGGAGG - Intronic
1030676884 7:112393644-112393666 GGGAGGGTGATTAGATCATGAGG + Intergenic
1032560845 7:132891759-132891781 TGGGAGGTGAATGGATAATGGGG + Intronic
1034539866 7:151750597-151750619 GGAAGGGGTAATGGAGATTGAGG + Intronic
1034634104 7:152553796-152553818 TGGGAGGTGATTGGATATTGGGG + Intergenic
1035680878 8:1486948-1486970 GGGAGGTTGAAACAATATTGGGG + Intergenic
1037342133 8:17857249-17857271 GGGAGAGTGAAAGGGGATTGAGG + Intergenic
1038351815 8:26782950-26782972 GGCTGGGTGATTGGATGTTGTGG - Intronic
1039435569 8:37557168-37557190 GGGGGGGTGAAAGAATCTTGAGG - Intergenic
1039549190 8:38430740-38430762 GGGAGGGAGAGTGGATGGTGGGG - Intronic
1039668672 8:39568478-39568500 GGTAGGGTGATTGGATCATGGGG - Intergenic
1041585005 8:59506256-59506278 GGGAGGAAGAATGGATGTTGAGG + Intergenic
1043642333 8:82470723-82470745 GGGAGGGTGATAAGATATTTTGG + Intergenic
1045614411 8:103891791-103891813 GAGAGGGTGAATGGAAATGGTGG + Intronic
1045998789 8:108395367-108395389 GGGAAGGTGATTGGATGATGGGG - Intronic
1047352931 8:124093217-124093239 GGGAAGGTGACTGGATCATGGGG - Intronic
1047416205 8:124666706-124666728 GGGAGGGTGGAGGGAGAATGAGG + Intronic
1048295354 8:133209836-133209858 GGAAGGGTGAAGGGGCATTGTGG - Intronic
1053168731 9:35863192-35863214 GGAAGGGGGAATTGATTTTGAGG - Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055605427 9:77965281-77965303 GGGAAGTTGAATGGTTTTTGAGG - Intronic
1055751727 9:79513982-79514004 TGGAGGGTGATTGGATCATGGGG - Intergenic
1056285092 9:85079534-85079556 GGGAGGATGGATGTAAATTGAGG - Intergenic
1057414266 9:94847280-94847302 TGGGTGGGGAATGGATATTGTGG + Intronic
1057430293 9:94987804-94987826 GTGAGGGGGAATGGTTAGTGGGG + Intronic
1058123813 9:101168692-101168714 GGGTGGGTGAATGGATAAAGTGG + Intronic
1058346522 9:103970090-103970112 GGGAGGGTGACTGGATCATGGGG + Intergenic
1058944239 9:109841717-109841739 GGGAGGGTGAAGGGAAAGAGGGG + Intronic
1059028396 9:110662372-110662394 GGGAGGGGAAATGGGTATTGGGG - Intergenic
1059095092 9:111404495-111404517 GGGGGGGTGACTGGATCTTGGGG + Intronic
1060378527 9:123142050-123142072 TGGAGGGTGATTAAATATTGAGG - Intronic
1061900224 9:133668806-133668828 GGGAGGGTGAGGGGAGATGGAGG - Intronic
1061900243 9:133668856-133668878 GGGAGGGTGAGGGGAGATGGAGG - Intronic
1061900315 9:133669066-133669088 GGGAGGGTGAGGGGAGATGGAGG - Intronic
1185547091 X:954365-954387 GGGAGGGTGAATGAATGTGTGGG - Intergenic
1185639178 X:1577259-1577281 GGGTGGGTGAATGGATGGTTGGG + Intergenic
1187202013 X:17144199-17144221 GGGAGAGTGAATGAATATCCTGG - Intronic
1188434048 X:30140004-30140026 GTGAGGGTGAAGGGAGATCGGGG - Intergenic
1190896714 X:54626174-54626196 GGGAGGGAGAAGGGAGACTGGGG - Intergenic
1192025149 X:67442195-67442217 GGGAAGTTGTATGTATATTGTGG + Intergenic
1192452151 X:71251331-71251353 GGGAGGGGGAAGGGAGAGTGGGG + Intronic
1192819752 X:74632368-74632390 GGGAGAGTGGATGCATATTGTGG - Intergenic
1193132947 X:77937167-77937189 GGGAGGTTGTATGTATATGGTGG + Intronic
1193930424 X:87545333-87545355 TGGGAGGTGATTGGATATTGGGG + Intronic
1195346943 X:103960290-103960312 GGGAAGGTGAATGGAAGTGGAGG + Intronic
1195360499 X:104078551-104078573 GGGAAGGTGAATGGAAGTGGAGG - Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1196698238 X:118637227-118637249 GGGAGGGTGGAGGGATATCAGGG + Intronic
1197609584 X:128623409-128623431 GGGAGGCTGAGTGGAGGTTGAGG - Intergenic
1198074359 X:133180359-133180381 TGGGAGGTGAATGGATCTTGGGG + Intergenic
1198212237 X:134527099-134527121 TGGAGGGTGAATGCAAAATGAGG - Intergenic
1198441367 X:136666612-136666634 GGGAAGGTCACTGGAAATTGAGG - Exonic