ID: 975658822

View in Genome Browser
Species Human (GRCh38)
Location 4:76668101-76668123
Sequence GTGCTCCTTCGGTGAGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 11, 3: 15, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975658813_975658822 19 Left 975658813 4:76668059-76668081 CCACCGCTGCAGCCTCCTCCTGC 0: 1
1: 1
2: 15
3: 173
4: 1191
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92
975658818_975658822 1 Left 975658818 4:76668077-76668099 CCTGCAGCTCCTGGTGCTGCTTG 0: 1
1: 3
2: 7
3: 87
4: 679
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92
975658814_975658822 16 Left 975658814 4:76668062-76668084 CCGCTGCAGCCTCCTCCTGCAGC 0: 1
1: 1
2: 7
3: 134
4: 1122
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92
975658811_975658822 26 Left 975658811 4:76668052-76668074 CCCTTGTCCACCGCTGCAGCCTC 0: 1
1: 0
2: 5
3: 35
4: 284
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92
975658816_975658822 7 Left 975658816 4:76668071-76668093 CCTCCTCCTGCAGCTCCTGGTGC 0: 1
1: 0
2: 12
3: 135
4: 931
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92
975658817_975658822 4 Left 975658817 4:76668074-76668096 CCTCCTGCAGCTCCTGGTGCTGC 0: 1
1: 0
2: 12
3: 129
4: 954
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92
975658819_975658822 -8 Left 975658819 4:76668086-76668108 CCTGGTGCTGCTTGTGTGCTCCT 0: 1
1: 4
2: 3
3: 23
4: 245
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92
975658812_975658822 25 Left 975658812 4:76668053-76668075 CCTTGTCCACCGCTGCAGCCTCC 0: 1
1: 0
2: 5
3: 45
4: 438
Right 975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG 0: 1
1: 0
2: 11
3: 15
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975658822 Original CRISPR GTGCTCCTTCGGTGAGGACC TGG Intronic
903180339 1:21602018-21602040 CTGCTCCTGTGGAGAGGACCTGG - Intronic
903663512 1:24993171-24993193 CTGGCCCTGCGGTGAGGACCTGG - Intergenic
903797045 1:25937157-25937179 GAGCTCCTTGGGTGATGGCCAGG + Intergenic
904772074 1:32886270-32886292 GTGCTCCCTCGAGGGGGACCGGG + Intronic
916513254 1:165492297-165492319 GTGCTAATTTGGTCAGGACCTGG - Intergenic
917674899 1:177309718-177309740 GTGCTCCTTCTGGGAGGGCTAGG - Intergenic
920209874 1:204320339-204320361 GTGCTTCTTAGGTGGGGAGCTGG + Intronic
922879863 1:228972603-228972625 GACCTCCTTGGGTGAGGCCCGGG + Intergenic
1067524340 10:47029186-47029208 CTGCTTCTTCCGTGAGGATCTGG - Intergenic
1069784348 10:70978315-70978337 GTGCTCCTTAGGTTAAGCCCAGG - Intergenic
1074767030 10:116707014-116707036 GGGCTCCTTTGGCCAGGACCAGG + Intronic
1074776775 10:116773024-116773046 GGGCTCATTCAGTCAGGACCGGG + Intergenic
1084051140 11:66600747-66600769 GTGCTCCTTGGGTCAGGCACTGG - Intronic
1084977809 11:72812926-72812948 GTGCCCCTTAGGGCAGGACCTGG - Intergenic
1085689305 11:78652457-78652479 CGGCTCCTTCCCTGAGGACCTGG + Intergenic
1089747447 11:120627308-120627330 CTTCTCCTTTGGAGAGGACCGGG - Intronic
1091455574 12:604900-604922 GTGCTCTTGCGGTGTGGTCCAGG + Intronic
1094853682 12:34393544-34393566 GTGCTCCATGGGTGTGAACCAGG - Intergenic
1094856463 12:34405068-34405090 GTGCTCCTTGGGTGCCAACCAGG - Intergenic
1095395202 12:41755481-41755503 CTTCTCCTTCTGTGAGGACAGGG + Intergenic
1097179446 12:57162931-57162953 GTGCGCCTGTGCTGAGGACCAGG + Exonic
1097313849 12:58151314-58151336 GAGCTCATTGGGTGAGGACAAGG + Intergenic
1102119618 12:110429923-110429945 CTGCTCCTCCAGTGAGGAGCAGG + Intergenic
1102998847 12:117369914-117369936 GTCCTCCTTCGGGGAGCCCCTGG + Intronic
1105929718 13:25041186-25041208 GAGCTCCATGGGTGAGGAGCAGG + Intergenic
1113806152 13:113110802-113110824 GTGCTCCTTCGAGGAGGCCCGGG + Exonic
1122627561 14:103092008-103092030 GTTCACCTTGGCTGAGGACCTGG - Intergenic
1125447831 15:39776839-39776861 GTGTTCCCTCGGGGAAGACCAGG - Intronic
1128388609 15:67167660-67167682 GTGCTCCTGCCGTGAGGGGCAGG + Intronic
1130909893 15:88263626-88263648 GGGCTGCTTTGGTGAGGAGCAGG - Intergenic
1132717530 16:1299404-1299426 GTGCTCCTTGGGCCAGGATCCGG - Intergenic
1135296337 16:21282768-21282790 GTGCTACTTTACTGAGGACCTGG - Intronic
1135643606 16:24142516-24142538 GTCCTCCTCCAGTGAGGGCCAGG + Intronic
1141155263 16:81592810-81592832 AGGCTGCTTTGGTGAGGACCTGG + Intronic
1141248608 16:82333984-82334006 GTGCTCCTTCTGAGAGCTCCAGG - Intergenic
1148598366 17:48875236-48875258 GTGCTCATTTGGTGCGGACCTGG - Intergenic
1148802113 17:50235777-50235799 GTGCTTGTTCAGTGAGGACCTGG + Intergenic
1151612099 17:75182880-75182902 GTGCTCGTTTGGTGCGGACCTGG - Intergenic
1155250542 18:23949409-23949431 CTGCTCCATCTGTGAGGACCAGG + Intronic
1160271729 18:77392842-77392864 GTGCTCCTTGCCTGAGGAACAGG - Intergenic
1160662840 19:309010-309032 GTGCTCCTTCTGTGCTGTCCCGG - Intronic
1160720731 19:595924-595946 GGGCTCCTGCGGGGAGGGCCTGG + Intronic
1161474293 19:4475573-4475595 GCGCCCCTCCGGTGAGTACCCGG + Exonic
1163823063 19:19507388-19507410 GTGCTCCTTCTGGGAGGAGCTGG - Exonic
1164843649 19:31413433-31413455 GTGCTCATTCTGTGATGACAGGG + Intergenic
1165354623 19:35295908-35295930 GTACTACTTCCGTGGGGACCTGG + Exonic
1168514823 19:57002506-57002528 GTGCTCCCTAGGGGAGGACAGGG - Intergenic
925449229 2:3953826-3953848 GTGCTCGCTCCTTGAGGACCTGG - Intergenic
926801378 2:16663872-16663894 GTGATCCCTCGGACAGGACCAGG + Intronic
927044349 2:19262292-19262314 GTGCTGCAGGGGTGAGGACCTGG - Intergenic
938070082 2:128303748-128303770 GTGGCCTTTGGGTGAGGACCTGG - Intronic
938174153 2:129108915-129108937 GTGCTCCTCCAGTGAACACCAGG - Intergenic
946254137 2:218430868-218430890 GGGCTCCGTGGGTGAGGGCCAGG + Exonic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
1173148746 20:40547789-40547811 GTGCTCATTTGGTGAGAATCAGG + Intergenic
1183886457 22:40887295-40887317 GTCCTCCCTAGGTGAGGGCCAGG + Intronic
1185173145 22:49305059-49305081 GGGCTCCTGCAGTGGGGACCTGG - Intergenic
955213327 3:56962254-56962276 CCCCTCCTTTGGTGAGGACCTGG - Intronic
962359430 3:134725443-134725465 CTGCCCCTTCGGTGGGGAGCAGG - Intronic
969129418 4:4980705-4980727 GAGCTCCCTCCGTGAGGCCCAGG + Intergenic
969701293 4:8769230-8769252 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701309 4:8769299-8769321 GTGCTCCTCGGGTGAGGAGGGGG + Intergenic
969701315 4:8769322-8769344 GTGTTCCTTGGGTGAGGACCTGG + Intergenic
969701326 4:8769368-8769390 GTGCTCCCTGGGTGAGGACCTGG + Intergenic
969701334 4:8769391-8769413 GTGCTCCTCGGGTGAGGACCTGG + Intergenic
969701342 4:8769437-8769459 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701350 4:8769483-8769505 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701358 4:8769529-8769551 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701366 4:8769552-8769574 GTGCTCCTCGGGTGAGGAGGTGG + Intergenic
969701370 4:8769575-8769597 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701381 4:8769644-8769666 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701389 4:8769667-8769689 GTGCTCCTCGGGTGAGGAGGTGG + Intergenic
969701393 4:8769690-8769712 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701401 4:8769713-8769735 GTGCTCCTCGGGTGAGGAGGTGG + Intergenic
969701405 4:8769736-8769758 GTGCTCCTTGAGTGAGGACCTGG + Intergenic
969701420 4:8769805-8769827 GTGCTCCTTGGGTGAGGAGGTGG + Intergenic
969701428 4:8769850-8769872 GTGCTCCTTGAATGAGGACCTGG + Intergenic
971238515 4:24865916-24865938 GTGCTCCTAGGGACAGGACCTGG + Intronic
975329579 4:73099158-73099180 CTGCTCCTTCAGTGAGGCACAGG - Intronic
975658822 4:76668101-76668123 GTGCTCCTTCGGTGAGGACCTGG + Intronic
982090956 4:151879534-151879556 GAGCTCCTTAGGAGAGGAGCTGG + Intergenic
991673358 5:69069257-69069279 GTGCTCGTTTGGTGTGGACTTGG - Intergenic
993091403 5:83431010-83431032 CTGGTCCTTTGGTGAGGAACTGG - Intergenic
1002253959 5:177945361-177945383 GTGCTGCTTTGCTGAGGACAGGG + Intergenic
1002569048 5:180129713-180129735 GTGCGCCATCGCTGGGGACCAGG + Intronic
1004073036 6:12319369-12319391 ATTCTCATTCGGTGTGGACCTGG + Intergenic
1004407173 6:15343969-15343991 CTGATCCTGCGGAGAGGACCCGG + Intronic
1005826709 6:29636389-29636411 GTGCTCGTTTGGAGCGGACCTGG - Intergenic
1006474294 6:34244898-34244920 CTGCTCCTCCAGTGAGGAGCAGG - Exonic
1008594378 6:53026610-53026632 ATGCTCCATCGGTGAGGAGGTGG + Intronic
1019172800 6:170143677-170143699 GTGCGCCTTCAGTGAGGACGGGG + Intergenic
1019592334 7:1841894-1841916 GTGCTCCCTGGCTGAGAACCCGG + Intronic
1020332975 7:7039109-7039131 CTGCTTCTTCCATGAGGACCAGG - Intergenic
1023660718 7:42468631-42468653 GTGCATCTGCGGTCAGGACCAGG + Intergenic
1025050751 7:55732078-55732100 GTGCTCGTTTGGTGCGGACCTGG + Intergenic
1025194164 7:56919618-56919640 GAGCTCCTTGGGGGAGGATCTGG - Intergenic
1025677785 7:63657326-63657348 GAGCTCCTTGGGGGAGGATCTGG + Intergenic
1029672176 7:102040869-102040891 GAGCTCCTTGGGGGAGGATCTGG - Intronic
1031890597 7:127289282-127289304 GTCCTCCTTCGCTGAGCAGCAGG + Intergenic
1033069986 7:138193192-138193214 GTGCTCCTTGGGTGTGGACGTGG - Intergenic
1036662010 8:10714838-10714860 CTGCTCCATCGGTGGAGACCCGG + Intergenic
1037690477 8:21177461-21177483 CTGCTCCAGCAGTGAGGACCTGG - Intergenic
1041380363 8:57248312-57248334 GAGCTGCTTCGGTGAGAAGCAGG - Intergenic
1048446044 8:134494109-134494131 GTGCTCCCTGTGTGAGGACCGGG - Intronic
1049845587 8:144799235-144799257 GGGCTGCTCCGGGGAGGACCAGG + Intronic
1053375703 9:37604557-37604579 GTCCTCCTTCTGTGTGGACCAGG + Intronic
1061871817 9:133524891-133524913 GTGCTCCTGTGCTGGGGACCTGG - Exonic
1185431349 X:13666-13688 GTGGTCCTTAGGGGAGGAGCGGG - Intergenic
1185440587 X:225997-226019 GTGGTCCTTAGGGGAGGAGCGGG - Intergenic
1185440639 X:226127-226149 GTGGTCCTTAGGGGAGGAGCGGG - Intergenic
1188156408 X:26748369-26748391 CTGCTCCTCCAGTGAGGAGCAGG - Intergenic
1189114026 X:38325466-38325488 GTGCTCCTTTGTTGACGACTTGG - Intronic
1190640753 X:52481499-52481521 CTGCTCCTTCCATGAGGACAAGG + Intergenic
1190646919 X:52531366-52531388 CTGCTCCTTCCATGAGGACAAGG - Intergenic
1191977384 X:66888424-66888446 GTGCTCCTTCTGTGATGACTGGG + Intergenic
1192380899 X:70614691-70614713 GTGGGCCTTGGGTGAGAACCAGG + Intronic
1196440884 X:115719275-115719297 GTGCTCGTTTGGTGCGGACCTGG - Exonic
1198329626 X:135610042-135610064 GTACTCCTTCAGTTAGTACCAGG + Intergenic
1199758954 X:150890714-150890736 TTGCCCCTTCGCTGAGGACGAGG - Intronic