ID: 975655907

View in Genome Browser
Species Human (GRCh38)
Location 4:76641055-76641077
Sequence AACTGTGGGCTGAAATATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975655904_975655907 -10 Left 975655904 4:76641042-76641064 CCATCCCTCTTTTAACTGTGGGC 0: 1
1: 0
2: 2
3: 23
4: 253
Right 975655907 4:76641055-76641077 AACTGTGGGCTGAAATATACTGG 0: 1
1: 0
2: 1
3: 9
4: 119
975655901_975655907 4 Left 975655901 4:76641028-76641050 CCTTTTTATGCAGGCCATCCCTC 0: 1
1: 0
2: 1
3: 6
4: 109
Right 975655907 4:76641055-76641077 AACTGTGGGCTGAAATATACTGG 0: 1
1: 0
2: 1
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975655907 Original CRISPR AACTGTGGGCTGAAATATAC TGG Intronic
905289261 1:36910445-36910467 AGCTGTGGGCTGGAAGATCCAGG + Intronic
908016544 1:59844318-59844340 AAATATGCACTGAAATATACAGG - Intronic
911058342 1:93726806-93726828 ACCTGTGGGCAGAAATTTAGTGG - Intronic
915125555 1:153661118-153661140 AACTAGGTGCTGAAAAATACCGG - Intronic
917943010 1:179942063-179942085 ACATGTGGGATGAAATATATTGG + Intergenic
918223699 1:182458947-182458969 AACTATGGGCTAGAATATAATGG - Intronic
920296854 1:204963070-204963092 CACTGTGGGCTGAAACAGATAGG + Intronic
921638654 1:217525180-217525202 AAATGAAGGTTGAAATATACTGG - Intronic
1063950007 10:11213355-11213377 AACTCAGGTCTGAAATGTACTGG - Intronic
1064527296 10:16270596-16270618 AACCTTGGGCTTACATATACAGG + Intergenic
1067288153 10:44922336-44922358 AAGTGTGGCCTGAAATTTAGTGG - Intronic
1067541787 10:47160230-47160252 AACTGTGGGATGAAGGATCCAGG - Intergenic
1070486558 10:76937537-76937559 AACTCTGGGATGAAATCCACAGG - Intronic
1071038647 10:81279555-81279577 AATTGTTGGTTGAAATACACTGG + Intergenic
1071749068 10:88454319-88454341 CATTGTGGGAGGAAATATACAGG + Intronic
1076335751 10:129705352-129705374 TACTGTGGGCGGAAATACCCTGG - Intronic
1076395006 10:130131957-130131979 AACTGTAGCCTGAAGCATACAGG - Intergenic
1078366060 11:10707479-10707501 AAATGTTGGCTGAATTAAACTGG + Intergenic
1078583822 11:12562432-12562454 AAGTGTTGGATGAAATAAACAGG + Intergenic
1079487696 11:20952638-20952660 AACTGTGGGCTAAAGTGGACTGG + Intronic
1083013507 11:59426712-59426734 AGCCTTGTGCTGAAATATACTGG + Intergenic
1084992540 11:72940978-72941000 ATGTGTGGGCTGACATCTACAGG + Intronic
1086161766 11:83729619-83729641 CTCTGTGAGCTGAAAAATACAGG + Intronic
1086966583 11:93034121-93034143 CACTGTGGGCTGAAAACTACTGG + Intergenic
1089090651 11:115872057-115872079 AAATGTGGAGTGAAATATACAGG - Intergenic
1090112634 11:123931043-123931065 AACTGAGGCAGGAAATATACAGG - Intergenic
1095245774 12:39919461-39919483 AAAAGTGGGATGAAATATATTGG - Intronic
1098050546 12:66447995-66448017 AACTGTGCGCTGAAATGCAGAGG - Intronic
1100130872 12:91491870-91491892 AACTGTGGATTGAAAAATTCAGG - Intergenic
1104540712 12:129662200-129662222 AACTTTGGGCTTAAATTTAGAGG + Intronic
1105803759 13:23936461-23936483 ACTTGTGAGCTGAAATATTCAGG + Intergenic
1105948245 13:25207979-25208001 AGCTGTAGGCTGAAATATTGTGG + Intergenic
1107181576 13:37467276-37467298 GACTGTGGGATGAAATAGAGGGG - Intergenic
1108581298 13:51830662-51830684 AAGTGGGGGCTGAAATAAAGGGG - Intergenic
1114886496 14:26858398-26858420 AACTGTGTACTGAAGTAGACTGG - Intergenic
1115048944 14:29032637-29032659 AAAAGTGGGTTAAAATATACAGG + Intergenic
1116161630 14:41273663-41273685 AACTGTGAGCTGGAAAATAAGGG - Intergenic
1116672659 14:47863058-47863080 AAATGTGGGCTGGAATCAACAGG - Intergenic
1119944508 14:78678452-78678474 AACTGTGGATGAAAATATACTGG - Intronic
1120103444 14:80469591-80469613 AATTGTGAGCTGACATAAACTGG - Intergenic
1122583633 14:102788242-102788264 AACATTGGGCTATAATATACTGG - Intronic
1125087171 15:35743846-35743868 AGCTGTGGCCTGAAGTACACAGG - Intergenic
1126191246 15:45881122-45881144 AACTGTGGGGGGAAAAATACTGG + Intergenic
1127075858 15:55324856-55324878 AACTGTGCCCTGTAAAATACAGG - Intronic
1130627195 15:85527553-85527575 AGGTGTGGGCTGGAATATAGCGG + Intronic
1130845540 15:87740892-87740914 AACTCTAGGCTGCAATATAAAGG - Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1141355100 16:83338307-83338329 AACTGTCAGCTGTAATATGCCGG + Intronic
1141871926 16:86792835-86792857 AACTAGGAGCTGAAATACACAGG + Intergenic
1145819187 17:27818315-27818337 ATCTGTGGGCTGTACTATCCCGG - Intronic
1146344032 17:32045385-32045407 CACTTTGGGCTGAAAGATACAGG - Intronic
1151734928 17:75933386-75933408 AACTGTAGGCTGGAATACATGGG + Intronic
1156756670 18:40536128-40536150 TACTGTGAGCTGAAATACCCAGG + Intergenic
1157952888 18:52060108-52060130 AACTGAGGGCTGGAGTATAGAGG - Intergenic
925349789 2:3192800-3192822 AAATGTTGGCTGAAACCTACAGG + Intronic
927115443 2:19896508-19896530 AAATGTAGGCTGAAATATTTAGG + Intergenic
927332140 2:21878153-21878175 AAGTTTGGGCTGCAATCTACTGG + Intergenic
930286747 2:49439138-49439160 AAGTCTGGGCTGGAATATATAGG - Intergenic
937062962 2:118993831-118993853 AACTTTTGGCTGAAAGATATAGG - Intronic
940332911 2:152494511-152494533 AAGTTTGGTCTGAAAAATACGGG + Intronic
942428681 2:175886134-175886156 AACTGTGGGCTTGAATAAGCAGG - Intergenic
1169642362 20:7768245-7768267 AACTGGGGACTGGAATATTCTGG - Intergenic
1170133220 20:13045167-13045189 AACTGGGTGCTGGAATATGCAGG - Intronic
1174201886 20:48812128-48812150 AACTGAGGGCTGAAAAAACCTGG - Intronic
1174634524 20:51987554-51987576 TTCTATGGGCTGAGATATACTGG + Intergenic
1178167782 21:30001156-30001178 AAATGTGGTCTTAAATTTACTGG - Intergenic
1179187732 21:39097484-39097506 AACTTTGAGTTGAAAGATACAGG - Intergenic
1179264207 21:39788372-39788394 AACTGTGGGATGAAACAGATGGG + Intronic
1182868135 22:33622672-33622694 AACTGGGGGCTTACATATATGGG - Intronic
949095300 3:78504-78526 AAATGTGAGCTGAAAACTACTGG - Intergenic
949122402 3:402489-402511 GTCTGTTGGCTGAAATATACAGG - Intronic
950991466 3:17442806-17442828 AACTGTGGTCTGAACTTAACTGG + Intronic
951620420 3:24595487-24595509 AACTGGAGACTGGAATATACTGG + Intergenic
952229091 3:31410718-31410740 AACTGGGGCAGGAAATATACAGG + Intergenic
954082121 3:48218489-48218511 AACTGGGGGCTGAAATCCAGGGG + Intergenic
956176860 3:66481126-66481148 AGGTGTGGTCTGAAATATAGAGG - Intronic
957164599 3:76655846-76655868 AACTTTGTGTTGAAATATATTGG - Intronic
958006273 3:87815178-87815200 AACTTTGGGCTATAATAAACAGG + Intergenic
960564832 3:119122420-119122442 CACTGTGGGTTGAAATGCACTGG + Intronic
962756245 3:138467547-138467569 ATCTGCAGGCTGGAATATACAGG - Exonic
963376716 3:144476347-144476369 AAATGTGGCCTGAAATACAAAGG - Intergenic
963459667 3:145594060-145594082 AACTGTGGGGTGCAGCATACAGG + Intergenic
967436570 3:189454208-189454230 AACTGTGGGCTGTAATGAGCAGG + Intergenic
967673747 3:192271104-192271126 AACTGTGGCATGAAATATCATGG + Intronic
970238710 4:13985453-13985475 AGGTGGGGGATGAAATATACTGG + Intergenic
971736154 4:30455273-30455295 AAATGTGGACTGAAACATAATGG + Intergenic
972098638 4:35382689-35382711 AAATGTGGGCTGAATTGTGCAGG - Intergenic
975655907 4:76641055-76641077 AACTGTGGGCTGAAATATACTGG + Intronic
977451389 4:97202978-97203000 ATCTGTGGTCTGAAATCTATTGG + Intronic
981526621 4:145713029-145713051 AATAGTGGGCTTAAATATTCAGG - Intronic
981749258 4:148077745-148077767 AACTGTGGGCTGAATTCTTTGGG + Intergenic
986454881 5:7907645-7907667 AACTGGGGGATGAAGTATATAGG - Intergenic
988179337 5:27769468-27769490 AAGTGTTGGTTTAAATATACGGG - Intergenic
988307179 5:29507330-29507352 AACTGTGGGCTGTATTGGACTGG + Intergenic
988325467 5:29760798-29760820 AACTGTGGACTGAAAGATTGAGG - Intergenic
991936743 5:71809674-71809696 ATCTGTGTGCTGGAATATAATGG - Intergenic
994579003 5:101614702-101614724 AACTATGGGCAGAAATACAAGGG - Intergenic
998718354 5:144911961-144911983 ACCTGTGAGCTGTAATATTCTGG + Intergenic
998943423 5:147310913-147310935 ATCTGTCGGCTTACATATACTGG - Intronic
1001000578 5:168002859-168002881 CACTGTGTGCTGAAATCTGCAGG + Intronic
1008112442 6:47507467-47507489 AAATGTGGGCTGGAATTTAGTGG + Intronic
1012359031 6:98353378-98353400 ATCTGTGGGATGAAAGAAACTGG - Intergenic
1012482472 6:99682362-99682384 AAATGTGGGTTAAAATATATTGG + Intergenic
1013687359 6:112601052-112601074 CACGGTGGGCTGAAATGTTCTGG + Intergenic
1015407778 6:132856846-132856868 TTCTCTGGGCTGGAATATACTGG - Intergenic
1017000849 6:149996093-149996115 ACCTGTGGGCAGAAATATGAGGG - Intergenic
1020617260 7:10475397-10475419 AACTGTGGACTTAAAGATATGGG - Intergenic
1022523414 7:31022357-31022379 AACTGTAGGCTGAAAGCTCCAGG - Intergenic
1024941780 7:54770317-54770339 AACTGTGGGCAGAAATATATTGG + Intergenic
1028722739 7:94051858-94051880 AACTGTGGTCCCAAAAATACTGG + Intergenic
1028929637 7:96398254-96398276 CACTGTGGGCTGAAGTACTCTGG - Intergenic
1029894031 7:103962535-103962557 TTCTGTGAGCTGAAATCTACTGG - Intronic
1033983167 7:147191148-147191170 ATCTGAGGGGTGAAATATACTGG - Intronic
1036072139 8:5452924-5452946 AAGTGTAGTCTGAAAAATACTGG - Intergenic
1039426955 8:37493966-37493988 ATCTGTGGGCCGAAATGTATTGG + Intergenic
1041325641 8:56660887-56660909 CACTGTGGTCTGAATTATATGGG + Intergenic
1044011845 8:87003864-87003886 AAGTGTGGGCAGAAATACTCTGG + Intronic
1049012917 8:139899601-139899623 AACTGTGCCCTGAGCTATACCGG + Intronic
1052020607 9:23521492-23521514 AACTGTGGGCAGAAGAATAGGGG - Intergenic
1052681084 9:31693674-31693696 AGCTGTGGGCTGAAGTTTACAGG + Intergenic
1052779392 9:32765103-32765125 AACTGTGGGCTGAAGAAGTCGGG + Intergenic
1053179034 9:35951983-35952005 AACTGAGGGCTGAACTCTAATGG - Intergenic
1056303183 9:85263043-85263065 AACACTGGGCTGAAATATGCAGG - Intergenic
1187289361 X:17938146-17938168 AACTGTAGGGTCAAATGTACAGG - Intergenic
1188292786 X:28409813-28409835 AAGGGTGGGCTGAAATTTAGGGG + Intergenic
1192094162 X:68192946-68192968 CACTGTGGGCAGCAATATTCAGG - Exonic
1198202609 X:134436891-134436913 AAGGGTGGGGTGAACTATACAGG + Intergenic
1198773462 X:140155335-140155357 CACTGTGGGCTGAAGTGTTCTGG + Intergenic
1199001574 X:142644269-142644291 GTATGTGTGCTGAAATATACAGG + Intergenic
1202240407 Y:22761279-22761301 AACTGTGGACTGTAAAACACTGG + Intergenic