ID: 975652772

View in Genome Browser
Species Human (GRCh38)
Location 4:76610987-76611009
Sequence CTGTGGATAGGGATGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975652759_975652772 26 Left 975652759 4:76610938-76610960 CCTCAAATGAGAAACTATTTCAC 0: 1
1: 0
2: 3
3: 41
4: 348
Right 975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG No data
975652757_975652772 30 Left 975652757 4:76610934-76610956 CCTCCCTCAAATGAGAAACTATT 0: 1
1: 0
2: 1
3: 26
4: 182
Right 975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG No data
975652758_975652772 27 Left 975652758 4:76610937-76610959 CCCTCAAATGAGAAACTATTTCA 0: 1
1: 0
2: 2
3: 31
4: 396
Right 975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG No data
975652761_975652772 -8 Left 975652761 4:76610972-76610994 CCCATTTGTCCTCCACTGTGGAT 0: 1
1: 0
2: 0
3: 17
4: 209
Right 975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG No data
975652762_975652772 -9 Left 975652762 4:76610973-76610995 CCATTTGTCCTCCACTGTGGATA 0: 1
1: 0
2: 2
3: 14
4: 191
Right 975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975652772 Original CRISPR CTGTGGATAGGGATGGGGGA GGG Intronic
No off target data available for this crispr