ID: 975657161

View in Genome Browser
Species Human (GRCh38)
Location 4:76653265-76653287
Sequence CCCAAACAGTAACAGCACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975657161_975657167 11 Left 975657161 4:76653265-76653287 CCTTGGTGCTGTTACTGTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 125
Right 975657167 4:76653299-76653321 CTTTGTTGTTGGGTCTGCCCTGG 0: 1
1: 0
2: 3
3: 26
4: 180
975657161_975657166 1 Left 975657161 4:76653265-76653287 CCTTGGTGCTGTTACTGTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 125
Right 975657166 4:76653289-76653311 TTGGATAGTTCTTTGTTGTTGGG 0: 1
1: 3
2: 32
3: 214
4: 760
975657161_975657168 21 Left 975657161 4:76653265-76653287 CCTTGGTGCTGTTACTGTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 125
Right 975657168 4:76653309-76653331 GGGTCTGCCCTGGCCATTGAAGG 0: 1
1: 0
2: 1
3: 29
4: 282
975657161_975657165 0 Left 975657161 4:76653265-76653287 CCTTGGTGCTGTTACTGTTTGGG 0: 1
1: 0
2: 0
3: 18
4: 125
Right 975657165 4:76653288-76653310 GTTGGATAGTTCTTTGTTGTTGG 0: 1
1: 17
2: 129
3: 379
4: 907

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975657161 Original CRISPR CCCAAACAGTAACAGCACCA AGG (reversed) Intronic
900578307 1:3395033-3395055 CCCAGACAGGAACTGCACGAAGG - Intronic
903499749 1:23794485-23794507 CCCAAACCGTACGGGCACCATGG - Exonic
904498703 1:30902078-30902100 CCAAAACAGACATAGCACCAAGG + Intronic
904961956 1:34340367-34340389 CCCAAACAGTAACTACAACATGG - Intergenic
906444640 1:45884907-45884929 CCCAAACAGTTAAAGTTCCATGG + Intronic
911080171 1:93921004-93921026 CGCAAACAGTAACACCACAATGG + Intergenic
916886919 1:169078393-169078415 GCTAAACAGTAGCAGCAACAAGG - Intergenic
920265791 1:204721625-204721647 CCATTACAATAACAGCACCAAGG + Intergenic
920328821 1:205189668-205189690 CACAAACAGTAACACCAAAAGGG + Intronic
920671916 1:208010183-208010205 CCCAAAGTGTTACAGCAACAGGG + Intergenic
920982351 1:210849830-210849852 CACAGACAGTAACAGCAGGAAGG - Intronic
921802536 1:219417886-219417908 CCCACTCAGTATCAGCACCTTGG - Intergenic
922462811 1:225826138-225826160 CCCAAGCAGTAACAGTGCCTGGG - Intronic
923297077 1:232604559-232604581 CCCAAACAGATACACCACCTTGG - Intergenic
923455393 1:234161144-234161166 CACAAAAAGTAACTGAACCAAGG - Intronic
923660727 1:235954885-235954907 CCCAAACAGGAACTGCTGCAAGG + Intergenic
1063506105 10:6601192-6601214 CCCCAACCGTTTCAGCACCAGGG + Intergenic
1064329711 10:14382209-14382231 CCCCAGCTGTAACAGCGCCAGGG + Intronic
1069605911 10:69738447-69738469 CGCAATCAGCAACATCACCACGG + Intergenic
1071757263 10:88556963-88556985 ACCAAACATTAAAAGCTCCAAGG - Intronic
1073426516 10:103458548-103458570 GCCAAGCAGAAAGAGCACCAGGG + Exonic
1078342133 11:10505224-10505246 CCCAACCAGTGACATCACCCAGG - Intronic
1079246623 11:18756954-18756976 AACAAAAAGAAACAGCACCAAGG + Intronic
1080764485 11:35282634-35282656 CCCAAACAGACAGAACACCAGGG + Intronic
1081412323 11:42774402-42774424 CCCCAATTGTAACTGCACCAAGG - Intergenic
1081680254 11:44997550-44997572 CCCAAACAGCCCCATCACCAAGG - Intergenic
1085241442 11:75059702-75059724 CCCAAAAAGCAAAAGTACCAAGG - Intergenic
1088913537 11:114209952-114209974 CCTAATAAGTAGCAGCACCAGGG - Intronic
1089466890 11:118691237-118691259 GCAAAACAGTAACAGAAGCACGG - Intergenic
1094490853 12:30959855-30959877 GCCAGACAGTAAGAGCACCGAGG + Intronic
1096047928 12:48580727-48580749 CCCTGACAGTAACATGACCATGG + Intergenic
1096548717 12:52358538-52358560 CCCAAAAAATAACGGCACCATGG - Intergenic
1100793938 12:98160038-98160060 CCCTTACAGTAACAGTAACAAGG + Intergenic
1102015361 12:109644702-109644724 CCCACACATTCACAGCTCCAAGG - Intergenic
1105412246 13:20180171-20180193 CTAAAACAGTAACAGCAACAAGG + Intergenic
1105821117 13:24081906-24081928 CCCAGAGAGCACCAGCACCAGGG - Intronic
1105889386 13:24671332-24671354 CTCCAACAATGACAGCACCAAGG - Intergenic
1108465714 13:50713653-50713675 CCTAAACAGCAACAGCATCATGG + Intronic
1108642739 13:52397584-52397606 CCCAAGCAGCTTCAGCACCACGG + Exonic
1113308898 13:109110062-109110084 GCCAAACAGTAACACAAACATGG - Intronic
1114130070 14:19781062-19781084 CCCAAACATTAGCACCACAATGG - Exonic
1115145341 14:30219663-30219685 GCCAAACAGTGACAGAAACATGG - Intergenic
1115432146 14:33331586-33331608 CAGAAACAGTAATAGCACCGAGG - Intronic
1123573341 15:21638746-21638768 CCCAAACATTAGCACCACAATGG - Exonic
1123609963 15:22081364-22081386 CCCAAACATTAGCACCACAATGG - Intergenic
1126800238 15:52291569-52291591 CCCAAACAGAAACGACGCCAGGG + Intronic
1202982209 15_KI270727v1_random:373159-373181 CCCAAACATTAGCACCACAATGG - Intergenic
1141692942 16:85606786-85606808 CCCAGACAGTAACAGGGCAAGGG + Intergenic
1143975830 17:10828892-10828914 TCCAAACTGTAACATTACCAAGG - Intronic
1146723388 17:35138888-35138910 CACAAGCAGAAACTGCACCAAGG - Intronic
1149297044 17:55270627-55270649 CCAAAACATTAACAGTGCCAAGG - Intronic
1151859943 17:76753185-76753207 CCCAAACAGTCATAGCAGCAAGG + Intronic
1151881239 17:76896044-76896066 CCCACACGGTGACAACACCAAGG + Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1154057977 18:11029875-11029897 CCCAACCAGTAATTCCACCATGG + Intronic
1155279904 18:24228776-24228798 CCCAAGCAATAAGAACACCATGG + Intronic
1156456750 18:37299152-37299174 CCCACTCAGTCACCGCACCATGG + Intronic
1162023473 19:7879571-7879593 CCCAAACCGTACGGGCACCATGG + Intergenic
1163041841 19:14608455-14608477 GCCAGACAGGGACAGCACCAGGG + Intronic
1164021565 19:21311876-21311898 CCCAAACAGAAACAGCCCTATGG + Intronic
1164128248 19:22337982-22338004 GCAAAAGAGTAACATCACCATGG + Intergenic
1164171233 19:22727344-22727366 GCAAAAGAGTAACATCACCATGG - Intergenic
1165794205 19:38509254-38509276 CCCAGTAAGTAACAGAACCATGG - Intronic
1167762592 19:51458759-51458781 CACAAACAGTGACAGCCCCGGGG - Intergenic
1167969776 19:53181784-53181806 CCCAAACACTACCTCCACCACGG + Intronic
926599154 2:14822962-14822984 TCCAAACAGTGACAGACCCAGGG + Intergenic
926955341 2:18288911-18288933 CCCAAACACGAACTGCACAAAGG - Intronic
927282493 2:21321595-21321617 CCCAGAGAGGAACAGCAGCATGG - Intergenic
929779232 2:44947059-44947081 CCCCAGCAGCACCAGCACCAGGG + Intergenic
930723821 2:54663667-54663689 CCCAAACAAAGACAGAACCAGGG - Intronic
931176153 2:59857060-59857082 CCCAAAGAGTAACAGTGCCCAGG + Intergenic
931177790 2:59870888-59870910 CCCAAAGAGTATTAGCACCCTGG - Intergenic
933071981 2:77870701-77870723 CCCCAACATTTTCAGCACCAGGG + Intergenic
933690159 2:85173403-85173425 GAAAAACAGAAACAGCACCATGG + Intronic
934331344 2:92072946-92072968 CGCAAAAAGCCACAGCACCAAGG - Intergenic
934851012 2:97701250-97701272 CCCAAGCAGCAACAGCACGATGG - Intergenic
937076650 2:119112284-119112306 CCCAAACAGCCACATCACCCAGG + Intergenic
939218969 2:139277838-139277860 CCCAAGCTGTAAAACCACCAGGG - Intergenic
940020025 2:149146711-149146733 CCCAAATATTAACAACCCCAAGG + Intronic
941067441 2:160919330-160919352 CCCAAACAGTACCCTCACAATGG + Intergenic
945945851 2:215994921-215994943 CCAAAACAGTAACAGCAATACGG - Intronic
1170560648 20:17555350-17555372 CCCAAACAATTACAGAAACATGG + Intronic
1174424685 20:50423613-50423635 CCAAGACAGGAATAGCACCAGGG + Intergenic
1181138567 22:20786866-20786888 TCCAAACAGTTCAAGCACCAAGG + Exonic
1181639068 22:24187421-24187443 CCCAAACAGGAACAGCTCCTGGG - Exonic
949455482 3:4233840-4233862 TCCTCAAAGTAACAGCACCAGGG + Intronic
950072768 3:10165407-10165429 CCCAAGAAGTGACAGCACCGTGG - Intronic
953259911 3:41327759-41327781 CCCAAACTATAATAGCATCAAGG + Intronic
953420955 3:42752777-42752799 CTCCACCACTAACAGCACCAGGG + Intronic
953948620 3:47170370-47170392 CCCAAACAATACCAGGACCTTGG - Intergenic
955442399 3:58970914-58970936 CCCAAACAGTAACTTCTCCAAGG - Intronic
956199196 3:66689032-66689054 CCCCAACAGAAGCAGCACTAAGG - Intergenic
959188896 3:103084375-103084397 CCTAGACAGCAAGAGCACCAAGG - Intergenic
959764929 3:110014208-110014230 GCTAAACAGGAACAGCAGCAAGG + Intergenic
970227504 4:13874915-13874937 ATCACATAGTAACAGCACCAGGG - Intergenic
971227870 4:24771613-24771635 TCCAAACACCAACAGCTCCAGGG + Intergenic
974514718 4:62894929-62894951 CCCTAACCCTAACATCACCAGGG - Intergenic
975495692 4:75033916-75033938 TCCAAACACCAGCAGCACCACGG - Exonic
975657161 4:76653265-76653287 CCCAAACAGTAACAGCACCAAGG - Intronic
976654017 4:87468015-87468037 GCAAAACAATAACAGCAACAAGG + Intergenic
978975474 4:114864849-114864871 CCCAGACAGACACAGAACCATGG - Intronic
981044316 4:140252186-140252208 CCCACACAGTCACAGCAGCAGGG + Intergenic
981541201 4:145847994-145848016 CCCAGGCAGTGACAGCGCCAGGG + Intronic
984617264 4:181912997-181913019 CTAAAGCAGTAACAGCACAAGGG + Intergenic
984877158 4:184379643-184379665 CCCAAGCAGTGGCAGCTCCAGGG - Intergenic
988319827 5:29680425-29680447 CTATAACAGTAACAGCACAAAGG - Intergenic
992982140 5:82186930-82186952 CCCAAACAGGAAAAGCACAATGG - Intronic
995024941 5:107409315-107409337 CCCAACCATTAAAAGCACCAAGG + Intronic
997311828 5:132892253-132892275 GTCAAGCAGTAACAGCAACAAGG - Exonic
1003518632 6:6838547-6838569 CCCACAAAGTAAAACCACCAGGG - Intergenic
1004564445 6:16782166-16782188 CCCACACAGAAACAGGCCCATGG - Intergenic
1005813098 6:29531023-29531045 GCCAAACAGGAACAGCTTCAGGG - Intergenic
1005848707 6:29802369-29802391 CCCAAACAGGAACAGTACCCAGG + Intergenic
1005860715 6:29897739-29897761 CCCAAACAGGAACAGTACCCAGG + Intergenic
1006327589 6:33365692-33365714 CCCAAACCGTACGGGCACCATGG + Intergenic
1007392870 6:41560679-41560701 CCCAAACAGGCACAATACCAGGG - Intronic
1008703928 6:54134690-54134712 CCCTAACAGTTACAGCTCTATGG + Intronic
1009940480 6:70283002-70283024 CCCCAACAGCAGCAGCCCCAGGG + Intronic
1010792002 6:80075536-80075558 CCAAAACAGTCACACCACCTGGG - Intergenic
1011440861 6:87385782-87385804 CAATAACAATAACAGCACCATGG + Intronic
1013277201 6:108596857-108596879 CCCAAACAGTTGCAGCTCAAAGG + Intronic
1015686720 6:135871391-135871413 CCCAAACAGCAGAAGCAACAGGG + Intronic
1019721250 7:2572942-2572964 CCCAACCAGTAAAAGCAGGAAGG - Intronic
1021882546 7:25108662-25108684 CCAAAACATCAATAGCACCAAGG - Intergenic
1026467508 7:70667183-70667205 CCCGCACATTAACTGCACCAGGG + Intronic
1029852913 7:103483481-103483503 CGAAAACAGTAACAGCACTTTGG + Intronic
1032681773 7:134192269-134192291 CTCAAACAGGAACATGACCATGG - Intronic
1035705467 8:1671247-1671269 CCAGAACAGGAACAGAACCAGGG - Intronic
1036381999 8:8241704-8241726 TCCACACAATAACAGAACCAGGG - Intergenic
1045829849 8:106445941-106445963 CAGAAACAGTAACAAGACCAGGG + Intronic
1046521811 8:115334587-115334609 CCCAAACAGAAACACCAGGATGG + Intergenic
1055468624 9:76590158-76590180 CCCAAACATCAACAGTGCCAAGG - Intergenic
1056719872 9:89062573-89062595 GACAAACAGTAACAGCATCGAGG + Intronic
1058663265 9:107284458-107284480 CCCAAACAGTAGCAGTTCAAGGG + Intronic
1060138353 9:121180522-121180544 CCCAAACACTGCCAGCACCAAGG + Exonic
1060978636 9:127779786-127779808 CATTAACAGTAACAGCCCCAGGG + Intergenic
1062256003 9:135621090-135621112 CACAGACAGTATCAACACCACGG + Intergenic
1185821794 X:3212204-3212226 CCATAACACAAACAGCACCAAGG - Intergenic
1185835569 X:3343780-3343802 CCAAAGCAGGATCAGCACCACGG + Exonic
1186808083 X:13160283-13160305 CCCAAACATAAGCAGCCCCAAGG - Intergenic
1189704838 X:43749614-43749636 TCCAAACAGTAACACCTCAATGG + Intergenic
1191196964 X:57734419-57734441 CCCAAACAGTGCAATCACCAGGG + Intergenic
1197992185 X:132330124-132330146 TCCAAACATTAACAGTACCAAGG - Intergenic
1200038739 X:153350457-153350479 CCCCAAGAGGAACAGCAGCAAGG + Exonic