ID: 975660051

View in Genome Browser
Species Human (GRCh38)
Location 4:76679740-76679762
Sequence TGGTTATGTGCAGGATGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975660051_975660064 18 Left 975660051 4:76679740-76679762 CCTGTCCATCCTGCACATAACCA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 975660064 4:76679781-76679803 GCACATTCTCCTCGGTGACAAGG 0: 1
1: 0
2: 0
3: 11
4: 104
975660051_975660066 27 Left 975660051 4:76679740-76679762 CCTGTCCATCCTGCACATAACCA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 975660066 4:76679790-76679812 CCTCGGTGACAAGGACCTACCGG 0: 1
1: 0
2: 0
3: 4
4: 45
975660051_975660054 -4 Left 975660051 4:76679740-76679762 CCTGTCCATCCTGCACATAACCA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 975660054 4:76679759-76679781 ACCACCTCCCCACACTCCCCAGG 0: 1
1: 1
2: 8
3: 61
4: 443
975660051_975660060 10 Left 975660051 4:76679740-76679762 CCTGTCCATCCTGCACATAACCA 0: 1
1: 0
2: 0
3: 18
4: 162
Right 975660060 4:76679773-76679795 CTCCCCAGGCACATTCTCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975660051 Original CRISPR TGGTTATGTGCAGGATGGAC AGG (reversed) Intronic
901282167 1:8046359-8046381 TGGTTAGTTGCAGGATGAATGGG + Intergenic
903834126 1:26191637-26191659 TGGATTTGTACAGGAGGGACAGG + Intronic
907356806 1:53882289-53882311 GGGTCATGTGCAGGAGGTACAGG - Intronic
908043872 1:60147128-60147150 TGGTTTAGTGCAGGAAGTACAGG - Intergenic
908276782 1:62481308-62481330 TGTTTGTGTGCAGAATGGAGTGG + Intronic
909486594 1:76180797-76180819 TGGCTCTGAGCAGGATGGATGGG - Intronic
910182125 1:84496536-84496558 GGTATATGTGCAGGATGTACAGG - Intronic
910324517 1:85990249-85990271 GGCTTATCTGGAGGATGGACAGG - Intronic
910629187 1:89339038-89339060 TTTTGATTTGCAGGATGGACTGG + Intergenic
911019220 1:93370140-93370162 TGGCAATGTGAAGGATAGACTGG - Intergenic
913430492 1:118785835-118785857 TGGTTATGTTCTGTAGGGACGGG - Intergenic
915610663 1:156989380-156989402 TGGTGGAGTGCTGGATGGACTGG - Intronic
916206317 1:162319353-162319375 TGGTGGTGTGGAGGATGGATTGG - Intronic
916207366 1:162328332-162328354 GGTACATGTGCAGGATGGACGGG - Intronic
916928414 1:169548316-169548338 TACTTATGTGCAGGATGTGCAGG - Intronic
920395141 1:205639700-205639722 TGGCAATGTGGAGGATGGGCTGG - Intergenic
921946199 1:220887630-220887652 GGGTTGTGTGCAGGAGGGGCGGG - Intergenic
1064972277 10:21078051-21078073 GGGTTGTGTGCAGAATGGACGGG + Intronic
1067876970 10:50016122-50016144 TGCTTCTGTGCAGGAAGGGCAGG - Intergenic
1069865256 10:71498424-71498446 TGGGGAAGTTCAGGATGGACTGG - Intronic
1070546867 10:77459214-77459236 AGGTGATGTGCAGGAAGGGCTGG - Intronic
1070959832 10:80490840-80490862 TGATTCTGTGCAGGAGGGCCTGG + Intronic
1071167701 10:82825883-82825905 TGTTAATGTGCAAGATGGAGTGG + Intronic
1071469730 10:85975300-85975322 TGCTGAGGTGCAGGGTGGACAGG + Intronic
1071739695 10:88343185-88343207 TGGTTATTTGAAGAATGAACTGG + Intronic
1075556760 10:123438367-123438389 TGTTTATATGCAGGATCAACAGG - Intergenic
1080234024 11:30048061-30048083 GGGTCATGTGCAGGATGTGCAGG + Intergenic
1080508068 11:32937615-32937637 TGACAATGTGGAGGATGGACTGG - Intronic
1080699493 11:34632403-34632425 TGTTTATGTGTAGGAGGGTCAGG - Intronic
1084126940 11:67105371-67105393 TGGTTATGGGCCGGATGCAGTGG - Intergenic
1085769572 11:79312754-79312776 TGGTGAGGTGCAAGATGGAATGG + Intronic
1087267034 11:96071794-96071816 TAGGTATATGCAGGATGGACTGG - Intronic
1088318491 11:108531196-108531218 TGGTGATGTGAAGGATGGAGAGG - Intronic
1088820036 11:113448923-113448945 TGGGCATGTGCAGGATGGTCAGG - Intronic
1092951643 12:13509158-13509180 TGGTGATGTGTAGAATGGATTGG + Intergenic
1095708700 12:45265666-45265688 CAGTGATGTGCAGAATGGACTGG - Intronic
1095864132 12:46952837-46952859 TGGATGTGTGCAGGATGTACAGG - Intergenic
1097168513 12:57098950-57098972 TGCTTATCTGCAGGAAGGAGGGG - Intronic
1098681623 12:73363245-73363267 TTGATGTGTGCAGGTTGGACTGG - Intergenic
1099148534 12:79078559-79078581 GGTTCATGTGCAGGATGTACAGG + Intronic
1099793866 12:87371218-87371240 TGGTTATGAGCACCAGGGACTGG - Intergenic
1101045743 12:100803977-100803999 CGGTAATGTGCAGGATGTGCAGG + Intronic
1104955786 12:132465248-132465270 TGTTTAGGTGCAGGTTGGAGAGG + Intergenic
1106785111 13:33099790-33099812 TGGTTTTGTTGAGGATGGACTGG - Intergenic
1108059705 13:46520213-46520235 TGGTTTTGTTGAGGATGAACTGG - Intergenic
1110433896 13:75458191-75458213 TGGATCTCTGCAGGATGGATGGG + Intronic
1112381731 13:98897252-98897274 TGGTGCTGTGAAGGGTGGACTGG - Intronic
1116911511 14:50471037-50471059 GGTATATGTGCAGGATGTACAGG + Intronic
1117126774 14:52637330-52637352 TGCTTCAGTGCAGGATGAACAGG - Exonic
1122098630 14:99389494-99389516 TGGTTTTGACCAGGGTGGACAGG + Intergenic
1125870935 15:43101302-43101324 TTGTTCTGTGCAGAATGGACAGG + Intronic
1126374353 15:47980303-47980325 TGGGTATGTGCAGCATGCAAAGG - Intergenic
1128682138 15:69659975-69659997 TGCTCATCTGCAGAATGGACAGG - Intergenic
1130516456 15:84629657-84629679 TGGTTAGGTGAGGGAAGGACAGG - Intergenic
1131442301 15:92468177-92468199 TGTGCATGTTCAGGATGGACGGG - Exonic
1133675834 16:8070939-8070961 TGCTTATGTGCAGGATGATTGGG + Intergenic
1135644266 16:24147575-24147597 TGGCTATGTGCAAGGTGGATAGG + Intronic
1135996595 16:27254291-27254313 TGGTTATGGCCAGGGTGAACAGG - Intronic
1139313408 16:66045879-66045901 GTGCTATGAGCAGGATGGACTGG - Intergenic
1143865328 17:9918965-9918987 TAGTCCTGTGCTGGATGGACAGG + Intronic
1143980017 17:10860874-10860896 TGGTTAACACCAGGATGGACAGG + Intergenic
1144722543 17:17481609-17481631 TCTTTATGTGCAGTATGGAAAGG - Intronic
1146638285 17:34521934-34521956 TGGTTGTGGGCCGGATGGGCAGG + Intergenic
1148915052 17:50969493-50969515 GAGTTGTGTGAAGGATGGACTGG - Intronic
1149208986 17:54281900-54281922 TGGTAATGTGTAGAAAGGACAGG - Intergenic
1153783410 18:8513984-8514006 GGTTAGTGTGCAGGATGGACTGG - Intergenic
1157401727 18:47394241-47394263 TGGGTAAGTGAAGGAAGGACAGG - Intergenic
1158193382 18:54856502-54856524 TTGTTATGTGGAGAATGGATGGG + Intronic
1160403036 18:78624967-78624989 GTGTTCTGTGCAGGATGGAAAGG + Intergenic
1162969553 19:14171979-14172001 TGGTTAAGAGCAGGATTGAAGGG - Intronic
1166617845 19:44267116-44267138 TGGCTATGTGGAGAATGGACTGG - Intronic
1167567790 19:50267768-50267790 GGGTTATTTGAAGGATGGACTGG + Intronic
926248738 2:11140938-11140960 TGGCAATGTGGAGGATGGATTGG - Intronic
926421459 2:12703876-12703898 TGGTTTTGTGCAGCAGGAACTGG + Intergenic
930020038 2:46996171-46996193 TGGTAAGATGAAGGATGGACTGG + Intronic
932003436 2:67905571-67905593 TGGTTGTTTGCAGGTTGGACTGG - Intergenic
933687885 2:85157806-85157828 TGGGTAGGGGCAGGATGGAGGGG + Intronic
934751464 2:96796753-96796775 TGTTTTTGTGGAGGAAGGACAGG - Intronic
935332561 2:101987819-101987841 GGGTGATGTGGAGGATGGACTGG + Intergenic
936931058 2:117789255-117789277 TAGTCATGGGCAGGAGGGACAGG - Intergenic
937004616 2:118500308-118500330 TGGTTATTGTCAGGATAGACTGG - Intergenic
937152719 2:119696885-119696907 GGGTCTTGTGAAGGATGGACAGG + Intergenic
938114954 2:128596532-128596554 GGGTTTTGTGCAGGCTGCACTGG + Intergenic
939417865 2:141924355-141924377 TGGCTCTCAGCAGGATGGACAGG - Intronic
940417532 2:153439986-153440008 TAGTTCTGTGCAGGATGTGCAGG + Intergenic
940948392 2:159644828-159644850 AAGTTTTGTGCAGTATGGACAGG + Intergenic
942003825 2:171677875-171677897 TGTATATGTGCAGGATGTGCAGG - Intergenic
942616077 2:177793419-177793441 TGGTTGTGTAGAGGGTGGACTGG + Intronic
1170442800 20:16395688-16395710 TGGTGATGACCAGGATGGCCAGG + Intronic
1171305534 20:24102641-24102663 TGGCCATGGGCAGGATGGGCTGG - Intergenic
1172404036 20:34674481-34674503 AGGTTACTTACAGGATGGACAGG - Intronic
1175626424 20:60491979-60492001 TGGGTATGTGAAGAATGAACGGG - Intergenic
1175668557 20:60881299-60881321 TGTACATGTGCAGGATGCACAGG + Intergenic
1178326118 21:31646812-31646834 TGGCTCTGTGAATGATGGACAGG + Intergenic
1179453480 21:41481452-41481474 TGCTTATGAGTAGGAGGGACGGG + Intronic
1181009519 22:20032318-20032340 TGGTTGTGTGCAGGCTGCCCTGG + Intronic
1183005373 22:34896974-34896996 TGGTGATATGCAGGAAGCACTGG + Intergenic
950310087 3:11949546-11949568 TGGTTTTGTTCAGGGGGGACAGG + Intergenic
953446894 3:42976137-42976159 CAGTAATGTGCAGGATGGATTGG + Intronic
953598539 3:44340032-44340054 GGGCTAAGTGCAGTATGGACAGG + Intronic
953793010 3:45962712-45962734 TGGTGATGGGGAGGATGGGCAGG + Intronic
954154861 3:48679781-48679803 ATGGTATGTGCAGGATGGAGGGG - Exonic
954759075 3:52861037-52861059 TGGTGCTTTGCAGGATGGAGGGG + Intronic
957812550 3:85245065-85245087 TGCTTATGTACAGGATTGTCTGG - Intronic
959376422 3:105593750-105593772 TGGCTTTCAGCAGGATGGACGGG + Intergenic
959629441 3:108491625-108491647 TGGTAATGGGCAGGATGGTGTGG - Intronic
961469880 3:127105030-127105052 TGGTTATGCCCAGGCTGGGCGGG + Intergenic
962980878 3:140488874-140488896 TGGCTATGTGCAGGAAATACTGG + Intronic
965256352 3:166418490-166418512 TGTATATGTGCAGGATGTGCAGG + Intergenic
965346113 3:167552838-167552860 TAATTATGTGCAGGATGGGATGG - Intronic
965551671 3:169972115-169972137 TGGCTGTGTGTAGGATGAACTGG - Intronic
965572454 3:170185648-170185670 TAGCTTTGTGAAGGATGGACTGG + Intergenic
966756235 3:183374104-183374126 TGGTGGTGTGTAGGATGGATTGG - Intronic
966923131 3:184627397-184627419 TGGGAATGTGCAGGAGAGACCGG - Intronic
967344399 3:188438002-188438024 TGGGTAGGGACAGGATGGACAGG + Intronic
968746331 4:2362501-2362523 TGGGCATGTGCAGGAGGGGCTGG - Intronic
973068009 4:45821685-45821707 TGGCCATGAGCAGGATGGATGGG + Intergenic
975660051 4:76679740-76679762 TGGTTATGTGCAGGATGGACAGG - Intronic
976521043 4:86027072-86027094 TATTTATGTGCATGATGGAGAGG - Intronic
977193004 4:94023660-94023682 AGTACATGTGCAGGATGGACAGG - Intergenic
977939332 4:102841896-102841918 TGGTGATGTGCAAGATAGTCTGG - Intronic
978819814 4:112953388-112953410 TGCTTCTGTGCAAGATGCACAGG + Intronic
979436743 4:120702179-120702201 CTGTTATGTGAAGCATGGACTGG - Intronic
979770338 4:124516505-124516527 TGGTTATTTGCAGGATTGCCTGG - Intergenic
983676190 4:170296145-170296167 TGGTTGTGTGCAGGAAGAAATGG + Intergenic
986639379 5:9857543-9857565 GGTATATGTGCAGGATGTACAGG - Intergenic
991016472 5:61938182-61938204 TGGGTATGTGAAGGATGAATGGG + Intergenic
992066907 5:73117639-73117661 TGGTCATCTGAAGGCTGGACTGG - Intergenic
994302893 5:98167021-98167043 AGTATATGTGCAGGATGTACAGG + Intergenic
994819296 5:104628150-104628172 TGGCTATCAGCAGGATGGATGGG - Intergenic
996246386 5:121269420-121269442 TGATAATGCACAGGATGGACAGG + Intergenic
996532629 5:124542276-124542298 TGGGCTTGTGCAGAATGGACTGG - Intergenic
996884527 5:128339784-128339806 TGTCTCTGTGCAGGAGGGACTGG + Intronic
998910180 5:146951375-146951397 TGTATATGTGCAGGATGTGCAGG + Intronic
999242102 5:150133682-150133704 TGGGGATGTGCAGGATGGAGCGG + Exonic
1001913290 5:175538907-175538929 TGGTAGTGTGGAGGATGGACCGG - Intergenic
1002053212 5:176583728-176583750 CAGTTGTGTGCAGGAGGGACAGG + Intronic
1002294602 5:178223388-178223410 TGGCCATGTGGAGGATGGACTGG - Intronic
1002294701 5:178223924-178223946 GGGCTATGTGGAGGATGGATTGG - Intronic
1002888639 6:1316524-1316546 TGGGTGTGTGAAGGAGGGACAGG - Intergenic
1004353500 6:14911682-14911704 TCGTTAAGTGCAGGAGGCACAGG + Intergenic
1006505416 6:34485908-34485930 TGGAGATGGGGAGGATGGACAGG + Intronic
1007184376 6:39955774-39955796 TGTACATGTGCAGGATGTACAGG - Intergenic
1007778161 6:44235420-44235442 TGGCCATGTGTGGGATGGACTGG - Intergenic
1007782555 6:44262925-44262947 TGGGTGTGGGCAGGCTGGACAGG - Intronic
1007900790 6:45410217-45410239 TGGCAATGTGGAGGATAGACTGG + Intronic
1010501342 6:76604184-76604206 GGATTATGTGCAGGACGTACAGG - Intergenic
1011377144 6:86701118-86701140 TGTATATGTGCAGAATGGGCAGG + Intergenic
1015365613 6:132393904-132393926 TGGTGATGTCCATGATGAACTGG - Intronic
1017155487 6:151319328-151319350 AGGTTATCTACAGGATGGGCAGG - Intronic
1020910806 7:14128058-14128080 GGGTCATGTGCAGGATGGGGAGG + Intergenic
1021666135 7:22982736-22982758 TGGCTATGTGGAGGATAGATTGG - Intronic
1026196778 7:68180139-68180161 TGCTGGTGTGGAGGATGGACTGG + Intergenic
1026562080 7:71458660-71458682 TGGTTCTCAGCAGGATGGATGGG + Intronic
1027243934 7:76352936-76352958 TGGTTATGGGCCGGATGTAGTGG - Intronic
1029016124 7:97316790-97316812 TGGCTCTCAGCAGGATGGACGGG - Intergenic
1029017054 7:97325803-97325825 TGGCTCTCAGCAGGATGGACAGG + Intergenic
1029582061 7:101443279-101443301 TGGTTGTGTGCAGCTGGGACAGG - Intronic
1029976349 7:104838109-104838131 TGGCTAATTGCAGGATGGCCAGG - Intronic
1030672799 7:112355412-112355434 TGATTGTGTGAAGGATGAACTGG + Intergenic
1031620523 7:123929312-123929334 TGGTCATTTGCAGGAAGGCCTGG + Intronic
1033521192 7:142162086-142162108 TGGTTATGTGCAGCAGAGACAGG + Intronic
1035665748 8:1378468-1378490 CAGGTGTGTGCAGGATGGACAGG - Intergenic
1039469353 8:37803733-37803755 GGGATGTGTGCAGGATGGATGGG + Intronic
1043350925 8:79360228-79360250 TGGTTTTCAGCAGGATGGATGGG + Intergenic
1044602980 8:94024370-94024392 TGGGAAAGTGCAGGATGGAGGGG + Intergenic
1045827815 8:106421463-106421485 TGGTTAGCTGCAGGGTGGAGAGG + Intronic
1050135731 9:2461713-2461735 TGGTTATATGGAGTCTGGACTGG + Intergenic
1051016514 9:12482703-12482725 TGTTTATGACTAGGATGGACTGG - Intergenic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1058131789 9:101261948-101261970 GGTATATGTGCAGGATGTACGGG - Intronic
1059974841 9:119704796-119704818 TGGATGTGTGCAGGATGGATAGG - Intergenic
1062285478 9:135770774-135770796 TGGTGATTTGCAGGAAGGGCAGG + Intronic
1189366558 X:40393506-40393528 TGGTTATCTGCAGGTTTGACTGG - Intergenic
1190279944 X:48922927-48922949 TGGTTCTGTGCGGGATGGGGTGG + Exonic
1191039692 X:56066416-56066438 TGGATATGTGCAGTATGTGCAGG + Intergenic
1192524309 X:71828380-71828402 TGAGTCTGTGCAGGCTGGACTGG + Intergenic
1193262159 X:79420774-79420796 AGGTTATGGGAAGGATGGAATGG - Intergenic
1194902494 X:99530327-99530349 TGTACATGTGCAGGATGGGCAGG - Intergenic
1196861569 X:120033682-120033704 TGGCTCTCTGCAGGATGGATGGG - Intergenic
1199791361 X:151158314-151158336 GGGATATGTGCAGGATGTGCAGG + Intergenic