ID: 975647070

View in Genome Browser
Species Human (GRCh38)
Location 4:76555783-76555805
Sequence GGTGAGGTGGTAGGAGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 1, 1: 1, 2: 6, 3: 72, 4: 699}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975647070_975647090 23 Left 975647070 4:76555783-76555805 CCTGTCCCTCCTACCACCTCACC 0: 1
1: 1
2: 6
3: 72
4: 699
Right 975647090 4:76555829-76555851 CACCTCTGGGAAAAGAGCTCGGG 0: 1
1: 0
2: 1
3: 23
4: 252
975647070_975647080 9 Left 975647070 4:76555783-76555805 CCTGTCCCTCCTACCACCTCACC 0: 1
1: 1
2: 6
3: 72
4: 699
Right 975647080 4:76555815-76555837 TCCCTACCCTACCCCACCTCTGG 0: 1
1: 0
2: 4
3: 78
4: 637
975647070_975647091 24 Left 975647070 4:76555783-76555805 CCTGTCCCTCCTACCACCTCACC 0: 1
1: 1
2: 6
3: 72
4: 699
Right 975647091 4:76555830-76555852 ACCTCTGGGAAAAGAGCTCGGGG 0: 1
1: 0
2: 2
3: 11
4: 129
975647070_975647082 10 Left 975647070 4:76555783-76555805 CCTGTCCCTCCTACCACCTCACC 0: 1
1: 1
2: 6
3: 72
4: 699
Right 975647082 4:76555816-76555838 CCCTACCCTACCCCACCTCTGGG 0: 1
1: 0
2: 4
3: 41
4: 393
975647070_975647093 28 Left 975647070 4:76555783-76555805 CCTGTCCCTCCTACCACCTCACC 0: 1
1: 1
2: 6
3: 72
4: 699
Right 975647093 4:76555834-76555856 CTGGGAAAAGAGCTCGGGGTTGG 0: 1
1: 0
2: 0
3: 17
4: 221
975647070_975647089 22 Left 975647070 4:76555783-76555805 CCTGTCCCTCCTACCACCTCACC 0: 1
1: 1
2: 6
3: 72
4: 699
Right 975647089 4:76555828-76555850 CCACCTCTGGGAAAAGAGCTCGG 0: 1
1: 0
2: 2
3: 26
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975647070 Original CRISPR GGTGAGGTGGTAGGAGGGAC AGG (reversed) Intronic
900115451 1:1026017-1026039 AGTGAGGTGGTGGGAGGGGTAGG + Intronic
900132912 1:1096822-1096844 GCTGAGGTGGGAGGATGGCCTGG - Intronic
900149418 1:1171644-1171666 GGTCAGGTGGCAGGTGGGGCTGG - Intergenic
900837004 1:5012783-5012805 GGTGAGGTGGGAGGAGAGAAAGG - Intergenic
900919830 1:5663067-5663089 GGTGACATGGTGGGCGGGACTGG - Intergenic
900926510 1:5709533-5709555 GGTGAGGTGCTGGGAGTCACGGG - Intergenic
901167541 1:7230797-7230819 GGGGAGATGGCATGAGGGACTGG + Intronic
901323787 1:8355392-8355414 GGTGGGGTGCTGGGAGGGAGTGG - Intronic
901867682 1:12117837-12117859 GGTGAGGGGGTGGGAGGTATAGG - Intronic
902382971 1:16061276-16061298 GGTGAGGTGGAGGAAGGCACTGG + Intronic
902533742 1:17107026-17107048 GGAGAGGTGACAGGAAGGACAGG + Intronic
902701705 1:18176696-18176718 GGTGAGGTGGGAGGAGTTCCGGG + Intronic
902786231 1:18734387-18734409 GGGGAGAGGGTAGGAGGGAGAGG - Intronic
902928387 1:19713031-19713053 GGTGAGGTTCTAGGAGAGAGTGG + Intronic
903649906 1:24916122-24916144 GGTGAAGTGGGAGTAGGGGCTGG - Intronic
904035885 1:27558283-27558305 GGTGAGGTGCTGGGAGGGCCTGG - Exonic
904322743 1:29707613-29707635 GGGGAGGAGGGAGGGGGGACGGG + Intergenic
904413379 1:30339206-30339228 AGTGAGGTGGGAGGAAGGAAGGG + Intergenic
904619411 1:31766327-31766349 TGAGAGGTGATGGGAGGGACTGG + Intergenic
905381229 1:37562798-37562820 GCTGAGGTGATAGGAGGGAGGGG + Intronic
905796029 1:40817218-40817240 GGTTAGATTGTTGGAGGGACAGG - Intronic
905914459 1:41675233-41675255 GGAGATGTGGCAGGAGGGGCAGG - Intronic
906296077 1:44649957-44649979 GGTGAGGTGGCATGGGGGTCGGG + Exonic
906326669 1:44850444-44850466 GGTGAGGTGGGGGAAGGGGCTGG + Intergenic
906691600 1:47796369-47796391 GGTGAGGTGGATGGAGAGCCTGG + Intronic
906736155 1:48130923-48130945 GGTGAGGGGGTTGGAGGGAGTGG - Intergenic
907210721 1:52819234-52819256 GGTAATGTAGTAGGAAGGACCGG - Intronic
907319689 1:53594642-53594664 GGTGACGTCGGAGGAGGCACAGG + Exonic
907336721 1:53704538-53704560 GGTGAGGAAGTGGGAGGGAGGGG + Intronic
907737087 1:57124923-57124945 GGTTGGGGGGTGGGAGGGACAGG - Intronic
907880432 1:58545081-58545103 GGAGAAGTAGTAGGAGGGCCTGG - Intronic
908103787 1:60818869-60818891 GGTGATGTAGTAGGAGGGATAGG - Intergenic
908199243 1:61777443-61777465 GCTGAGGTGGGAGGAGGTAGAGG + Intronic
908486116 1:64595469-64595491 GGTCAAGTGGCAGGATGGACAGG + Intronic
909071147 1:70994921-70994943 GGAGAGGAAGTGGGAGGGACTGG + Intronic
909229966 1:73075304-73075326 GGGGAGGTGGGAAGAGGGAGTGG - Intergenic
909583071 1:77260010-77260032 GATGAGGATGTAGAAGGGACTGG - Intergenic
910059280 1:83068958-83068980 GGTGAATTGGGATGAGGGACAGG + Intergenic
911154239 1:94623368-94623390 GTTTAGCTGGTAGCAGGGACAGG + Intergenic
911694264 1:100870735-100870757 CTTGAGGGGGTAGGAGGGACAGG - Intergenic
912160982 1:106984966-106984988 GGTGAGGAGAGAGGAGGGACAGG - Intergenic
912797719 1:112702977-112702999 GGTGAGGGGATTGGAGGGAGGGG - Exonic
915163045 1:153933100-153933122 GGGGAGGAGGTGGGAGGGGCTGG - Intronic
915312984 1:155013703-155013725 GGGGAGGTGGGGGGTGGGACTGG + Intronic
915421432 1:155785587-155785609 GCTGAGGTGGGAGGAGCGATTGG - Intronic
915873761 1:159590095-159590117 GGTGAGGTGGTATGATGGTTTGG + Intergenic
915985745 1:160462460-160462482 AGTGAGGTGATAACAGGGACTGG + Intergenic
916575190 1:166060471-166060493 GGAGGGTGGGTAGGAGGGACTGG + Intronic
916678980 1:167087534-167087556 AGTGGAGTGTTAGGAGGGACGGG + Intronic
917735433 1:177915793-177915815 GGTGAGGCAGGAGGAGGGAGTGG - Intergenic
918108543 1:181434722-181434744 GGTGTGGTGGGAGGAGCTACGGG + Intronic
918294562 1:183144137-183144159 GGTGGGTTGGTAGGAGGAAGGGG - Exonic
918448343 1:184635828-184635850 GGGGAGGTGGAAGCAGGCACTGG + Intergenic
919187382 1:194170072-194170094 GGGAAGGTGGTAGGAGGGTCAGG - Intergenic
919585279 1:199430822-199430844 GGTGAGGAGGTAGGGGGGAATGG + Intergenic
920108991 1:203573996-203574018 GGTGGGGTGGTAGGAGGGAGAGG - Intergenic
920175451 1:204098687-204098709 GGTTAGGTGGTGGGGAGGACTGG + Intronic
920387173 1:205577287-205577309 GGTGGCCTGGTAGAAGGGACTGG - Intronic
920415066 1:205793574-205793596 GGTGAGGGGGCTGGAGGGATAGG + Intronic
920496367 1:206457754-206457776 GTTGAGGTGGAAGGAGGGAAGGG - Intronic
920509642 1:206541404-206541426 GCTGGGGAGGAAGGAGGGACAGG + Intronic
920657589 1:207888033-207888055 GGGGAGGTGGGAGGAAGGATCGG + Intronic
922209963 1:223479156-223479178 GGTGAGGAGGTAGGAGGGTGAGG + Intergenic
922209973 1:223479172-223479194 GGTGAGGAGGTGGGGGGGAGGGG + Intergenic
922940758 1:229463306-229463328 GGTGAGGTGGGAGAAGTGATTGG + Intronic
922969506 1:229724108-229724130 GGTGTGGGGGGAGGAGGGAGTGG + Intergenic
923252753 1:232192276-232192298 GCTGAGATGGTAGGAAAGACAGG + Intergenic
923448579 1:234095319-234095341 GGTGAGTAGGAAGGAGGGAGAGG + Intronic
923545757 1:234922145-234922167 GGGGAGGTGGCAGGTGGGATGGG + Intergenic
923721143 1:236468108-236468130 GCTGGGGTGGGTGGAGGGACTGG - Intronic
923843541 1:237701670-237701692 GGTGAGGGGGCAGGAGGGGGTGG - Intronic
924470198 1:244336647-244336669 GGTGTGGTGGAAGGAGGGTTGGG - Intergenic
1062818431 10:516822-516844 GGTAGGGTGGGAGGGGGGACAGG + Intronic
1062856815 10:783928-783950 TGGGAGGTGGACGGAGGGACGGG - Intergenic
1062856836 10:783989-784011 TGGGAGGTGGACGGAGGGACGGG - Intergenic
1062856857 10:784050-784072 TGGGAGGTGGACGGAGGGACGGG - Intergenic
1062856898 10:784172-784194 TGGGAGGTGGACGGAGGGACGGG - Intergenic
1062856919 10:784233-784255 TGGGAGGTGGACGGAGGGACGGG - Intergenic
1062856940 10:784294-784316 TGGGAGGTGGACGGAGGGACGGG - Intergenic
1063395747 10:5685311-5685333 GGTGAGGGGGTGGGAGGGGTCGG + Intronic
1063558559 10:7104370-7104392 GGGAAGGTGGGAGGAGGGAGAGG - Intergenic
1064261642 10:13790961-13790983 TGTGAGGTGACAGAAGGGACTGG + Intronic
1064390003 10:14934002-14934024 GGTGAGCTGGGAGGATGGAAGGG + Intronic
1064400438 10:15016530-15016552 GGTGAGCTGGGAGGATGGAAGGG + Intergenic
1064423420 10:15209886-15209908 GGTGAGGTGGGTGGAGAGAAGGG - Intergenic
1065176538 10:23081735-23081757 GGTGAGGAGGTCTGAGGGATTGG + Intergenic
1066696621 10:38084707-38084729 GGTGGGGTGGGAGGAGGGAGAGG + Intergenic
1067777653 10:49175058-49175080 GGTGAGGTGGCAGCAGGGACTGG + Intronic
1067979962 10:51074076-51074098 GGTGGGGAGGTGGGAGGGAGGGG - Intronic
1068545065 10:58335390-58335412 GGTGAGGTGGGAGCAGGGTCAGG + Intronic
1069059176 10:63875927-63875949 GGGAAGGTGGGAGGAGGGAGAGG - Intergenic
1069846116 10:71372894-71372916 ATTGAGGAGGGAGGAGGGACAGG + Intergenic
1070552509 10:77501764-77501786 GGTGGGGTGGGAGCAGGGGCAGG + Intronic
1070826223 10:79391913-79391935 TGAGGGGTGGTAGGAGGGAAAGG - Intronic
1071228962 10:83563460-83563482 GTTGAGGTGCTAGAAGGTACAGG + Intergenic
1072038945 10:91589801-91589823 AGTGAGGAGGTGAGAGGGACAGG + Intergenic
1072645164 10:97248312-97248334 GCTGAGGTGGGAGGATCGACTGG + Intronic
1074219984 10:111427079-111427101 TGGCAGGTGGGAGGAGGGACAGG - Intergenic
1074519839 10:114209117-114209139 GCTGAGGTGGGAGGAGGGCTTGG + Intronic
1074765451 10:116696775-116696797 GTTGAGGTGGAAGGAGGGTAAGG - Intronic
1075170737 10:120111448-120111470 GATGAGGGGCAAGGAGGGACAGG - Intergenic
1075238612 10:120756813-120756835 GGTGAGGTCTCAGGAGGTACAGG - Intergenic
1075528968 10:123210965-123210987 TGGGGGGTGGGAGGAGGGACAGG - Intergenic
1076325420 10:129616818-129616840 GGTGAGGTGGGAGAGGGGCCTGG + Intronic
1076483513 10:130800598-130800620 GGTAAGGTTTTAGGAAGGACTGG + Intergenic
1076516673 10:131049251-131049273 GGTGCAGTGGGAGGAGGGGCTGG - Intergenic
1076801996 10:132835211-132835233 GGCGAGGTGGGGGGAGGGGCGGG - Intronic
1076809426 10:132878930-132878952 GGAGAGGTGGTAGGAGGAGCAGG + Intronic
1077297831 11:1834395-1834417 GGTGAGGTGGTGGCAGGTAGGGG - Intronic
1077301059 11:1847169-1847191 GGTGAGGAGGTAGGGGTGACTGG - Intergenic
1077476814 11:2794346-2794368 GGTGCTGAGGTAGGAGGGTCAGG + Intronic
1077888613 11:6403539-6403561 GGTGAGCTAGGAGGAGGGATGGG + Exonic
1078928418 11:15894697-15894719 GGGGAGGTGGCTGGAGGCACTGG - Intergenic
1079097899 11:17522737-17522759 GGTGGGGTGGGAGGCGGGACAGG + Intronic
1079288555 11:19164054-19164076 GATGAGGTGATAGGTGGGAGTGG + Intronic
1079375039 11:19884729-19884751 GGTGAGGTGGGATTAGGGCCAGG - Intronic
1079469616 11:20765711-20765733 GGTGAGGTGGGAGTTGGGCCTGG + Intronic
1079599710 11:22295713-22295735 GTAGAGGTGGTAGGAGTGATGGG + Intergenic
1082828414 11:57597973-57597995 GGGGAGGTGGTGGGAGGGGGAGG - Intronic
1083147410 11:60769659-60769681 GAGGAGGTGATAGGAGGGATAGG - Intronic
1083499770 11:63093697-63093719 GGGAAGGTGGGAGGAGGGAGAGG + Intronic
1083544403 11:63538037-63538059 GGTGAGGGGGTTTGAGGGAGGGG + Intronic
1083763511 11:64831483-64831505 GGTGAGCTGGTGGAGGGGACTGG - Exonic
1084661968 11:70551318-70551340 GGGGAGGCGGTGGGAGGGAGGGG - Intronic
1084946255 11:72640360-72640382 GGTGGGGTGGGAGGAGGCAGTGG - Intronic
1085322576 11:75583808-75583830 GGAGAGGAGGGAGGAGGGAGAGG + Intergenic
1085472152 11:76765190-76765212 GGTGTGGGGGTAGGAGGCACAGG + Intergenic
1086335814 11:85799732-85799754 GGTGGGGTGGTAAGAGGGAAGGG - Intronic
1087454859 11:98372130-98372152 GTTGGGGTGGTAGGAGGTAGGGG + Intergenic
1088238739 11:107752364-107752386 GGTGCGGGGGGAGGAGGGAGAGG - Intergenic
1088582730 11:111331309-111331331 GGTGAGGGGGAGGGAGGGGCAGG - Intergenic
1088733912 11:112709560-112709582 GGTGGGGTGGTAGGAGTAGCGGG - Intergenic
1089085276 11:115811850-115811872 GCTGAGGTGGAAGGATGGATTGG + Intergenic
1089123382 11:116158562-116158584 GGGGAGCAGGTAGGAGGTACAGG - Intergenic
1089139447 11:116274351-116274373 GGAGAGGTGGGAGGTGGGTCTGG - Intergenic
1089514967 11:119026581-119026603 GGTGAGCGGGCAGAAGGGACAGG - Exonic
1090085678 11:123648849-123648871 GATGAAGTAGTAGGAGGGATGGG + Intronic
1090202009 11:124864016-124864038 GGGGAGGGGGTAGGTGGGAGTGG - Intergenic
1091091409 11:132774694-132774716 GGTGAGGTTGCAAGGGGGACAGG - Intronic
1091216083 11:133903034-133903056 GGGGAGGTGGTGGGAGGGGCAGG - Intergenic
1091798459 12:3310276-3310298 AGGGAAGTGGTGGGAGGGACAGG + Intergenic
1091818828 12:3459283-3459305 GGGGAGGTGGGAAGGGGGACAGG - Intronic
1091966361 12:4745720-4745742 GGTGACGTGGAAGGAGGGGAGGG + Intronic
1092342097 12:7685549-7685571 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1092677361 12:10936125-10936147 GGCGGGGTGGTGGGAGGGATAGG - Intronic
1092744311 12:11659373-11659395 TGCATGGTGGTAGGAGGGACAGG - Intronic
1092915296 12:13183951-13183973 GGTGAGGTGGAAGGATGAAATGG + Intergenic
1092997231 12:13961891-13961913 AGAGAGGTGGTGGGAGGGTCTGG + Intronic
1093203931 12:16224042-16224064 GGGGAGGTGAGAGGAGGGAAGGG + Intronic
1093637510 12:21489000-21489022 GGTGAGTAGGCAGAAGGGACAGG - Intronic
1096176367 12:49522853-49522875 GGTGAGATGGTGAGAGGGTCTGG + Exonic
1096616871 12:52838264-52838286 GGTGGGGTGCCAGGAGGGGCTGG - Intronic
1096765463 12:53885110-53885132 GGTGTGGTGGTGGGTGGGAGTGG + Intergenic
1096829724 12:54304641-54304663 GGGGAGGTGGTAGAGGGGTCTGG + Intronic
1096834545 12:54341205-54341227 GGTGACATGGTATGAGGGAAGGG - Intronic
1097012788 12:55965383-55965405 GGTGGGGTGGTGAGAGGGTCTGG - Intronic
1097108005 12:56636382-56636404 GGTGGGGAGGGAGGAGGGAAGGG + Intronic
1097502465 12:60422218-60422240 GATGAGATGGAAGGAGGGAAGGG - Intergenic
1097872123 12:64610464-64610486 GGGGAGGCGGCAGGAGGGGCCGG + Intergenic
1098677413 12:73307523-73307545 TATGAGGTGGTAGGAAGGAAAGG - Intergenic
1098791803 12:74833583-74833605 GGGGGGGTGGGAGGAGGGAGAGG + Intergenic
1099860230 12:88217394-88217416 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1100775611 12:97970315-97970337 TGGAAGGTGGTAGGAGGGAGAGG - Intergenic
1100843656 12:98638379-98638401 GCTGAGGGGGTAGGATGGATTGG - Intronic
1101892661 12:108731026-108731048 GGCGAGGTGCTGGGAGGGAAGGG - Intronic
1102218740 12:111180097-111180119 GGTGAGGTGGGGGGAGGGTGGGG - Intronic
1102664817 12:114562936-114562958 GGAGAAGTGGTAGGAGGCAGAGG - Intergenic
1102931282 12:116864256-116864278 GGTGGGATGGAAGGAGAGACAGG + Intronic
1102999569 12:117375098-117375120 GGTGAGCAGGGAGGAGGGAGAGG + Intronic
1103536583 12:121637704-121637726 GGGGAGGTGGCAGGAGACACTGG + Intronic
1103866849 12:124059439-124059461 TGTAGGGTGGGAGGAGGGACAGG - Intronic
1104990287 12:132620657-132620679 GGTCAGGAGGGAGGAGGGACTGG - Intronic
1106605722 13:31226531-31226553 GCTGAGCTGGTAGGAGTGGCAGG + Intronic
1107084917 13:36416431-36416453 CGTGGGGTGGGAGGAGGGAGAGG + Intergenic
1110726005 13:78824676-78824698 GTGGAGGTGGAAGGAGGGAGAGG - Intergenic
1110910512 13:80956068-80956090 TGGGAGGTGGGAGGAGGGAGAGG + Intergenic
1111330327 13:86757566-86757588 GGAGAGGGGGTAGGGGGCACAGG + Intergenic
1111478233 13:88783310-88783332 GGTGAAGTGTGAGGAGGGAGAGG - Intergenic
1111525359 13:89461270-89461292 TGTGAGATGGGAGGAGGGATAGG + Intergenic
1111532799 13:89561490-89561512 GTGGAGGTGGGAGGAGGGAGAGG + Intergenic
1112394700 13:99018951-99018973 GGTGAGATGGTAGGAGAGTCAGG - Intronic
1113218275 13:108068959-108068981 GGTGAGGGGGTTGGGGGGAGGGG - Intergenic
1113218990 13:108076371-108076393 GGTGGGGTGGAAGGAGCGAGCGG - Intergenic
1113814486 13:113161784-113161806 TGTGAGGAGGTGGCAGGGACGGG - Intronic
1113814758 13:113162624-113162646 TGTGAGGAGGTGGCAGGGACGGG - Intronic
1114547708 14:23514436-23514458 GCTGGGGTGGAAGGAGGGAAGGG + Intergenic
1117131558 14:52692437-52692459 GCAGATGTGGTAAGAGGGACAGG + Intronic
1118567998 14:67163890-67163912 GGTGGGGTGGAAGGAGTGAGTGG - Intronic
1119332997 14:73809473-73809495 TGGGTGGTGGTGGGAGGGACGGG - Intergenic
1119725615 14:76920350-76920372 GGGGAGCTGGGAGGAGGGACAGG - Intergenic
1119768612 14:77206225-77206247 GGTGGGGAGGTGGGAGGGGCAGG + Intronic
1121113994 14:91331010-91331032 GAGGAAGTGGTAGGAGGGGCTGG + Intronic
1122305405 14:100762975-100762997 GGTGAGGTGGGTGGGGGGACGGG + Intergenic
1122307873 14:100776948-100776970 TGTGTGGGGGTAGGACGGACGGG + Intergenic
1122506508 14:102235107-102235129 GGTGGGGTGGTTGGAGAGAAGGG - Intronic
1122815643 14:104310800-104310822 GGTGGGGTGGTTGAAGGGAGAGG + Intergenic
1122857308 14:104566035-104566057 GGTCAGGCGGTGGCAGGGACAGG - Intronic
1122907000 14:104806200-104806222 GGGGAGGTGGCAGAAGGGAAGGG - Intergenic
1122949472 14:105033722-105033744 GGTGAAGGGGAAGGAGGAACAGG - Intergenic
1124022826 15:25939598-25939620 GGTGGGGCGGAAGGAGGGACAGG + Intergenic
1124902320 15:33835875-33835897 GGTGAGGAGGTGGCAGGGCCAGG - Intronic
1126443875 15:48720232-48720254 AGTGAGGTCGTAGGAAGGAGAGG + Intronic
1127113312 15:55698092-55698114 GCAGAGCTGGTAGGAGGGATGGG - Intronic
1127118990 15:55754920-55754942 GGTGATGTGGCAGCAGGGAAAGG + Intergenic
1127457915 15:59171533-59171555 GGTGAGGTGGACTGGGGGACAGG + Intronic
1127771565 15:62235404-62235426 GTTGGGGTGGGAGGAGGGAGAGG + Intergenic
1128084322 15:64875503-64875525 GGTGAGGTGGGAGAGGGGAGCGG + Intronic
1128084967 15:64879530-64879552 GGTGAGGAGGGAGGAGAGATGGG + Intronic
1128242303 15:66109271-66109293 CGTGAGGTGGTATCAGGGAGTGG - Intronic
1128249698 15:66155663-66155685 GGAGAGGTTGAAAGAGGGACAGG - Intronic
1129412837 15:75359371-75359393 AGTGAGGTGGGGGGAGGAACAGG + Exonic
1129413655 15:75362905-75362927 AGCGAGGTGGGAGGAGGGGCTGG + Intronic
1130032506 15:80328622-80328644 GTTGAGGTGGTGGGAGGGAGAGG - Intergenic
1130158019 15:81370063-81370085 GGTGTGGAGGTAGCAGGGAGGGG + Intronic
1130233620 15:82114712-82114734 GGTTTGGTGGCAGGAGGGACTGG - Intergenic
1130484672 15:84392093-84392115 GGAGGGGTGGCAGGAGGAACAGG + Intergenic
1130545959 15:84857839-84857861 GGTGAGGCGGCGGGAGGTACAGG - Exonic
1130933727 15:88451008-88451030 GGACTGGTGGTAGGGGGGACAGG + Intergenic
1131042361 15:89282389-89282411 GAAGAGATGTTAGGAGGGACTGG - Intronic
1131568920 15:93512675-93512697 GTGGTGGTGGTAGTAGGGACTGG + Intergenic
1132142706 15:99408341-99408363 GCTGAGTTGGTTGGAGGGAGAGG + Intergenic
1132302923 15:100787664-100787686 GGTGTGGTGCTGGGAGGGACAGG - Intergenic
1132497230 16:269608-269630 GGTGAGGAGGCAGAAGGGTCAGG - Intronic
1132933177 16:2468922-2468944 GGAGAGGTGGGAGGTGGGAGAGG + Intergenic
1133386972 16:5377538-5377560 GGTGAGGGAGGAGGAGGGAAAGG + Intergenic
1133500050 16:6357290-6357312 GGTGAGGTTGAGGGAGAGACTGG + Intronic
1133652419 16:7825106-7825128 TGAGAGGTGGGAGGAGGGAGAGG + Intergenic
1133924515 16:10182341-10182363 GGGGAGGTGGTAGGGGGTGCGGG - Intronic
1136043786 16:27600200-27600222 GGTGAGGAGGGAGGAGGGAAAGG + Intronic
1136500184 16:30666253-30666275 GGTGAGGGGGCAGGCAGGACAGG - Intronic
1136684614 16:31986806-31986828 GGAGGGGTGTTAGGGGGGACAGG - Intergenic
1136785238 16:32930342-32930364 GGAGGGGTGTTAGGGGGGACAGG - Intergenic
1136884544 16:33923462-33923484 GGAGGGGTGTTAGGGGGGACAGG + Intergenic
1137246252 16:46708004-46708026 GGGGAGGGGGTAGGGGGGTCAGG + Intronic
1137548634 16:49421499-49421521 GGGGAAGGGGTAGGAGGGAGAGG + Intergenic
1137719151 16:50617619-50617641 GCTGTGGTGTGAGGAGGGACAGG + Intronic
1138143606 16:54588983-54589005 GCTGAGGTGGGAGGATGGATTGG - Intergenic
1138848787 16:60600689-60600711 GTGGAGGTGGAAGGAGGGAGAGG - Intergenic
1138984766 16:62314844-62314866 TGTGGGGTGGGAGGAGGGAGAGG + Intergenic
1139430963 16:66910855-66910877 GGGGAGGTGGCAGGAGGACCAGG - Intronic
1139658571 16:68404559-68404581 GGTGGGGTGTGAGGAGGGGCTGG + Intronic
1139670697 16:68491020-68491042 GGAGGGGTGGTGGGAGGGATGGG + Intergenic
1140087403 16:71809202-71809224 GGTGAGGGGGTAGGGGGGTGGGG + Intergenic
1140263939 16:73404181-73404203 GTTGAGGGGGTGGGAGGGGCTGG - Intergenic
1140315333 16:73891017-73891039 GGTGAGGTGGAGGGGGGGAGCGG - Intergenic
1140920622 16:79534298-79534320 GGTGAGGTAGAAGGAGACACAGG - Intergenic
1141432468 16:83977525-83977547 GGTGAGGCGATGGGTGGGACTGG + Intronic
1141566958 16:84909080-84909102 GGAGAGGTGGTGCTAGGGACAGG - Exonic
1141613756 16:85198529-85198551 GGTGATGTGCTGGGAGGGTCGGG + Intergenic
1141713901 16:85716237-85716259 GGAGAGGGGGTTGGAGGGAGAGG + Intronic
1141787459 16:86211326-86211348 GGTGAGGGGCTTGGAGGGATAGG + Intergenic
1141895890 16:86958658-86958680 GGGGAGGTGGAGGGAAGGACAGG - Intergenic
1142248859 16:88982053-88982075 GCTGAGGTGGTGAGCGGGACCGG - Intergenic
1142401986 16:89863715-89863737 CCTGAGGGGGTAGCAGGGACAGG + Intronic
1203087896 16_KI270728v1_random:1194351-1194373 GGAGGGGTGTTAGGGGGGACAGG - Intergenic
1142642506 17:1292547-1292569 ACTGAGGAGGTAGGAGGGACTGG - Intronic
1142864116 17:2779942-2779964 GATGAGGTGGCAGGAAGGAAGGG + Intronic
1143145362 17:4771900-4771922 GGTGAGGTGTCAGGAAGGACAGG - Exonic
1143284581 17:5779727-5779749 GGTGAGGAGTAAAGAGGGACAGG + Intronic
1143449113 17:7025123-7025145 TGTGAGGAGGTAGGGGGTACTGG - Exonic
1144143672 17:12376365-12376387 GGTGAAGGGGGAGGAGGGAGGGG + Intergenic
1144413593 17:15024368-15024390 GGTGAGGTAGGGGGTGGGACTGG - Intergenic
1144738944 17:17570529-17570551 GGTGAGGAGGCATGAGGGAGGGG + Intronic
1144754386 17:17670389-17670411 GGGGAGGAGGTGGGAGGAACAGG + Intergenic
1145009386 17:19359063-19359085 AGTGGGGTGGTGGGAGGGGCTGG - Intronic
1146076208 17:29731909-29731931 GGTGAGGGGGTTGGAGGGACAGG - Intronic
1146750205 17:35372311-35372333 GGAAGGGTGGTAGGAGGGAAGGG + Intronic
1146770369 17:35563152-35563174 CCTGAGGTGGGAGGAGGGAGAGG + Intergenic
1146913269 17:36661494-36661516 GGTGAGCAGCCAGGAGGGACCGG + Intergenic
1146996151 17:37322849-37322871 GGGGAGCTGGAAGGAGGGGCTGG - Intronic
1147145549 17:38482487-38482509 GGAGGGGTGTTAGGGGGGACAGG - Intronic
1147504427 17:41001483-41001505 TGGAAGGTGGGAGGAGGGACAGG + Intergenic
1147579416 17:41619847-41619869 AGGGAGGTGGTGGCAGGGACAGG - Intronic
1148024431 17:44576485-44576507 GCTGAGGTGGGAGGATGGCCTGG + Intergenic
1148235182 17:45964007-45964029 GGTGAGGAGGTGAGAGGGACCGG + Intronic
1148685305 17:49497399-49497421 GGAGAGCGGGGAGGAGGGACCGG + Intronic
1149993118 17:61393726-61393748 GGTGCCCTGGCAGGAGGGACTGG - Intergenic
1150477995 17:65488624-65488646 GGAGAGGGGGAAGGAGGGAGAGG + Intergenic
1151408651 17:73906179-73906201 GGGGAGGTGGTAGGAGGCAGTGG + Intergenic
1151460206 17:74249808-74249830 GGTGGGGGGGTGGGAGGGGCAGG + Intronic
1151604609 17:75128618-75128640 GGGGAGGTGGGAGGAGGCCCGGG + Intronic
1151712166 17:75813153-75813175 GCTGTTGTGGTAGTAGGGACAGG - Exonic
1152013736 17:77736049-77736071 GGGGAGGTGGCAGGAGGAAAAGG + Intergenic
1152147600 17:78577533-78577555 GGGGAGGTTGGAGGGGGGACAGG + Intergenic
1152149489 17:78590029-78590051 GGGGAGATGGCAGGAGGGACAGG - Intergenic
1152202251 17:78953971-78953993 GATGAGTGGGTGGGAGGGACGGG + Intergenic
1152497891 17:80687274-80687296 GGTGTGGTGGGAGGAGAGACAGG - Intronic
1152510007 17:80780318-80780340 GTTCAGTTGGTAGGAGGGAGGGG + Intronic
1152589726 17:81205489-81205511 GGAGGGGAGGTAGGAGGGGCAGG + Intronic
1152710208 17:81867593-81867615 GGTGGGGTGGTGGGAGGGGAAGG - Intergenic
1153737521 18:8086607-8086629 GGTGGGGTGGAAGTAGGGAAAGG + Intronic
1154018894 18:10645210-10645232 GGTGAGGAAGGAAGAGGGACAGG - Intergenic
1154066262 18:11110215-11110237 GCTGAGGTGGAAGGATGGCCAGG - Intronic
1154170709 18:12048202-12048224 GGTGTGGGGGTTGGGGGGACTGG - Intergenic
1154185336 18:12178213-12178235 GGTGAGGAAGGAAGAGGGACAGG + Intergenic
1154488689 18:14902170-14902192 GGGGAGGGGGTGGCAGGGACCGG - Intergenic
1155065746 18:22267527-22267549 TGTGATGTGGGAGGAGGCACTGG - Intergenic
1155556138 18:27021177-27021199 GGTGAGAGGGTAGGAGGGTCAGG + Intronic
1155567002 18:27146422-27146444 GGTGAGGTGGTAGGAGCAGCAGG + Intronic
1157339927 18:46769712-46769734 GGTGAGGTGGAGGGAAAGACGGG - Intergenic
1157627031 18:49059653-49059675 AGTGTGGTGGTATGAGGGAGGGG + Intronic
1158406586 18:57165440-57165462 GGTGAGGTGGGGGGAGGAATGGG - Intergenic
1158610469 18:58935393-58935415 GGAGAGGGGGGAGGAGGGAGAGG - Intronic
1158733147 18:60048321-60048343 GGAGAGTTGGGAGGAGGGAGAGG - Intergenic
1159365751 18:67464177-67464199 GGTGTGGTGGAAAGATGGACAGG + Intergenic
1159468079 18:68811755-68811777 GGTGAGATGGCAGGAATGACAGG + Intronic
1159798563 18:72869508-72869530 GGTGTGGTGGTAGGAGGCTTGGG - Intergenic
1160057399 18:75496411-75496433 GGAGAGCTGGGAGGAGGGAGAGG - Intergenic
1160682466 19:418087-418109 GGTGTGGACGGAGGAGGGACAGG - Intronic
1160723522 19:607763-607785 AGTGAGTTGGCAGGAGGGCCAGG - Intronic
1160795798 19:944946-944968 GGCGACGTGGTGGAAGGGACGGG - Intronic
1160969153 19:1759768-1759790 GGAGAGGGGGTATGAGGGGCTGG + Intronic
1160990056 19:1856810-1856832 GGGGAGGCGGCAGGAGGGAAGGG + Intronic
1161330956 19:3687670-3687692 GGTGAGGTGGCTGGAGGGGAGGG + Intronic
1161358247 19:3831676-3831698 GGTGGGGTTGTAGGAGGGCGGGG + Exonic
1161399307 19:4060340-4060362 GGTTAGATGGGAGGTGGGACCGG - Intronic
1161490038 19:4556644-4556666 GGGGTGGTGGTAGGACTGACAGG + Intronic
1161778815 19:6278500-6278522 AATGAGGTGGAAGGAGGGAGAGG + Intronic
1161817634 19:6509629-6509651 GGGGAGGTGGAAGGAGGGGCCGG - Intergenic
1161957633 19:7505456-7505478 GCTGCGGTGGGAGGCGGGACGGG - Intronic
1161989517 19:7676762-7676784 GGAGAGGAGGTAGGAGGGTGAGG + Exonic
1162129547 19:8517616-8517638 GGTGAGGTGGCAGAAGGGACAGG + Intergenic
1162568770 19:11458615-11458637 GGTGAGGGGGTCAGATGGACAGG + Intronic
1162816537 19:13198746-13198768 GGAGAGGTAGTAGGCGTGACGGG + Intergenic
1162967598 19:14163426-14163448 GGGGAGGAGGTAGGAGAGAAGGG + Intronic
1163333116 19:16654166-16654188 GCTGAGGTGGCAGTAGGGATGGG - Intronic
1163566139 19:18052296-18052318 GGGGAGGAGGGGGGAGGGACAGG + Intergenic
1163566551 19:18055221-18055243 GGGGAGGTGGGAAGAGGGGCAGG + Intergenic
1163608176 19:18287152-18287174 GGTGGGGAGGCAGGTGGGACTGG + Intergenic
1163779545 19:19239365-19239387 GATGGGGAGGTAGGAGGGAAAGG - Intronic
1163788112 19:19287908-19287930 GAAGAGGTGGAAGGAGAGACAGG - Intronic
1165112632 19:33511193-33511215 CATGAGGTGCAAGGAGGGACCGG + Intronic
1165145222 19:33726172-33726194 GGTGTGGTGGTAGATGGGGCAGG + Intronic
1165445519 19:35855139-35855161 GGGGAGGTGGGAGGAGGGCAAGG - Intronic
1165745127 19:38226235-38226257 GGTGAGACGGGAGGGGGGACGGG - Intronic
1165771963 19:38385399-38385421 GGTGAGAGGGGAGAAGGGACAGG - Exonic
1166061478 19:40328378-40328400 GGGCAGGTGGTAGGAGGAGCTGG - Intronic
1166360622 19:42251534-42251556 GGAGGGGTGGGAGGAGGGAAAGG + Intronic
1167131906 19:47592389-47592411 GCTGAGATGGTCTGAGGGACAGG - Intergenic
1167272954 19:48516751-48516773 GGGGAGGTGGTGGGCGGGGCAGG - Intergenic
1167403147 19:49286411-49286433 GGTGGGGAGGTAGGTGGGAGGGG + Intergenic
1168099600 19:54134089-54134111 GGGGAGGTGGAGGGAGGGAGAGG - Intergenic
1168251593 19:55145374-55145396 GGAGAGGAGGGAGGAGGGAAAGG + Intronic
1168337884 19:55606467-55606489 GGTGGGGTGAGAGGAGGTACGGG - Intronic
1168719854 19:58548934-58548956 GGTGAGGTGGATGGAGGGTGGGG + Intronic
925064588 2:920512-920534 GGACAGGTGGCAGGAGGAACAGG - Intergenic
925425915 2:3748486-3748508 GGGGAAGTGGGAGGAGGAACAGG + Intronic
925755429 2:7128154-7128176 GGGGAGGGGGGAGGAGGGAAAGG - Intergenic
925755452 2:7128195-7128217 GGGGAGGGGGGAGGAGGGAAAGG - Intergenic
925755482 2:7128249-7128271 GGGGAGGGGGGAGGAGGGAAAGG - Intergenic
927004800 2:18836857-18836879 GGTGAGGTGGTGGCAGGGGGTGG - Intergenic
927306685 2:21581733-21581755 AGTGAGGGGGTGGGAGGGAAAGG + Intergenic
927345277 2:22031463-22031485 AGTGAAGTGTTAGGAGGAACAGG - Intergenic
927641353 2:24847655-24847677 GGTGAAGTGCTGGGTGGGACAGG + Intronic
927894708 2:26774333-26774355 AGACAGGAGGTAGGAGGGACAGG - Intronic
927993573 2:27465702-27465724 AGTGAGGTGGTGGGAGAGTCTGG - Intronic
928021177 2:27706275-27706297 GGTGGGGAGGTGGGAGGGGCTGG + Exonic
928194610 2:29206226-29206248 GGAGAGGAGGTAGAAGGGAGGGG - Intronic
928224022 2:29432051-29432073 GTTGAGGTGGTAGCAGGGCAGGG - Intronic
928343970 2:30472816-30472838 GGGGGGCAGGTAGGAGGGACTGG - Intronic
928379086 2:30802730-30802752 GGGGAGATGGTGGGAAGGACAGG + Intronic
928387569 2:30883371-30883393 GGAGAGGTGGTGGGTGGTACCGG - Intergenic
928753879 2:34500956-34500978 GGTGAGGTGGTAGGTAGGATGGG + Intergenic
929121358 2:38486698-38486720 TGTGTGGTGGTGGTAGGGACTGG - Intergenic
929171509 2:38937310-38937332 GGTGGGGTGGGGGGAGGGGCGGG - Intronic
929819633 2:45262793-45262815 GGTGAGCTGGGAGGAGGCAGAGG - Intergenic
930333543 2:50016978-50017000 TGTGAGGTGGCAGGATGGATGGG - Intronic
930470828 2:51810402-51810424 AGTGAGGTGAAAGGAGGCACCGG - Intergenic
930935703 2:56948606-56948628 TGGGAGGTGGGAGGAGGGAAAGG - Intergenic
931214198 2:60226200-60226222 GCTCAGGTGGTAGGAAGGCCAGG + Intergenic
931589858 2:63871194-63871216 GGAGAGGGGGTAGAAGGGAATGG - Intronic
931972167 2:67600723-67600745 AGTGAGGTAGGAGGCGGGACTGG - Intergenic
932435944 2:71702578-71702600 GAGGAGGTGGCAGGAGGGTCGGG + Intergenic
932558132 2:72843471-72843493 GGTGAGATGGTAGAAAGGAATGG - Intergenic
932581451 2:72994997-72995019 GGTGTGGTGGGAGCAGGGAGGGG - Intronic
932948267 2:76262599-76262621 GGTGAGGTGGGAGGTGGGCAGGG + Intergenic
933691433 2:85182066-85182088 GGGGAGGAGGCAGGATGGACGGG + Intronic
933815996 2:86069305-86069327 GGTGAGGGTGAAGGAGGCACTGG + Intronic
934902196 2:98168888-98168910 GGGGAGGAAGTAGAAGGGACAGG + Intronic
935037351 2:99391555-99391577 GGTCAGGGGGTAGGAGGGGAAGG - Intronic
935051293 2:99527155-99527177 GGTTAGGTGGAAGGATGAACAGG + Intergenic
936058792 2:109281187-109281209 GCTGGGGTCGCAGGAGGGACAGG - Intronic
936938334 2:117859146-117859168 AGAGAGGTGGTAGGAGGGACTGG + Intergenic
937283730 2:120736975-120736997 AGTGAGGTGGAAGGGGGAACCGG - Intronic
937882697 2:126880443-126880465 GGTGAGGTGGGAGGTGGGCAAGG + Intergenic
939121707 2:138125171-138125193 GGGGTGGTGGTCGGGGGGACGGG + Intergenic
939871208 2:147527812-147527834 GGTGAGGTGGTGAGAGTGGCGGG - Intergenic
939969718 2:148645197-148645219 GGGGAGGGGGGAGGAGGGAAGGG - Intronic
941199103 2:162487473-162487495 GGTGAGTGGGGAGGAGGGAGAGG + Intronic
941211965 2:162651352-162651374 GGTGGGGTGGGAGGAGGGAGAGG - Intronic
941885508 2:170523454-170523476 GGTGGGGTGGGAGTAGGGAGGGG + Intronic
941890810 2:170579610-170579632 GAGGAAGTGGTAGGAGTGACTGG - Intronic
942250767 2:174046076-174046098 GCTGAGGTGGAAGGTGGGAGTGG + Intergenic
943171691 2:184408856-184408878 GGTGAGGTGGTGGGAGGGGGTGG + Intergenic
943782319 2:191838031-191838053 GGAGAGGTGGCAGGGGGGTCTGG - Intronic
944357496 2:198808911-198808933 GGTGTTGTGGTAGAAGGGAGAGG - Intergenic
944420356 2:199523604-199523626 TGGAAGGTGGCAGGAGGGACAGG - Intergenic
945263048 2:207862721-207862743 GGTGAGTAGGTAGTAGTGACTGG + Intronic
945272195 2:207952292-207952314 GGAGGGATGGAAGGAGGGACAGG - Intronic
945986997 2:216363003-216363025 GGAGAGGAGGTTGGAGGGAGAGG - Intronic
946201053 2:218070979-218071001 GGTTAGGTGTCAGGAGGGAGAGG - Intronic
946276291 2:218634221-218634243 GGTGAGGAGGCAGCAGGGACTGG + Exonic
946333142 2:219021727-219021749 GGGGAGGTGGGAGGAGGTACTGG - Intronic
946414096 2:219530782-219530804 GGGGAGGTGGTGGGAGAGGCAGG + Intronic
946651423 2:221895898-221895920 GGTGGAGTGGTAGGAGGGCCAGG - Intergenic
947549048 2:231033458-231033480 GCTGAGGTGGGAAGAGGGGCTGG - Intergenic
947565120 2:231188793-231188815 GGTGAGGTGGCAAGAGGAGCAGG - Intergenic
947828657 2:233123964-233123986 GAGGGGGTGGGAGGAGGGACAGG + Intronic
947874167 2:233457572-233457594 TGTGACGTGGAAGGAGGGTCAGG + Intronic
948188533 2:236040849-236040871 TGTGCGGTGGTAGCAGGGGCTGG + Intronic
948601613 2:239110903-239110925 GCTGAGGAGGCAGGAGGGGCCGG - Intronic
1168904095 20:1390354-1390376 GGGGAGGGGGGAGGGGGGACGGG + Intronic
1169725430 20:8724064-8724086 GTGGAGGTGGGAGGAGGGAGAGG + Intronic
1170760462 20:19244576-19244598 GGTGAGGTGGGAGAAGGCAGCGG + Intronic
1171011959 20:21513757-21513779 GGGGAGTTGGGGGGAGGGACTGG + Exonic
1171074165 20:22105063-22105085 GGTGAGGTGGAGGGTGGGATGGG + Intergenic
1172064831 20:32211865-32211887 GGTTAGATTGTAGCAGGGACAGG - Intronic
1172174408 20:32963432-32963454 GGGGAGGTGGTATGAGGGGAAGG - Intergenic
1172181436 20:33006246-33006268 GGTGAGGGCGCAGGAGGGGCCGG + Intergenic
1172768602 20:37364048-37364070 GGAGAGGTGGGAGGCGGGGCAGG - Intronic
1172806894 20:37618491-37618513 GGTGAGGTGGGAGGAGCACCAGG + Intergenic
1173347499 20:42214433-42214455 GGTGATGGGGCAGGAGGGAAAGG - Intronic
1173922677 20:46758002-46758024 GGAAAGGAGTTAGGAGGGACAGG + Intergenic
1173931662 20:46825877-46825899 GGGAAGATGGGAGGAGGGACAGG + Intergenic
1174362760 20:50039048-50039070 GGTGGGGTGGGATGAGGGAGTGG + Intergenic
1174403461 20:50288821-50288843 GCAGAGGTGGGAGAAGGGACTGG + Intergenic
1174845701 20:53941125-53941147 TGTGAAGTGGGAGGAGGGAGGGG + Intronic
1175224881 20:57439232-57439254 GGTCAGGGGGTAGGAGGGTGGGG - Intergenic
1175275198 20:57763700-57763722 GCTGAGGTGGAAGGAGAGGCTGG + Intergenic
1175282148 20:57811083-57811105 GGTGAGCTGGTAGGAGGGACAGG + Intergenic
1175615258 20:60392987-60393009 GATGAGGTGCTACGTGGGACAGG - Intergenic
1175722682 20:61296840-61296862 CGTCAGGTGGAAGGAGGGACGGG + Intronic
1175746963 20:61463807-61463829 GGTGAGCTGGCAGAAAGGACAGG + Intronic
1175893859 20:62327473-62327495 GGGGAGGTCTTAGGTGGGACTGG - Intronic
1175946078 20:62559368-62559390 GCTGATGTGGGAGGAGGGCCGGG - Intronic
1176022650 20:62970065-62970087 GCTGAGGTGGGAGGATCGACTGG - Intergenic
1176138576 20:63535737-63535759 GGCCAGGTGGTTGGAGGGGCAGG - Intronic
1176350858 21:5795383-5795405 GGTGAGGAAGTAGGAGGGGACGG - Intergenic
1176357672 21:5915967-5915989 GGTGAGGAAGTAGGAGGGGACGG - Intergenic
1176512928 21:7762177-7762199 GGAAAGGTGGGAGGAGGGGCAGG + Intronic
1176545179 21:8193453-8193475 GGTGAGGAAGTAGGAGGGGACGG - Intergenic
1176564130 21:8376498-8376520 GGTGAGGAAGTAGGAGGGGACGG - Intergenic
1176668316 21:9707984-9708006 GGGGAGGTGGGAAGAGGGAGAGG + Intergenic
1177679149 21:24341439-24341461 GGGGAGGTGGGATGAGGGAGAGG + Intergenic
1178282929 21:31299306-31299328 GGTGACGTGGTAGCATGGCCAGG - Intronic
1178482171 21:32989165-32989187 GGGGAGGTGGGAGGAGGCAGAGG - Intergenic
1178647041 21:34392701-34392723 GGAAAGGTGGGAGGAGGGGCAGG + Intronic
1180059745 21:45378761-45378783 GGTGAGGTGCTGGGAGGGCAGGG - Intergenic
1180094765 21:45550888-45550910 GGGGCGGTGGTGGGAGGGAAGGG - Intergenic
1180170317 21:46055033-46055055 TGTGAGGTGGAGGGAGGGAGGGG - Intergenic
1180198067 21:46209118-46209140 GCTGATCTGGCAGGAGGGACCGG + Intronic
1181040052 22:20187873-20187895 CGTGAGATGGAAGGAGGGCCTGG - Intergenic
1181312878 22:21954947-21954969 GGTGAGGTGGTGCGTGGGGCAGG + Intergenic
1181345986 22:22221019-22221041 GGTGAGGTGGTGCGTGGGGCAGG + Intergenic
1181643768 22:24219466-24219488 GGTGAGGTGTTGGGAGGCAGAGG + Intergenic
1181745026 22:24950301-24950323 GGTGAGGTTGGGGGAGGGAGGGG + Intergenic
1182098030 22:27638930-27638952 GGGGAGGTGGGATGAGGGAAGGG + Intergenic
1182243175 22:28933779-28933801 GGGGAGGAGGGAGGAGGGAGGGG - Intronic
1182313273 22:29424821-29424843 GGGGGGGGGGTGGGAGGGACAGG - Intergenic
1182658098 22:31905635-31905657 GGGAACATGGTAGGAGGGACGGG + Intronic
1183107827 22:35627536-35627558 GGTGAGGTGGTGCCAGGGAGCGG + Intronic
1183279764 22:36925728-36925750 GGTGAGGAGGGAGGAAGGGCTGG - Intronic
1183499717 22:38171443-38171465 GCTGAGGTGGAAGGAGGTAGAGG - Intronic
1183568563 22:38634699-38634721 GGAGAGGCAGTAGGAGGGACAGG - Intronic
1184088467 22:42280013-42280035 GGTGAGTTACTAGCAGGGACAGG + Intronic
1184394335 22:44223990-44224012 GGCAAGGTGGTAGCAGGGAAGGG - Intergenic
1184502016 22:44880069-44880091 GATGGGGAGGTGGGAGGGACTGG + Intergenic
1184655641 22:45940731-45940753 GGTAGGGTGGCTGGAGGGACTGG + Intronic
1184727397 22:46354981-46355003 GCTGAGGAGAAAGGAGGGACTGG - Intronic
1184852297 22:47127956-47127978 GGTGGGGTGGAGGGAAGGACGGG - Intronic
1203250049 22_KI270733v1_random:109691-109713 GGTGAGGAAGTAGGAGGGGACGG - Intergenic
949193399 3:1276962-1276984 GGTGTGGTGGTAGGTGGATCAGG + Intronic
949433112 3:3999699-3999721 GGAAAGGTGGGAGGAGGGAGAGG + Intronic
949534704 3:4986865-4986887 GGAGAGGTGGCAGGAGGCAGGGG + Intergenic
949682618 3:6532170-6532192 AGTAAGGTGGTAGGAGCTACTGG + Intergenic
950004509 3:9682988-9683010 GGAGAGGTGGTAGGAGCTGCTGG + Intronic
950121373 3:10484367-10484389 GGTGAGATTCTAGAAGGGACAGG + Intronic
950186112 3:10946581-10946603 GGTGAGGTGGGAGAGGTGACCGG + Intergenic
950421463 3:12902019-12902041 GGGGAGGTGGTGACAGGGACAGG + Intronic
950533005 3:13563858-13563880 GGCGGGGTGGTTGGAGGGGCAGG + Intronic
950611862 3:14132176-14132198 GGGGAGGTGGTGGGAGGAGCAGG + Intronic
950657365 3:14444939-14444961 GGTGAGGTGGTAAGGGGCAGAGG - Intronic
952538372 3:34338300-34338322 GCTGAGGAGGTAGGGTGGACAGG + Intergenic
953034060 3:39196518-39196540 GGGGAGGGGGTATGAGGGAAGGG + Intergenic
953342862 3:42150171-42150193 GGGGAGGTGATGGGAGGGGCAGG + Intronic
953878726 3:46680763-46680785 GTGGAGGTGGCAGGAAGGACAGG + Intronic
954873403 3:53784873-53784895 GGAGAGGTGGTATGAAGGATAGG + Intronic
955038090 3:55288562-55288584 GCTAAGATGGTAGGAGGAACTGG - Intergenic
955117637 3:56021709-56021731 GGGAAGGTGGGAGGAGGGAGAGG - Intronic
955924936 3:63995515-63995537 GGTGAGGTGGTACTGGGCACTGG - Exonic
956229549 3:66998407-66998429 GGTGAGGGGGAAGGTGGGCCGGG + Intronic
956337905 3:68185372-68185394 TGTAAGGAGGTAGAAGGGACTGG + Intronic
956358038 3:68415487-68415509 AGTGAGGAGGTTGGAGGGATGGG + Intronic
956854950 3:73266962-73266984 GGGGGGGTGGGAGGAGGGAGAGG + Intergenic
957086045 3:75678133-75678155 GGGAAGGTGGGAGGAGGGAGAGG - Intergenic
957763233 3:84587262-84587284 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
960054167 3:113264827-113264849 GGATAGAGGGTAGGAGGGACAGG + Intronic
960652771 3:119969915-119969937 CATGACCTGGTAGGAGGGACTGG - Intronic
960844719 3:121994985-121995007 GGTGGGGTGGAAGCAGGGAAGGG + Intronic
960986019 3:123281550-123281572 GGAGAGGTGGTAGGGGAGGCAGG - Intergenic
961448792 3:126993164-126993186 GGTGAGGAGGCAGGGGAGACAGG - Intronic
961523885 3:127484302-127484324 GGTGGAGTGGCAGGAGGGGCAGG + Intergenic
961991321 3:131195249-131195271 GGTGAGGTTGGAGGAGGGGTGGG - Intronic
962170232 3:133094206-133094228 GGTGGGGTGGGAGGTGGGAAGGG - Intronic
962356054 3:134695130-134695152 GGGTAGGAGGTGGGAGGGACTGG + Intronic
962683503 3:137823981-137824003 GGGGAGCTGGTAGCAAGGACAGG - Intergenic
963186592 3:142424718-142424740 GGGGAGTGGGTAGGAGGGAGAGG + Intronic
963837003 3:150067934-150067956 GGTGAGGAAGTAGCATGGACAGG + Intergenic
964480154 3:157131552-157131574 GGGGGGGTGGTTGGGGGGACAGG + Intergenic
964561429 3:158000791-158000813 TGTAAGGTGGGAGGAGGGAAAGG + Intergenic
965499461 3:169440544-169440566 GATGGGGTGGGAGGAGGGAGTGG + Intronic
966378719 3:179322976-179322998 GGTGAGGTGGGGGCAGGGAGCGG - Intronic
966744134 3:183259683-183259705 GGTGGGGTGGAAGGAAGGAGAGG - Intronic
966824379 3:183951671-183951693 TGTGAGGGGTCAGGAGGGACAGG + Intronic
966984573 3:185167472-185167494 ACTGAGGAGGTAGGAAGGACTGG + Intergenic
968053942 3:195676505-195676527 GGAGAGGCGGTAGGCGGGACAGG + Intergenic
968101949 3:195972642-195972664 GGAGAGGCGGTAGGCGGGACAGG - Intergenic
968441691 4:627659-627681 GGGGAGGAGGGAGGAGGGAACGG - Intronic
968578182 4:1377603-1377625 AGGCAGGTGGGAGGAGGGACGGG - Intronic
969444882 4:7239124-7239146 AGTGGGGAGGAAGGAGGGACAGG - Intronic
969533204 4:7740753-7740775 GGTGTGGTGTTGGGAGGGCCTGG - Exonic
969908004 4:10415565-10415587 GGTGAGATATTAGGAGAGACAGG + Intergenic
970579959 4:17466170-17466192 GCTGAGGTGGTGGGAGGCAGAGG - Intronic
972318117 4:37946694-37946716 GTTGTGGTGGCAGCAGGGACTGG + Intronic
972377190 4:38483622-38483644 TGGGAGGTGGGAGGAGGGAGAGG - Intergenic
972393991 4:38642105-38642127 GCTGAGGTGGTGAGAGGTACTGG - Intergenic
972475171 4:39443356-39443378 GGGGAGTAGGGAGGAGGGACAGG - Intronic
973188918 4:47365118-47365140 GGAGAGGTGGAAGGATGTACAGG - Intronic
973366024 4:49210269-49210291 GGTGAGGTGCTGGCAGGGATGGG + Intergenic
973532029 4:51843901-51843923 AGCGAGGTGGTGGGAGGGACTGG + Intronic
973721108 4:53724530-53724552 GGGGAGGAGGAAGGAGGGAGGGG - Intronic
973914095 4:55615770-55615792 GTGGAGGTGGGAGGAGGGAGAGG - Intronic
975647070 4:76555783-76555805 GGTGAGGTGGTAGGAGGGACAGG - Intronic
976199881 4:82567421-82567443 TGGCAGGTGGGAGGAGGGACAGG - Intergenic
976613399 4:87052413-87052435 GGTGTGGGGGGAGGAGGGAGCGG - Intronic
977700077 4:100011921-100011943 ATTGAGGTGGTAGGAGGGCAGGG - Intergenic
977821361 4:101475801-101475823 GGTGAGGTGGGAAGTGGGAGGGG + Intronic
980219972 4:129901734-129901756 GGTGGAGTGGAAGGAGGGAAAGG - Intergenic
982683089 4:158456225-158456247 GGGAAGGTGGGAGGAGGGAGAGG + Intronic
984380389 4:178985702-178985724 GGTGGGGTGGGAGGAAGGGCGGG - Intergenic
984628933 4:182039971-182039993 GGTGAGGCGATAGGAGGGGAGGG + Intergenic
984715385 4:182919678-182919700 GAGGAGGTGGAAGGAGGGGCAGG - Intergenic
984834971 4:184010998-184011020 GGTGAGATTTGAGGAGGGACAGG - Exonic
985074067 4:186195459-186195481 CGTGAAGTGGGAGGAGGGATGGG - Intronic
985367955 4:189253402-189253424 GGTAGGGTGGGAGGAGGGAAAGG + Intergenic
985406466 4:189643511-189643533 GGGGAGGTGGGAAGAGGGAGAGG - Intergenic
985623842 5:973324-973346 GGGGAGGTGGGAGGAGGGAGAGG + Intergenic
985660193 5:1153187-1153209 GCTGACGTGGGAGGAGGGACGGG + Intergenic
985794257 5:1950241-1950263 GGTGTGGAGGGAAGAGGGACCGG + Intergenic
985885364 5:2673302-2673324 GGTAAGGTGGTAGCAGGGGTAGG + Intergenic
986307927 5:6529233-6529255 GGTGGTGTGGTGGGAGGCACAGG - Intergenic
987394737 5:17412447-17412469 GGTGATGTGGTAGGACTGCCTGG - Intergenic
987551883 5:19393322-19393344 GGTGAAGTGATAGGTGGGAAAGG + Intergenic
989565021 5:42893648-42893670 GGTGAGGTGGTAAGAGCGTGGGG - Intergenic
990315251 5:54577357-54577379 GTTGAGGTGGGAGGAGGGGAGGG - Intergenic
990379723 5:55210927-55210949 GGGGAGGTGGTAAGAGGAAGGGG + Intergenic
990477542 5:56175693-56175715 GGGAAGGTGGTGGGAGGGACTGG - Intronic
990500839 5:56395633-56395655 GGAAAGGTGGGAGGAGGGAGAGG + Intergenic
991503389 5:67300145-67300167 GGAGGGATGGTAGGAGGGAAAGG - Intergenic
991659703 5:68938010-68938032 GGTGGGGTGGGAAGAGGGAAAGG - Intergenic
992066275 5:73113013-73113035 GGTGAGCTGGTAGGAGGTGTTGG + Intergenic
992997348 5:82346536-82346558 AGGGAGGTGGGAGGAGGGAGCGG - Intronic
993141020 5:84033602-84033624 GTTGAGGTGGGAGGATGGTCTGG + Intronic
993691959 5:91012861-91012883 GTGGAGGTGGGAGGAGGGAGAGG - Intronic
993904489 5:93607687-93607709 GGGGAGGTGGTAGGAGGGGATGG + Intergenic
993923517 5:93837119-93837141 GGTGGAGTGGGAGGAGGGAGAGG - Intronic
994869701 5:105331668-105331690 GGGGAGGAGGAAGGAGGGAGGGG + Intergenic
995582353 5:113615350-113615372 GGTGGGGTGGAAGGAAGGAAAGG + Intergenic
995857158 5:116605486-116605508 GGTGAGGAGGTTGGAGACACTGG + Intergenic
996038903 5:118788654-118788676 GGAGGAGTGGAAGGAGGGACAGG + Intergenic
996385418 5:122905251-122905273 TGGGAGGTGGGAGGAGGGAAGGG + Intronic
996444992 5:123537427-123537449 GGTGAGGGGGTGGGAGGGAGTGG + Intronic
996858266 5:128034647-128034669 GGTAAGGTGGGAGGAGAGAGAGG + Intergenic
996886012 5:128354325-128354347 GCTGAGGGGGTGGGAGGCACAGG + Intronic
997022474 5:130017436-130017458 GGTGTGGTGGTGGGATGGAGGGG + Intronic
997059791 5:130487835-130487857 GGTTAGGGGGTAGGGTGGACAGG - Intergenic
997943314 5:138178042-138178064 GGCGGGGTAGTAGGAGGGGCTGG - Intronic
998326011 5:141280419-141280441 GGTGGGGTGGTAGGGGAGAGGGG - Intergenic
998819683 5:146047448-146047470 GGTGGGGTGGGGAGAGGGACAGG + Intronic
998820951 5:146057337-146057359 GGAGAGGTGGAGGGAGGTACAGG - Intronic
998950530 5:147389214-147389236 GGTGATGTGGAAGTTGGGACGGG - Intergenic
999742688 5:154568554-154568576 GGTGGGAGGGGAGGAGGGACAGG + Intergenic
1000680420 5:164177122-164177144 TGGGAGGTGGGAGGAGGGAGAGG - Intergenic
1001246923 5:170111705-170111727 GGTGAGATGGAAGAAGGGAGGGG + Intergenic
1002042083 5:176521789-176521811 GGTGAGGTGGCAGAGGGGCCAGG - Intergenic
1002105032 5:176875819-176875841 GCTGAGCTGGTGGGAGGGGCAGG - Intronic
1003606471 6:7565832-7565854 GTGGAGGTGGAAGGAGGGAGAGG + Intronic
1004057310 6:12152747-12152769 GGAGAGGATGTAGGAGGGGCTGG - Intronic
1004335586 6:14761665-14761687 GGGAAGGTGGGAGGAGGGAGAGG + Intergenic
1004446671 6:15706542-15706564 GGGGAGGTGGAAGGAGAGGCAGG - Intergenic
1004495273 6:16157053-16157075 GGTGGGATGGCAGGTGGGACAGG - Intergenic
1004911616 6:20290952-20290974 GGTGGGGAGGCAGGAGGGAAGGG + Intergenic
1005024634 6:21450725-21450747 GCTGAGGTGGGAGGAAGGCCAGG - Intergenic
1005319779 6:24641930-24641952 GCTGAGGTGGGAGGAGGCAGAGG + Intronic
1006265251 6:32916252-32916274 GTGGAGGTGGGAGGAGGGAGAGG - Intergenic
1006315112 6:33286757-33286779 GGTGAGGTGTTAGGAGTCATAGG - Intronic
1007270065 6:40629544-40629566 AATAAGGTGGTAGGATGGACAGG - Intergenic
1007387196 6:41528061-41528083 GGGGAGGTGGAGGGAAGGACAGG - Intergenic
1007410282 6:41657417-41657439 GGTGAGGGAGAAGCAGGGACAGG + Intergenic
1007646918 6:43389993-43390015 GGGGAGGTGGGCAGAGGGACCGG + Intergenic
1007702787 6:43774254-43774276 AGTGAGGAGGGAGGAGGGGCTGG + Intronic
1007708192 6:43804387-43804409 GAAGAGGTGGTAGGAGGAACAGG + Intergenic
1007737558 6:43991041-43991063 TGGGACGTGGTAGGAGGGAGTGG - Intergenic
1007944924 6:45817623-45817645 TGGGGGGTGGTAGGAGGGTCAGG - Intergenic
1008163793 6:48110464-48110486 GGTGAGGTGAGAGGAGGGAGGGG + Intergenic
1008454541 6:51694062-51694084 GGTGAGGTGGTAAGAGAGGCGGG - Intronic
1008505224 6:52223700-52223722 GGTGAGGAAGTAGAAGTGACAGG - Intergenic
1009212837 6:60883731-60883753 GTTGAGGGGGTAGGAGGCAATGG - Intergenic
1010037021 6:71337629-71337651 TGTGTGGTGGGAGGGGGGACAGG + Intergenic
1010850136 6:80764723-80764745 GGTTTGGTGGTAGAAGGGCCTGG + Intergenic
1011112234 6:83851491-83851513 GGTGGGGTGGGAGGAGAGAGAGG - Intergenic
1011477622 6:87763525-87763547 GGTGAGTAGGTAGGAGAGATGGG + Intergenic
1012049140 6:94317710-94317732 GGGAAGGTGGTAGGCGGGAGAGG - Intergenic
1013891242 6:115030526-115030548 GCGGAGGTGGAAGGGGGGACAGG - Intergenic
1013992079 6:116265350-116265372 GGTGGGGTGCTGGCAGGGACTGG + Intronic
1014094791 6:117448003-117448025 CCTGAGGTGGGATGAGGGACAGG - Intronic
1014402397 6:121006661-121006683 TGGAAGGTGGGAGGAGGGACAGG + Intergenic
1015620283 6:135124912-135124934 AGTGAGGTGGAAGGAGGAAGAGG + Intergenic
1015944881 6:138489660-138489682 GCTGAGGTGGGAGGATGGATTGG + Intronic
1016458979 6:144262228-144262250 GGGGTGGAGGTAGGTGGGACTGG + Intergenic
1017663445 6:156695993-156696015 GGTGAGGCAGGAGGAGGGGCAGG - Intergenic
1017751649 6:157494311-157494333 GGGAAGGTCGGAGGAGGGACAGG - Intronic
1018047181 6:159975536-159975558 GGGCAGGTGGAAGGAGGGGCAGG + Intronic
1018699476 6:166415483-166415505 GATGTGGTGGTGGTAGGGACTGG + Intronic
1018759624 6:166880936-166880958 GGGGGGGTGGGAGGAGTGACAGG + Intronic
1018976158 6:168568679-168568701 GGTGAGGGGGAAGGAGGGATGGG - Intronic
1019186134 6:170221352-170221374 GGTGGGGTTGTCGGAGGGGCTGG + Intergenic
1019281586 7:203037-203059 GGGAAGGTGGTAGGTGGGAGAGG + Intronic
1019551770 7:1606752-1606774 GGAGAGGAGGAAGGAGGGACGGG - Intergenic
1019601943 7:1889234-1889256 CGTCGGGTGGTGGGAGGGACTGG - Intronic
1019615136 7:1955991-1956013 GGTGGGGTGGCAGGGGGGAGCGG + Intronic
1019712547 7:2524245-2524267 GGCGGGGTGGCGGGAGGGACAGG - Intronic
1019857166 7:3620789-3620811 AGTGAGGTGCTACAAGGGACGGG - Intronic
1019936719 7:4262790-4262812 GGTGATGAGGTAGAAGGGAGGGG - Intronic
1019936747 7:4262858-4262880 GGTGATGAGGTAGAAGGGAGGGG - Intronic
1019936778 7:4262930-4262952 GGTGATGAGGTAGAAGGGAGGGG - Intronic
1019936833 7:4263065-4263087 GGTGATGAGGTAGAAGGGAGGGG - Intronic
1020080107 7:5282455-5282477 GGAGGGGTGGGAGGAGGGAAGGG + Intronic
1020278060 7:6636835-6636857 GGTGGGGAGGGAGGAGGGACGGG - Intergenic
1021425650 7:20496311-20496333 AGTGAGGTGCTGGCAGGGACAGG - Intergenic
1022815132 7:33905750-33905772 GGGGAGGGGGCGGGAGGGACCGG + Intronic
1023043314 7:36191384-36191406 GGAGAGGTGGGAAGAGGGAGGGG + Intronic
1023125945 7:36954367-36954389 GGTGTGGGGGAAGCAGGGACAGG + Intronic
1023821939 7:43985475-43985497 GGTGTGGGGGCAGGAGGGGCAGG - Intergenic
1023918270 7:44606810-44606832 CGGAGGGTGGTAGGAGGGACGGG + Intronic
1024116350 7:46197406-46197428 GAGGAGGTGGGAGCAGGGACTGG - Intergenic
1024883116 7:54111861-54111883 GGGAAGATGGGAGGAGGGACAGG + Intergenic
1024977520 7:55127442-55127464 GGTGAGGGGGTGGGAAGGAGAGG - Intronic
1025024521 7:55505455-55505477 GGTGACGTGGTAAGACGGAAAGG + Intronic
1025198815 7:56949761-56949783 GGAGGGGTGGGAGGAGGGAGAGG - Intergenic
1025673131 7:63627172-63627194 GGAGGGGTGGGAGGAGGGAGAGG + Intergenic
1026159169 7:67853521-67853543 GGGGAGGTGGCAGGAGGGTTAGG + Intergenic
1026197213 7:68183583-68183605 GGGGAGGTGGTAGGACGGGAGGG + Intergenic
1026360776 7:69599438-69599460 GGAGAGAGGGGAGGAGGGACGGG - Exonic
1026663353 7:72321655-72321677 GGTGAGGTGCCTGGAGGGAGGGG + Intronic
1026787038 7:73308409-73308431 GGTGAGGGGAGGGGAGGGACGGG - Exonic
1027026829 7:74858749-74858771 GCTGAGGTGGGAGGATGGCCGGG + Intergenic
1027060923 7:75085360-75085382 GCTGAGGTGGGAGGATGGCCGGG - Intergenic
1027246817 7:76373259-76373281 GGGGTGGAGGTGGGAGGGACAGG + Intergenic
1027782806 7:82540851-82540873 GCTGAGGTGGTAAGAGGGGATGG - Intergenic
1028149830 7:87358753-87358775 GAGGAGGTGGAAGTAGGGACAGG + Intronic
1029408289 7:100390967-100390989 GGTGAGGTGGAAAGAGGAAAAGG + Intronic
1029467884 7:100737357-100737379 GGGCAGGCGGGAGGAGGGACAGG - Intronic
1029750203 7:102538888-102538910 GGTGTGGGGGCAGGAGGGGCAGG - Intronic
1029768154 7:102637996-102638018 GGTGTGGGGGCAGGAGGGGCAGG - Intronic
1029974009 7:104815712-104815734 GGTGGGGTGGTGGTAGGCACAGG - Intronic
1030133874 7:106227513-106227535 GGGGAGGTGGGGGGAGGGAGAGG - Intergenic
1030349535 7:108468682-108468704 GTTTTGGTGGTAGGAGGGAGGGG - Intergenic
1031695203 7:124843495-124843517 GGGGAGTTGGAAGGAGGGAGTGG + Intronic
1032305751 7:130731978-130732000 GGTGAGTTGGTGGGTGGGAGAGG - Exonic
1032405398 7:131652203-131652225 TGTGAGGTGGAAGAAGGGATGGG + Intergenic
1032867159 7:135937726-135937748 GAAGAGGTGGAAGGAGGGACAGG - Intronic
1033937151 7:146600519-146600541 GGTGAGGTGGAAAGAGTTACTGG + Intronic
1034087073 7:148330708-148330730 GGTGAAGTGGATGGAGGGAATGG + Intronic
1034133114 7:148739193-148739215 AGTGAGGTGTGAGGAGGGGCTGG + Intronic
1034478951 7:151305089-151305111 GATGAGGAGGTAGGAGGGGTGGG - Intergenic
1034677666 7:152903188-152903210 GGTGAGGTGGAGGAAGGGAGAGG + Intergenic
1035245653 7:157560712-157560734 GGTGAGGTGGGAGGAGGGAAGGG - Intronic
1035253688 7:157613127-157613149 GCTGAGGCGGGAGGCGGGACTGG - Intronic
1035450590 7:158974530-158974552 GGGGGGGTGGTGGGAGGGACGGG + Intergenic
1035765101 8:2099225-2099247 GGTGAGGTGGGAGGGAGCACAGG + Intronic
1036056717 8:5263215-5263237 TCTGAGGTGGAAGGAGGGAATGG + Intergenic
1037101067 8:15047098-15047120 GGTAAGGATGCAGGAGGGACAGG - Intronic
1037409853 8:18584898-18584920 GTTGAGGTGGTGAGAGGGAGAGG + Intronic
1037467294 8:19172708-19172730 GGGGAGGGGGGAGAAGGGACGGG + Intergenic
1037472708 8:19226000-19226022 GATGAGGTGGTAGGACTGTCTGG - Intergenic
1037819129 8:22127311-22127333 GGTGTGGTGGCTGGGGGGACAGG + Exonic
1040735583 8:50503976-50503998 TGTAGGGTGGGAGGAGGGACAGG - Intronic
1040994120 8:53384444-53384466 GGTGAGGTGGAATGAGGGATTGG - Intergenic
1041029728 8:53724569-53724591 GGGGAGGGGGGAGGAGGGAGGGG - Intronic
1041212147 8:55563376-55563398 GGTAAGGTGAGAGGAGGGACTGG + Intergenic
1041487550 8:58395721-58395743 GTGGAGGTGGAAGGAGGGAGAGG + Intergenic
1041691419 8:60691658-60691680 GGTGAGGTGGAAGGGAGGAGTGG - Intronic
1041995087 8:64045230-64045252 GTTGAGGAGGTAGGAGGGAATGG + Intergenic
1042515215 8:69652144-69652166 AGGGAGGTGGTAGGAAGGAGGGG - Intronic
1043542842 8:81281524-81281546 GGTGAGGAGGAAGGAGGCAGTGG + Intronic
1044113825 8:88309430-88309452 GGGAGGGTGGTAGGAGGGAGGGG + Intronic
1044311934 8:90703847-90703869 TGGAAGGTGGTAGGAGGGAGAGG - Intronic
1045125017 8:99079388-99079410 GGGGAGGTGGGAGTAAGGACAGG - Intronic
1045235162 8:100345985-100346007 GGTGAGGTAGAAGTGGGGACTGG - Intronic
1045786764 8:105930759-105930781 GTAGAGGTGGGAGGAGGGAGAGG + Intergenic
1047062306 8:121241391-121241413 GGTGAGGTAGCAGGAAGGAGAGG + Intergenic
1047873287 8:129108306-129108328 GGAGGGGTGGAAGGAGGGAGAGG + Intergenic
1047906732 8:129480621-129480643 GGTGAGTGGGGAGGAGGGGCTGG - Intergenic
1048325553 8:133436451-133436473 TGTGCAGTGGTAGGAAGGACAGG + Intergenic
1048841923 8:138574242-138574264 GGGGAGTTGGTAGGAGGGGATGG - Intergenic
1048897382 8:139004662-139004684 TGTGAGGTGATAGGATGGAGTGG + Intergenic
1048950899 8:139495977-139495999 GATGAGGTGTTAGCAGGGTCGGG - Intergenic
1049230717 8:141479868-141479890 GGTCAGGTGGTGGCGGGGACAGG + Intergenic
1049305304 8:141899690-141899712 GGCCAGGTGGTTGGAGGGGCTGG - Intergenic
1049442424 8:142615422-142615444 AGGGAGGTGGAAGGAGGGAAAGG + Intergenic
1049693209 8:143971786-143971808 GGTGAGGGGGCAGGGGGGCCGGG - Intronic
1049708585 8:144053805-144053827 GGGGTGGGGGTAGGAGAGACAGG - Intronic
1050874344 9:10615410-10615432 GGGGAGGAGGTAGGAGGAAGGGG - Intergenic
1050974976 9:11926476-11926498 GGGAAGGTGGGAGGAGGGAGAGG + Intergenic
1051494279 9:17701391-17701413 GGAGAGGTGGTAGCAGGTAGTGG + Intronic
1053205861 9:36186182-36186204 GGAGAGGTGGTGGGAAGGATGGG - Intergenic
1053297990 9:36928661-36928683 GTAGAGGTGGAAGGAGGGAAGGG - Intronic
1053561825 9:39204069-39204091 GGGGTGGTGGGAGGAGGGATAGG + Intronic
1054135293 9:61414883-61414905 GGGGTGGTGGGAGGAGGGATAGG - Intergenic
1055361586 9:75496767-75496789 GGTGAGGTGGTAGATGTGATGGG - Intergenic
1055621129 9:78126133-78126155 GGTCAGGTGGGAGGAGGGAGAGG - Intergenic
1055828942 9:80358325-80358347 GGTGGGGAGGTAGCAGGGGCAGG + Intergenic
1056092020 9:83215170-83215192 GGGGAGCTGGTAGGAGGGGATGG - Intergenic
1056166558 9:83946737-83946759 GGTGTGGTGGTTGTAGAGACAGG - Intronic
1056260280 9:84841684-84841706 AGTAAGGTGGGAGGAGGGACCGG - Intronic
1056275617 9:84991705-84991727 ATTGTGGTGGTAGGAGGGAGGGG + Intronic
1057194290 9:93108183-93108205 GGTGAGGAGGGAGGAGGCAGAGG + Intronic
1057526690 9:95809335-95809357 GGTGAGGTAGTGGGAGGGAAAGG - Intergenic
1057885065 9:98823673-98823695 GGTGAGGTTGCAGGATGGGCAGG + Intronic
1058053115 9:100426351-100426373 GGTCTGGAGGAAGGAGGGACTGG + Intergenic
1058876175 9:109246752-109246774 GGTGAGCTGGCAGGCGGCACAGG + Intronic
1058949210 9:109887884-109887906 CGTGATGTAGGAGGAGGGACAGG + Intronic
1059487989 9:114642185-114642207 GGTGGGGAGGAAGGAGGGAAGGG - Intronic
1060524682 9:124313816-124313838 GGTGAGGAGGTGGGAGAGCCGGG + Intronic
1060568831 9:124618882-124618904 GTTGAGGTGGTAGGAGAGTAGGG + Intronic
1060946923 9:127575123-127575145 GGGGAAGTGGGGGGAGGGACTGG - Intronic
1061073876 9:128328856-128328878 GGGGAGGGGGTAGCAGGGACAGG + Intronic
1061087270 9:128406307-128406329 TGTGAGGAGGTAGGAGGGGCTGG + Intergenic
1061252786 9:129436461-129436483 GGTGAGGTTCAAGGAGGGGCGGG + Intergenic
1061389101 9:130307353-130307375 GGTGAGTTGGGATGAGGGAGAGG + Intronic
1061489009 9:130934827-130934849 GCTGAGGAGGTAGAATGGACAGG - Intronic
1061782509 9:133004274-133004296 GGTGAGGTGGTTGGAGGAGGAGG - Intergenic
1061802289 9:133119276-133119298 GGGGTGTTGGCAGGAGGGACAGG + Intronic
1061967558 9:134024996-134025018 GCGGAGGTGGGAGGAGGGGCTGG - Intergenic
1062149547 9:135010587-135010609 AGTGAGGTAGGAGGTGGGACTGG - Intergenic
1062572096 9:137190452-137190474 GGAGAGGAGGGAGGAGGGTCTGG + Intergenic
1203466449 Un_GL000220v1:92958-92980 GGTGAGGAAGTAGGAGGGGACGG - Intergenic
1203657550 Un_KI270753v1:12971-12993 GGGGAGGTGGGAAGAGGGAGAGG - Intergenic
1185608516 X:1380618-1380640 GGGGAGGGGGAAGGAGGGAGAGG + Intronic
1186432855 X:9519783-9519805 GGAGAGGGGGTTGGAGGAACGGG + Intronic
1187377077 X:18764585-18764607 GGAAAGGTGGAAGGATGGACAGG + Intronic
1187915672 X:24150177-24150199 GGTGAGGGGGGGGGAGGGACGGG + Intronic
1188107302 X:26160308-26160330 ACTGAGGTGATAGCAGGGACTGG - Intergenic
1189105982 X:38235692-38235714 ACTGAGGTTGCAGGAGGGACAGG - Intronic
1189467609 X:41289130-41289152 TGTGTGGCGGTAGGTGGGACTGG + Intergenic
1189950373 X:46223884-46223906 GGTAGGGTGGGAGGAGGGAGAGG + Intergenic
1190324568 X:49199059-49199081 GGTGGGGTTGTTGGAGGTACAGG + Intronic
1190982845 X:55471986-55472008 TTTGGGGTGGGAGGAGGGACAGG + Intergenic
1190985854 X:55501197-55501219 TTTGGGGTGGGAGGAGGGACAGG - Intergenic
1192359100 X:70427099-70427121 GGTGATGAGGTAGCAGGGAAGGG - Intronic
1192626057 X:72729987-72730009 TGGGAGGTGGGAGGAGGGAGAGG - Intergenic
1192766720 X:74147089-74147111 GGCAAGGTGGTAGCAGGCACAGG - Intergenic
1193894300 X:87093201-87093223 GGGAAGGTGGGAGGAGGGAGAGG - Intergenic
1194429693 X:93786138-93786160 GGTCAGGGGGTAGGTGGGAATGG - Intergenic
1194638364 X:96373219-96373241 GGAGAGGGGGAAGGAAGGACAGG + Intergenic
1194923459 X:99795852-99795874 GGTGGGGGGGTAAGATGGACAGG + Intergenic
1194942798 X:100032466-100032488 GGGGCGGTGGGAGGAGGGAGAGG + Intergenic
1195342640 X:103919967-103919989 GGTGAGGAGGTAGTAGGGAGAGG + Intronic
1195364150 X:104111610-104111632 GGTGAGGAGGTAGTGGGGAGAGG - Intronic
1197440490 X:126482494-126482516 AGTGAGTTGGTTGGAGGGAAAGG + Intergenic
1198653941 X:138893173-138893195 GGTCAGATGGTATGAGTGACTGG + Intronic
1199542647 X:148974102-148974124 GATGAGGTGGTAGTAGGGGCTGG + Intronic
1199675544 X:150186225-150186247 GGAGAGGTGATGGGAGAGACAGG + Intergenic
1200017864 X:153179791-153179813 GGTGAGGTGGCAGAAGGGTTGGG - Intronic
1200204797 X:154308165-154308187 GTGGAGGAGGTAGGAGGCACTGG + Intronic
1201597751 Y:15691356-15691378 GCTGAGGTGGGAGGAGTGCCTGG - Intergenic
1201766742 Y:17579734-17579756 GGAGAGGTGGAAGGAGGAGCAGG + Intergenic
1201834811 Y:18326251-18326273 GGAGAGGTGGAAGGAGGAGCAGG - Intergenic