ID: 975656413

View in Genome Browser
Species Human (GRCh38)
Location 4:76645447-76645469
Sequence CGTGCTGCCCAGGTGGGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975656413_975656418 -8 Left 975656413 4:76645447-76645469 CCACGTCCCACCTGGGCAGCACG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 975656418 4:76645462-76645484 GCAGCACGATGGCCACAGAAAGG 0: 1
1: 0
2: 0
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975656413 Original CRISPR CGTGCTGCCCAGGTGGGACG TGG (reversed) Intronic
900266612 1:1760357-1760379 CGTGCGTCCCAGGCAGGACGGGG - Intronic
901066104 1:6495364-6495386 CGTTCTGCACAGGAGGGCCGTGG - Intronic
901223196 1:7595831-7595853 TGTGATGCCCAGGTGGGGTGGGG - Intronic
902245001 1:15114980-15115002 GGAGCTGCCAAGGTGGGAGGAGG + Exonic
903646439 1:24898889-24898911 CTTGCTGGCAAGGTGGGAGGGGG + Intergenic
903929894 1:26856110-26856132 CCTGGTGCCCAGGTTGGAGGTGG - Exonic
904077396 1:27853047-27853069 CGTGCCGTCCAGGAGGGAGGTGG + Intergenic
905449475 1:38047212-38047234 CCTGCTGCCCGGGCGGGATGCGG - Intergenic
910927368 1:92410868-92410890 CTTCCTGCCAAGGTGGGAGGGGG - Intergenic
911101837 1:94101552-94101574 GGTGCTGACCAGGTGGGGTGGGG + Intronic
912206587 1:107515881-107515903 GGTGCTGCCCAGGGAGGAAGGGG - Intergenic
915280906 1:154821517-154821539 CTTGCTGCCCAGGAGTGACTTGG - Intronic
918309385 1:183274931-183274953 TGTGCTGCCCAGGAGAGAGGAGG - Intronic
919726328 1:200887223-200887245 GGTGCAGCCCAGCTGGGACGTGG + Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
924797237 1:247301104-247301126 GGTGCTGCTCCGGTGGGAGGCGG + Exonic
1062788541 10:285494-285516 CGTGCTGCCACCGTGGGAGGAGG + Intronic
1062895582 10:1100909-1100931 CGTGCAGCTCAGTCGGGACGGGG - Intronic
1063460455 10:6212180-6212202 CGTGCCGCCCAGGCGGGAGCTGG + Intronic
1064046204 10:12018244-12018266 CATGCTGCCCAGGTTGGTCTCGG - Intronic
1069258155 10:66360537-66360559 TGTGCTTTCCAGGTGGGACAGGG + Intronic
1069741372 10:70687873-70687895 CGTGCCGTCCAGGAGGGAGGTGG - Intronic
1072509417 10:96104010-96104032 TGTGTTGCCCAGGTTGGACTGGG - Intergenic
1077006941 11:362868-362890 CGAGCAGCCCATGTGGCACGTGG - Intergenic
1077470990 11:2760494-2760516 CGTGCTGCCCAGCGGGGGCTTGG - Intronic
1081562049 11:44226688-44226710 CATGCTGCCCAGATGGGAAAGGG - Intronic
1083525500 11:63361100-63361122 CATCCTGCCCAGGTAGGAGGAGG + Intronic
1083624861 11:64067240-64067262 CGTGCCGCACAGGTGGGAGTGGG - Intronic
1083811656 11:65109923-65109945 GGTGCTGCCCAGGCTGGCCGGGG + Exonic
1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG + Intronic
1095439512 12:42227775-42227797 CGTGCTGTCCGGGAGGGAGGTGG + Intronic
1098058546 12:66535083-66535105 CATGCTAGCCAGGTGGGAAGAGG - Intronic
1098653805 12:73005341-73005363 GGTCCTGCACAGATGGGACGTGG + Intergenic
1100582090 12:95947602-95947624 CGTGCCGTCCAGGAGGGAGGTGG + Intronic
1103563587 12:121804609-121804631 CGCGCTGGCAAGGTGGGAGGGGG + Intronic
1104769397 12:131351506-131351528 TGTGCTCCCCAGGTGGGCCTTGG - Intergenic
1105241000 13:18609672-18609694 CGCGCTGCTCAGGTGCGACCAGG + Intergenic
1106602590 13:31200327-31200349 CGCGGCGCCCAGGTGGGACCCGG + Intronic
1106627777 13:31438393-31438415 TGTGCTGACCAGAAGGGACGAGG - Intergenic
1112889294 13:104211434-104211456 GGTCCTGCACAGATGGGACGTGG + Intergenic
1116490560 14:45498761-45498783 GGTCCCGCCCAGATGGGACGAGG + Intergenic
1117801204 14:59446391-59446413 GGTCCTGCACAGATGGGACGTGG - Intronic
1117980795 14:61340355-61340377 GGTGTTCCCCAGGTGGGAGGGGG + Intronic
1119602759 14:75988173-75988195 TGTGCTGCCCAGGCTGGACAAGG - Intronic
1121324019 14:93009407-93009429 TGTGCAGCCCAGTTGGGACAGGG - Intronic
1122792242 14:104188958-104188980 CCGGCAGCCCAGGTGGGAAGTGG - Intergenic
1123490357 15:20775473-20775495 CGCGCTGCTCAGGTGCGACCAGG - Intergenic
1123546858 15:21344560-21344582 CGCGCTGCTCAGGTGCGACCAGG - Intergenic
1124632940 15:31347559-31347581 GGTGCTGCTCATGAGGGACGAGG + Intronic
1125508963 15:40282761-40282783 CGTGCGGCCCAGGAGCGGCGGGG - Intronic
1125914452 15:43473613-43473635 CTGGCTGCTCTGGTGGGACGTGG - Intronic
1129395226 15:75240777-75240799 AGTGCTGCCAAGGTGGGGCAGGG - Intergenic
1129710935 15:77819923-77819945 CGGGCTGGGCAGGTGGGACAAGG - Intronic
1130076155 15:80692347-80692369 CGTGCTGCCCAGGGGATAAGAGG - Intronic
1131447771 15:92513846-92513868 GGTCCTGCACAGGTGGGACACGG - Intergenic
1202955190 15_KI270727v1_random:71776-71798 CGCGCTGCTCAGGTGCGACCAGG - Intergenic
1132598033 16:762080-762102 GGTGCAGTCCAGGTGGGGCGGGG - Intronic
1132783750 16:1642900-1642922 TGTGCTGCCCAGCGGGGGCGTGG + Intronic
1132867460 16:2100541-2100563 CATGATGCCCACGTGGGCCGTGG + Exonic
1132948070 16:2543567-2543589 TGTGCGGCCCAGGTGGGTCCAGG + Intronic
1132966377 16:2657775-2657797 TGTGCGGCCCAGGTGGGTCCAGG - Intergenic
1134524318 16:14932574-14932596 CATGATGCCCACGTGGGCCGTGG - Intronic
1134548585 16:15128364-15128386 CATGATGCCCACGTGGGCCGTGG + Intronic
1134711907 16:16331061-16331083 CATGATGCCCACGTGGGCCGTGG - Intergenic
1134719763 16:16374354-16374376 CATGATGCCCACGTGGGCCGTGG - Intergenic
1134947663 16:18337531-18337553 CATGATGCCCACGTGGGCCGTGG + Intergenic
1134954921 16:18377633-18377655 CATGATGCCCACGTGGGCCGTGG + Intergenic
1136229567 16:28878490-28878512 CCGGCTGCTCAAGTGGGACGGGG + Exonic
1138605707 16:58086825-58086847 CGGGCTCCCCACGTGGGATGCGG + Intergenic
1140409603 16:74733974-74733996 CGTGGTGCCCAGGTAGAAGGGGG - Intronic
1142017042 16:87754984-87755006 CCTGCTCCCCAGGTGGCATGAGG - Intronic
1142089571 16:88202855-88202877 CCTGCAGCCCAGGTGAGATGAGG + Intergenic
1142245018 16:88966415-88966437 CATGCTGCACAGGTGGGAGAGGG - Intronic
1148774591 17:50088352-50088374 CGTGTTACCCAGGTGGGCCGGGG - Intronic
1150249547 17:63698448-63698470 CGTGGGGGCCAGGTGGGAAGGGG - Exonic
1151153089 17:72104713-72104735 TCTGCAGCCCAGGTGGGAGGTGG - Intergenic
1151729176 17:75900932-75900954 GGTGCTGCCCAGGCGGGAAGAGG - Intronic
1152884570 17:82842062-82842084 CGTGCTGCCCAGATGCAAGGCGG + Intronic
1154266674 18:12884387-12884409 CGGGGTGCCCAGGTGGGAGGGGG + Intronic
1154447964 18:14450230-14450252 CGCGCTGCTCAGGTGCGACCAGG - Intergenic
1160221775 18:76983395-76983417 CGTGCTGGCCAGGTGGGGCGGGG + Intronic
1160502689 18:79410201-79410223 CTTGTTGGCCAGGTGGGACTGGG + Intronic
1161250335 19:3276522-3276544 GGGGCTGGCCAGGTGGGGCGGGG + Intronic
1161553713 19:4928657-4928679 CTTGCTGTTCAGGTGGGACAGGG + Intronic
1161585280 19:5102361-5102383 CTGGCTGCCCAGGAGGGATGTGG + Intronic
1162328000 19:10010164-10010186 CGTGCGGCCCCGGTGTGATGTGG - Intronic
1162567681 19:11453219-11453241 CGTGACGCCAAGGTGGAACGAGG + Exonic
1163360650 19:16844042-16844064 CATGTTGCCCAGGTGGGTCTTGG + Intronic
1163435756 19:17294223-17294245 GGTGCTGCCCGGGAGGGGCGTGG - Intronic
1164753008 19:30670037-30670059 CATCCTGCCCAGGTGGGAGAGGG + Intronic
1167124969 19:47543301-47543323 CATGTTGCCCAGGTTGGACATGG + Intronic
925169200 2:1740638-1740660 TGTGCAGTCCTGGTGGGACGGGG - Intronic
925433835 2:3819277-3819299 GGTCCTGCACAGATGGGACGTGG + Intronic
926027327 2:9556188-9556210 CGACCTGCCCAGGGCGGACGAGG + Intergenic
927559637 2:24060915-24060937 GGTGCAGCCCAGGTAGGATGAGG + Exonic
929484437 2:42341367-42341389 TGGTCTGCCCAGGTGGGACTTGG - Intronic
930202122 2:48556756-48556778 CGTGCCGTCCAGGAGGGAGGTGG - Intronic
930202223 2:48556982-48557004 CGTGCCGTCCAGGAGGGAGGTGG - Intronic
931850444 2:66246268-66246290 GGTCCTGCACAGATGGGACGCGG - Intergenic
932367625 2:71163057-71163079 GGTCCTGCACAGATGGGACGCGG + Intergenic
933179749 2:79215192-79215214 GGTCCTGCACAGATGGGACGTGG + Intronic
935137560 2:100321427-100321449 CGCGCTGCTCAGGTGCGACCAGG - Exonic
939961458 2:148569359-148569381 CGTTCTGCCCAGGTGAGGCCAGG + Intergenic
943061592 2:183046223-183046245 AGTCCTGCACAGATGGGACGAGG - Intergenic
946439444 2:219682543-219682565 GGGGCTGTCCAGGTGGGACAGGG + Intergenic
947535980 2:230940688-230940710 CGACCTGCCCAGCTGGGGCGAGG - Intronic
947914565 2:233823007-233823029 CCTGCTGGCCAGGTGGGCCCTGG + Exonic
1171422936 20:25030922-25030944 CGTGTTGGCCAGGCGGCACGTGG + Exonic
1173321952 20:41996634-41996656 AGAGCTGCCCAGGTGGGGCTGGG - Intergenic
1173595602 20:44257083-44257105 CACTCTGCCCAGGTGGGGCGGGG - Intronic
1173991210 20:47305039-47305061 CTTGCTGCCCAGGCTGGTCGCGG - Intronic
1175737927 20:61400026-61400048 CGTGCTGCCCAGCTGTAAGGGGG - Intronic
1175922769 20:62457888-62457910 GGGGCTGCCCAGGTGGCTCGAGG - Intergenic
1176448260 21:6840465-6840487 CGCGCTGCTCAGGTGCGACCAGG + Intergenic
1176826430 21:13705487-13705509 CGCGCTGCTCAGGTGCGACCAGG + Intergenic
1178264376 21:31129093-31129115 CCTGCTGTCCAAGTGGGACAGGG + Intronic
1178639983 21:34337872-34337894 AGGGTTGCCCAGGTGGGACAAGG - Intergenic
1179722484 21:43323638-43323660 CATGCTGCCCATGTGGGCCTGGG + Intergenic
1179888416 21:44324322-44324344 TGTGGGGCCCAGGTGGGAGGTGG + Intronic
1179994522 21:44967817-44967839 CGTCCTCCCCAGGAGGGACGGGG + Intronic
1182505574 22:30779883-30779905 GGGGCTGCCCAGGTGGGCCAGGG - Intronic
1183389783 22:37539003-37539025 GGTGCTGCACCTGTGGGACGAGG - Intergenic
1184745737 22:46454659-46454681 CAAGCTGTCCGGGTGGGACGCGG + Intronic
1185103874 22:48856352-48856374 GCTGCTGCCCAGGTGGGAAGAGG + Intergenic
949599780 3:5585271-5585293 CGTGTTACCCAGGTGGCAAGGGG + Intergenic
951803556 3:26623085-26623107 CGAGCTGCCCACCTGGGACCGGG - Exonic
952476570 3:33717378-33717400 CGGTCTGCCCAGTGGGGACGCGG + Intronic
953031228 3:39181067-39181089 CGTGCCGCCGAGGAGGGGCGGGG - Intergenic
953177212 3:40563316-40563338 GGTCCTGCACAGATGGGACGCGG - Intronic
953657352 3:44864150-44864172 GTTGCTGCCCAGGGTGGACGTGG + Intronic
954678381 3:52327817-52327839 AGTGGGGCCCAGGTGGGACTGGG - Intronic
955916362 3:63912226-63912248 CGGGCTGCCATGGTGGGGCGCGG + Intronic
957155096 3:76536025-76536047 GGTCCTGCACAGGTGGGACATGG + Intronic
957203236 3:77164514-77164536 CGTGCTGTCCGGGAGGGAGGTGG + Intronic
957203309 3:77164690-77164712 CGTGCTGTCCGGGAGGGAGGTGG + Intronic
960862086 3:122164683-122164705 CGTGCCGTCCAGGAGGGAGGTGG + Intergenic
961120709 3:124368150-124368172 CGTGCTGTCCGGGAGGGAGGTGG - Intronic
965070347 3:163909879-163909901 GGTCCTGCACAGATGGGACGTGG - Intergenic
966808631 3:183825178-183825200 CGTGCTGCCCATCGGCGACGCGG - Exonic
968903322 4:3441023-3441045 AGGGCTGCCGAGGTGGGAGGAGG - Intergenic
969864952 4:10069256-10069278 CGAGCTGCCCAAATGGGATGTGG + Intergenic
971236326 4:24845362-24845384 AGTGCAGCCCAGGTGGGGCAGGG - Intronic
973001840 4:44961442-44961464 ATTGCTGCACAGGTGGGATGGGG + Intergenic
975656413 4:76645447-76645469 CGTGCTGCCCAGGTGGGACGTGG - Intronic
982734621 4:158992746-158992768 CCTGCTGCCCTGTTGGGACCTGG - Intronic
985057379 4:186047575-186047597 GGTCCTGCACAGATGGGACGTGG + Intergenic
985551602 5:535953-535975 CGCCCTGCCCAGGTGGGCTGCGG - Intergenic
985688382 5:1294100-1294122 CGTCCTGCCCGGGTGGGCCCAGG + Exonic
987581593 5:19800915-19800937 CGTGTTGCCCAGGCTGGTCGCGG - Intronic
990852718 5:60225030-60225052 CTTGCTTCCCAGGTGGTACCTGG - Intronic
997726435 5:136124179-136124201 TGTGATGGCCAGGTGGGAGGTGG + Intergenic
999130983 5:149283010-149283032 GGTGCTGCCCCGGTGGTAAGAGG - Intronic
1002053800 5:176586809-176586831 CGTGCTGCCCAACCGGGAGGTGG + Exonic
1002451210 5:179319849-179319871 CGTGCTGACCAGTGGGGACCTGG - Intronic
1005850658 6:29818252-29818274 CCTGCTGCCCAGATGGGTCTGGG - Intergenic
1006082763 6:31576974-31576996 CGTCATGGCCAGGTGGGATGTGG + Intronic
1006093504 6:31642017-31642039 GGTGTTGCCAAGGTGGGATGAGG - Intronic
1008112128 6:47505810-47505832 CGTGCCGTCCAGGAGGGAGGTGG - Intronic
1014396083 6:120927522-120927544 GGTCCTGCACAGATGGGACGTGG - Intergenic
1014428060 6:121333709-121333731 TGTGCTGCCCGGGTGAGGCGCGG + Intronic
1015165236 6:130194676-130194698 GGTCCTGCACAGATGGGACGCGG - Intronic
1015750183 6:136550777-136550799 GGAGCAGCCCAGGTGGGGCGAGG + Intronic
1019609266 7:1928726-1928748 GGCCCTGCCCAGGTGGCACGGGG + Intronic
1020006291 7:4785247-4785269 CGAGGGGCCCAGGTGGGACAGGG - Intronic
1020082761 7:5295639-5295661 AGTGCTGCCCAGGCAGGAAGCGG + Intronic
1022125503 7:27352452-27352474 CGTGCTGTGCAGGTGTGAAGGGG + Intergenic
1025211507 7:57021538-57021560 AGTGCTGCCCAGGCAGGAAGCGG - Intergenic
1025660448 7:63555309-63555331 AGTGCTGCCCAGGCAGGAAGCGG + Intergenic
1026280090 7:68914581-68914603 CGTTCTGCCCAGATGGGCTGTGG - Intergenic
1029147781 7:98458871-98458893 CTTGCTCCCCAGGTGGGCCGAGG - Intergenic
1034551154 7:151821513-151821535 CGGGCTGCCCAGGTGGTAGAAGG + Intronic
1035125628 7:156606817-156606839 GGTGGTGCCCAGGCGGGGCGTGG - Intergenic
1035287181 7:157814075-157814097 CGTGCTGCGCAGGTGAGGCCTGG + Intronic
1040939645 8:52819107-52819129 CCTGCTGCTCAGGTGGTACCTGG + Intergenic
1041084709 8:54246038-54246060 GGTGCCGGCCAGGTGGGACGGGG + Intergenic
1046800645 8:118422970-118422992 CGTGTTGCCCAGGCTGGTCGAGG - Intronic
1048469921 8:134696630-134696652 AGCCCTGCCCAGGTGGGACAGGG + Intronic
1048983302 8:139714885-139714907 CTTGCTAATCAGGTGGGACGGGG + Intergenic
1049370467 8:142261873-142261895 CCTGCTGCCCAGGTTGGACTTGG - Intronic
1049541401 8:143210779-143210801 CGTGGTGCCTGGGTGGGATGAGG + Intergenic
1049565953 8:143339107-143339129 GGGACTGCCCAGGTGGGAGGCGG + Intronic
1053058050 9:35005821-35005843 GGTCCTGCACAGATGGGACGCGG - Intergenic
1053413174 9:37928847-37928869 TGTGCTGCTCAGGTGGGACTAGG - Intronic
1056249401 9:84732707-84732729 CCTGCTGCCCAGGTGAAAGGGGG + Intronic
1056601435 9:88050197-88050219 CCTGCTGCCCAGGTGTGGGGTGG + Intergenic
1061605419 9:131706463-131706485 CATGCTGCCCAGGTTGGTCTTGG + Intronic
1062024012 9:134332219-134332241 AGTGCTGCCCTGGTGGCATGAGG - Intronic
1062044150 9:134417493-134417515 AGTGCCGCCCAGCTGGGGCGAGG - Intronic
1062363887 9:136199838-136199860 CGGGATGCCCAGCTGGCACGCGG + Exonic
1062463005 9:136669668-136669690 CGTGCTGCCCCGGCTGGAAGAGG + Exonic
1062591764 9:137277651-137277673 GGTGCGGCCCAGGCGGGACTTGG - Intergenic
1062634057 9:137480723-137480745 GGGGCTGCCCAGGCGGGAAGCGG + Intronic
1203520931 Un_GL000213v1:44053-44075 CGCGCTGCTCAGGTGCGACCAGG - Intergenic
1185461751 X:335962-335984 CGTGTTGCCCAGGTTGGTCTTGG - Intronic
1187976480 X:24709350-24709372 CGTGCTGTCCGGGAGGGAGGTGG - Intronic
1192795452 X:74421487-74421509 CGGGCTGGCCAGCTGGGGCGCGG + Exonic
1194367124 X:93025267-93025289 GGTCCTGCACAGATGGGACGTGG - Intergenic
1196300031 X:114042317-114042339 GGTCCTGCACAGATGGGACGCGG - Intergenic
1201307487 Y:12563304-12563326 GGTCCTGCACAGATGGGACGTGG + Intergenic