ID: 975660313

View in Genome Browser
Species Human (GRCh38)
Location 4:76681961-76681983
Sequence CCAGAGAAGCAGAGAGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 9, 3: 72, 4: 565}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975660313 Original CRISPR CCAGAGAAGCAGAGAGTTGA GGG (reversed) Intronic
900189567 1:1347676-1347698 CCAGAGAAGCAGGGACTGCAAGG + Intronic
900247812 1:1646716-1646738 CCTGAGAAGCAGAGACTGGTGGG - Intronic
900259039 1:1713870-1713892 CCTGAGAAGCAGAGACTGGTGGG - Intronic
901907050 1:12421944-12421966 CCAGAGTAGCAGAGATTACAAGG + Intronic
904383112 1:30124721-30124743 CCAGAGAAGGAGGGAGATGTAGG - Intergenic
904398969 1:30243370-30243392 CCTGAGACTCAGAGAGGTGAGGG + Intergenic
904778578 1:32927166-32927188 CCAGAGAAATAGAGAGGTGGGGG + Intergenic
904974300 1:34444026-34444048 CAATGGAAGCAGAGAGTGGAGGG - Intergenic
905386555 1:37608276-37608298 TCAGAGCATCACAGAGTTGATGG + Intergenic
905733613 1:40312112-40312134 CCTGGGGAGCAGAGAGTTGATGG + Exonic
905773020 1:40650308-40650330 CCTCAGAAGCAGGGACTTGAAGG + Intronic
905840682 1:41175385-41175407 CCTGAGAATCAGGGAGCTGATGG - Intronic
906786981 1:48624651-48624673 CCAGGGCAGCAGGGAGGTGAAGG + Intronic
907111576 1:51931250-51931272 CCAGTGAAGAAGAAAGTTAAGGG - Intronic
908224688 1:62044292-62044314 TCATAGAAGCAGAGAGTAGTGGG - Intronic
908304653 1:62799952-62799974 CCATGGAGGCAGAGAGTGGAAGG - Intronic
908457283 1:64316047-64316069 CCAGGGTAGCACAGAGATGAGGG - Intergenic
908701515 1:66907404-66907426 GAAGAGAATGAGAGAGTTGAAGG - Intronic
910475751 1:87604427-87604449 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
911261830 1:95695441-95695463 CCAGAGAGGGAGAGAGATTAAGG + Intergenic
911698128 1:100916790-100916812 TCATGGAAGCAGAGAGTAGAAGG - Intronic
912383072 1:109257971-109257993 CCACAGCAGCAGGGAGTTGGCGG - Intronic
912398857 1:109371692-109371714 TCAGTGAAGCTGAGAGTTGCCGG - Intronic
912553506 1:110499554-110499576 CCAGAGAGTTAGAGAGTTAAAGG - Intergenic
912821423 1:112870959-112870981 CCAGAGAAACTGAGAGCTCAGGG - Intergenic
913198501 1:116477280-116477302 CCAGAGGAGCAGATGTTTGAAGG + Intergenic
913658470 1:120984138-120984160 CTAGTGATCCAGAGAGTTGAGGG - Intergenic
914009837 1:143767247-143767269 CTAGTGATCCAGAGAGTTGAGGG - Intergenic
914153792 1:145067322-145067344 TCAGAGAAGCCAAGAGTTCAAGG + Intronic
914323944 1:146592667-146592689 TCAGAGAAGCAGAAAGGTGTGGG + Intergenic
914324055 1:146593922-146593944 TCAGAGAAGCAGAAAGGTGTGGG - Intergenic
914648457 1:149675908-149675930 CTAGTGATCCAGAGAGTTGAGGG - Intergenic
915240943 1:154521260-154521282 CCAGAGAAGCCCAGAGCTGCAGG - Intronic
915828982 1:159107462-159107484 CCAGTTAAGCAAAGACTTGAAGG + Intronic
916329731 1:163601196-163601218 CCTGAGAACCAGAGGGCTGATGG - Intergenic
916450375 1:164915075-164915097 CCAGAGGAGCTGACAGTAGAGGG - Intergenic
916615284 1:166432980-166433002 TGAGTGAAGCAGAGTGTTGAAGG + Intergenic
916869109 1:168893280-168893302 TCAGATAAACAGAGAGATGAAGG + Intergenic
917000416 1:170351688-170351710 TGAGAGAAGCAGAGAGTGGTTGG + Intergenic
918387918 1:184029272-184029294 CCAGAGGAGTAGAGAGCTAAGGG + Intronic
918803745 1:189010932-189010954 CCAAAGCAGCAGAGATTTAAGGG + Intergenic
918936434 1:190928270-190928292 TTAGAAAAGCAGAGAGATGATGG - Intergenic
918963696 1:191312244-191312266 ACAGAGAGAGAGAGAGTTGAGGG - Intergenic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
919588300 1:199466746-199466768 CCAGAGAAAAATAGGGTTGAGGG + Intergenic
919693386 1:200547627-200547649 TCATAGAAGCAGAGAGGTGAAGG + Intergenic
920305502 1:205015767-205015789 ACAGACAAGCAGAGAGGTGAGGG + Intronic
920695304 1:208177382-208177404 ACAGAGACACAGAGATTTGAAGG - Intronic
920835709 1:209509001-209509023 TCAGAGAGGGAGAGAGATGACGG - Intergenic
921158964 1:212459596-212459618 TCATAGAAGCAGAGAATAGAAGG - Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
921352538 1:214250723-214250745 CCAGAGAGGAAATGAGTTGAGGG + Intergenic
921973692 1:221178079-221178101 GAAGAGAAGAAGAGAGGTGAAGG + Intergenic
922003221 1:221502239-221502261 CCTGAGAACTAGAGAGATGATGG + Intergenic
922220581 1:223555367-223555389 CCAGAGAGGCTGAGAGTAGTCGG - Intronic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923266324 1:232318027-232318049 CCAGACAACCAAAGAGTAGATGG + Intergenic
924039376 1:239969099-239969121 TCAAAGAAACAGAGAGTAGAAGG + Intergenic
924858323 1:247896459-247896481 CCTCAGAAACAGAGAGGTGAAGG + Exonic
924865556 1:247975591-247975613 CCTGAGAAACAGGGAGGTGATGG + Intronic
1063179005 10:3580023-3580045 CCAGTGAATCAAAGAGTTGTGGG + Intergenic
1064300516 10:14118897-14118919 CAAGAGAGCCAGAGAGTTGTGGG - Intronic
1064319412 10:14288809-14288831 TCATAGAAACAGAGAGTAGAAGG - Intronic
1065333428 10:24628542-24628564 CAAGAAAAGCAGGGAGCTGATGG - Intronic
1065827884 10:29588449-29588471 CCAGAGAAGCAGAGAATGAATGG - Intronic
1065949979 10:30642853-30642875 CCAGAGAAGCGGAGAATGAATGG + Intergenic
1066355911 10:34683663-34683685 CCAGATAAGCAAAGTCTTGAGGG + Intronic
1067451043 10:46382093-46382115 ACAGAGCAGCAGAGAGATCAAGG - Intronic
1067586200 10:47477658-47477680 ACAGAGCAGCAGAGAGATCAAGG + Intronic
1067776047 10:49165601-49165623 CCAGAGGAGGAGAGAGTGTAAGG + Intronic
1068032283 10:51718734-51718756 CCATAGAGACAGAGAGTAGAAGG + Intronic
1068086565 10:52380902-52380924 CTAGAGAAGCAGAGAAATGGTGG + Intergenic
1068725987 10:60304067-60304089 CTATAGAAACAGAGAGTAGAAGG + Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1069778631 10:70941254-70941276 CCAGAGAAGCATGGAGTGGAGGG - Intergenic
1070602215 10:77873787-77873809 GCAGAAAGGCAGAGAGCTGACGG + Intronic
1070686762 10:78490617-78490639 TCAGCGAATCAGACAGTTGATGG + Intergenic
1070822616 10:79370131-79370153 CCAGAGAACCAGAAAGTTTCTGG - Intergenic
1070837958 10:79462938-79462960 CCACAGGAGCAGAGAGGGGAGGG + Intergenic
1070971105 10:80568010-80568032 ACAGAGAGGCACAGAGATGAAGG - Intronic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1073658924 10:105450608-105450630 CCAGAGAAGGAGGTGGTTGAGGG - Intergenic
1073707138 10:105997666-105997688 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1074917666 10:117972770-117972792 CCACAGAACCAGAGAGCAGAAGG - Intergenic
1075223634 10:120605459-120605481 ACAGAGAGGCAGAGAGGTGCTGG - Intergenic
1076106457 10:127827407-127827429 CCAGAGAGGCTGAGGGTAGAGGG + Intergenic
1076691820 10:132227658-132227680 TCAGAGAGGGAGAGAGTTTAGGG - Intronic
1077260197 11:1613722-1613744 CCCGAGAACCAGGGAGCTGACGG - Intergenic
1077300631 11:1845322-1845344 ACAGAGAAGCAGAGAGACAAAGG + Intergenic
1077353223 11:2102647-2102669 CCAGAGACTCACAGAGTGGAGGG - Intergenic
1077374013 11:2197237-2197259 ACAGAGATGCAGAGAGATGGAGG - Intergenic
1077449379 11:2627484-2627506 TCAGAGAAACGGAGAGTAGAAGG - Intronic
1077718122 11:4601230-4601252 CCAGCAAAGCAGAGACATGATGG + Intronic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1080357958 11:31473379-31473401 ACTGAGGAGCAGAGAGATGAAGG + Intronic
1080504354 11:32897812-32897834 CTAGAGAAGCAGAGGTGTGATGG - Intronic
1080841228 11:35985263-35985285 CCACAGAACCAGACAGTGGAAGG - Intronic
1080886467 11:36372631-36372653 CAAGAGAAGCAGGGAGTGGCTGG + Intronic
1080927327 11:36770970-36770992 CAAGAGAAGTAGAGGGTTCATGG - Intergenic
1081080410 11:38733306-38733328 ACATAGAAACATAGAGTTGAAGG - Intergenic
1081433226 11:42999254-42999276 CCAGGGAGGCAGAGAGTTTCAGG + Intergenic
1081614871 11:44584871-44584893 CCAGAGGACCAGAGAGCTGGTGG + Intronic
1081760539 11:45573838-45573860 CCTGAGAATCAGAGAGGTGAAGG + Intergenic
1082834272 11:57640194-57640216 CCAGAGAAACAGAGGCTGGAGGG - Intergenic
1083299106 11:61730990-61731012 CCAGAGAAGGGAAGAGTTGAGGG - Intronic
1084942142 11:72618513-72618535 CCAGTGAGGGAGAGAGTTGGCGG + Intronic
1085800234 11:79582594-79582616 CAAGAGAAGCAGAGCTTAGAAGG - Intergenic
1087456549 11:98394312-98394334 GCAGAAAAGCAGAAAGTTGGGGG - Intergenic
1087459412 11:98425829-98425851 CCACAGAAACAGAGAGTATAAGG - Intergenic
1087828624 11:102794608-102794630 CCAGAGAAGAAGAGAAGAGAGGG - Intronic
1088622921 11:111705071-111705093 CCAGTGGAGCAGAGACTTGATGG + Exonic
1088986613 11:114914746-114914768 CTTGGGAAGCAGAGAGATGAAGG - Intergenic
1089524487 11:119088036-119088058 CCAGAGAAGCAGAGACTAGAGGG - Intronic
1090906020 11:131075304-131075326 CCAGAGAGTCTGAGATTTGAAGG + Intergenic
1090981370 11:131725466-131725488 CCAGAGAAGAAATGACTTGAAGG + Intronic
1091964562 12:4727079-4727101 CCAGAGAAACAGAGATATGGTGG + Intronic
1092456320 12:8646584-8646606 CCAGAGAATCATAGAATTAAAGG + Exonic
1092632721 12:10400491-10400513 TCATAGAAGCAGGGAGTAGAAGG + Intronic
1093407803 12:18826345-18826367 ACATAGAAGCAGAGAGTAGCAGG - Intergenic
1093760479 12:22903923-22903945 TTACAGAAGAAGAGAGTTGAAGG + Intergenic
1093780588 12:23132386-23132408 CCTGAGAACCAGTGAGCTGATGG - Intergenic
1094257792 12:28454746-28454768 CCAGAGAAGTTGAGAGCTGTGGG + Intronic
1094487185 12:30934360-30934382 CCAGAGAAGCTGAGCCTGGATGG - Intronic
1095165997 12:38972777-38972799 CAAGTGTAGCTGAGAGTTGAGGG + Intergenic
1095215800 12:39545868-39545890 CCAAAGAAGCAGAAAGAGGAAGG + Intergenic
1095978997 12:47959818-47959840 GCAGAGCAGCAGAGAGTGAAGGG - Intergenic
1096559527 12:52425573-52425595 TCACAGAAACAGAGAGTGGAGGG + Intronic
1097295162 12:57955002-57955024 CCAGAGAAGCAGGGACTCAAGGG - Intronic
1098394104 12:70000266-70000288 CCAGAGAAGGAGAGAGGAGTGGG - Intergenic
1099173708 12:79396461-79396483 CAAGAGAAGCAGTTAGTTGAAGG + Intronic
1099929806 12:89060321-89060343 GCAGTGAAGCAGAAAGCTGAAGG + Intergenic
1102089002 12:110170512-110170534 GCAGAGAATCAGAGAGATCAAGG - Intronic
1102450769 12:113040410-113040432 TCATAGATGCAGAGAGTAGAAGG - Intergenic
1102523528 12:113494347-113494369 GAAGAGAAGAAGAGAGGTGAGGG + Intergenic
1102730496 12:115104630-115104652 CCAGACAATCAGAGTGTTGCTGG + Intergenic
1103149592 12:118625425-118625447 CCAGAGGAACAGAGAGGGGATGG + Intergenic
1103177605 12:118878139-118878161 GCAGAGAAGCAGAGAGGTTCTGG + Intergenic
1103421560 12:120788869-120788891 ACAGAGAAACAGAGAGGTGTAGG - Intronic
1103887619 12:124214672-124214694 CCAGAGTAGCAGAGAGACAAGGG + Intronic
1103975678 12:124701164-124701186 CCAGAGCGGCAGTGAGTAGAGGG + Intergenic
1104187467 12:126446551-126446573 TCATAGAAGCAGAGAGTATAAGG + Intergenic
1104452738 12:128884353-128884375 TCATAGAAGCAGAGAGTAGTAGG + Intronic
1105883426 13:24623269-24623291 ACAGTGCAGCAGTGAGTTGAAGG - Intergenic
1106337277 13:28795757-28795779 CCAGGGAAGCACACAGTTAAGGG + Intergenic
1106629383 13:31454451-31454473 CCAGTGAAGCTGTGTGTTGAAGG + Intergenic
1107664312 13:42673248-42673270 CCAGAGAAGCTGAGAAGGGATGG - Intergenic
1107767922 13:43757193-43757215 AAAGAGGAGCAGAGAATTGAGGG - Intronic
1107965456 13:45593738-45593760 CCACAGGAGCAGAGAGTGAAGGG - Intronic
1108125161 13:47234557-47234579 ACTGAGAAGCAGATATTTGAGGG + Intergenic
1108444074 13:50488762-50488784 TCATAGAAGCAGAGAATAGAAGG - Intronic
1108964899 13:56286054-56286076 ACAGCTAAGCAGAGAGGTGAAGG - Intergenic
1109154541 13:58889980-58890002 GCAGAGAAGAAGAAAGTGGAGGG + Intergenic
1109723559 13:66308939-66308961 GCAGAGAAGCAGATTATTGATGG - Intronic
1110747878 13:79077630-79077652 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1111118180 13:83809416-83809438 TCAGAGATGCAGAAAGTTAAAGG + Intergenic
1111146726 13:84191530-84191552 CCAGGAAAGAAGAGAGTTTAAGG - Intergenic
1114152456 14:20059089-20059111 GAAGAGAAGGAGAGAGATGAGGG + Intergenic
1115308232 14:31953819-31953841 GAGGAGAAGCAGAGAGTTGGGGG - Intergenic
1115755453 14:36523166-36523188 CCAGCGAAGCAGAGCGTGGTCGG - Intergenic
1115795372 14:36929767-36929789 CCAGGGAAGGAAAGAATTGACGG - Intronic
1116081870 14:40184926-40184948 TCATAGAAGCAGAGAGTAGAGGG - Intergenic
1116286413 14:42978248-42978270 TCATAGAAGTAGAGAGTAGAAGG - Intergenic
1116287521 14:42991557-42991579 CCAGAAAAGCAGAGGTTAGACGG + Intergenic
1116594259 14:46819947-46819969 CCAGAGAAGCACACACCTGAGGG - Intergenic
1116683962 14:48013989-48014011 GTATAGAAGCAGAGAGTAGAAGG + Intergenic
1116919714 14:50560346-50560368 CCACAGAAGCAGAAAGTGGAGGG - Intronic
1117179199 14:53175119-53175141 GCAGAGAAACAGAGAGATTAGGG - Intergenic
1117793042 14:59361396-59361418 CCAGATAAGCAGAGTGATTACGG + Intronic
1118365473 14:65091715-65091737 GCAGAGAAGAAGAGTGTTGCTGG - Intronic
1118656387 14:67954499-67954521 CCAGAGGAGAAGACAGATGAAGG + Intronic
1118839668 14:69501007-69501029 GCAGAGAGGCAGGGAGTTCAGGG - Intronic
1119414034 14:74457519-74457541 CCAGTGAGGCAGAGAGCTGATGG - Intergenic
1119618651 14:76115071-76115093 GCAGAGATGCAGAGAGATGTCGG + Intergenic
1120215949 14:81680853-81680875 CCAGAGAAACAGGGAGATAAGGG - Intergenic
1120401705 14:84040777-84040799 CCAGAGAAGGGGACATTTGAGGG + Intergenic
1121230466 14:92353920-92353942 CCAGAGAGCAGGAGAGTTGATGG + Intronic
1121839577 14:97121813-97121835 CCAGAGGAACATAGATTTGAAGG - Intergenic
1121942347 14:98083104-98083126 CCTGAGAACCAGAGAGTTGATGG - Intergenic
1122249336 14:100427104-100427126 CCAGAGCAGCAGAGAGGAGGAGG - Intronic
1122409119 14:101517111-101517133 GCAGAAGAGCAGAGACTTGAGGG + Intergenic
1123027025 14:105430223-105430245 CCAGTGAAGGGAAGAGTTGAGGG - Intronic
1123664150 15:22594584-22594606 CCAGAGCAGATGAGAGTTGATGG + Intergenic
1124317981 15:28689022-28689044 CCAGAGCAGATGAGAGTTGATGG + Intergenic
1124552718 15:30696415-30696437 ACTCAGAAGCAGAGAGCTGAGGG - Intronic
1124565452 15:30808461-30808483 CCAGAGTAGATGAGAGTTGATGG - Intergenic
1124678524 15:31709255-31709277 ACTCAGAAGCAGAGAGCTGAGGG + Intronic
1124704439 15:31951672-31951694 CCAGAGAAGGAGAGAGAAAAAGG - Intergenic
1124871400 15:33546683-33546705 ACTGAGACACAGAGAGTTGAAGG + Intronic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1126131935 15:45350079-45350101 TCAGAGAAGCAGAGAATAGCTGG + Intergenic
1126350248 15:47738574-47738596 CCAGAGAAACAGAGAGTCTTTGG - Intronic
1126392541 15:48175271-48175293 ACTCAGAAGCAGAGAGTAGAAGG + Intronic
1127978569 15:64017138-64017160 CTGGAGAAGAAGAGACTTGAAGG - Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128889119 15:71315188-71315210 CCAGAGATGAGGAGAGATGAAGG - Intronic
1129274731 15:74437479-74437501 CAAGAGAAGCTGAAAATTGAGGG + Intergenic
1129941402 15:79500252-79500274 CCAGAGAAGGAGAGAGAGAAAGG - Intergenic
1130068654 15:80628173-80628195 CCTGAGAGCCAGAGAGCTGATGG - Intergenic
1130090925 15:80820596-80820618 ACTGAGAATCAGAAAGTTGAGGG - Intronic
1130885956 15:88092805-88092827 ACAGAGATGCAGGGATTTGAAGG - Intronic
1131015414 15:89053696-89053718 CAAGAGAAGCAGAGACTCAAGGG + Intergenic
1131420863 15:92304303-92304325 CCAGATCAGCAGAAAGCTGATGG - Intergenic
1131687224 15:94781178-94781200 CCAGGGCAGCAGAGACTTAAAGG + Intergenic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1133465480 16:6023008-6023030 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1134027439 16:10965069-10965091 TCATAGAAGCAGAGAGTCAAAGG - Intronic
1135928930 16:26720134-26720156 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1135973296 16:27087937-27087959 ACAGAGAAGCAGGGAGGTCAGGG - Intergenic
1137476957 16:48817478-48817500 GCAAAGAAGCAAAGAGCTGAGGG - Intergenic
1137715777 16:50597515-50597537 CCAGAAAATCAGACAGCTGAAGG + Intronic
1138094405 16:54200788-54200810 AAAGAGAAGGAGAGAGTTTAGGG - Intergenic
1138208876 16:55146199-55146221 TCAGAGAAGAAGAGAGAGGAGGG - Intergenic
1138496471 16:57412063-57412085 CCAGAGAAGCAGAGGAATGTTGG + Intronic
1139586969 16:67910224-67910246 GCAGAGAAGCAGAGAGATGCAGG + Intronic
1140009507 16:71116921-71116943 TCAGAGAAGCAGAAAGGTGTGGG + Intronic
1140009618 16:71118177-71118199 TCAGAGAAGCAGAAAGGTGTGGG - Intronic
1140796393 16:78442481-78442503 TCACAGAAGCAGAGAGTAGAGGG - Intronic
1140889169 16:79270506-79270528 TCAGAGGAGCAGAGAGATGATGG - Intergenic
1141058261 16:80839154-80839176 TCATAGAAGTAGAGAGTAGAAGG - Intergenic
1141278768 16:82611744-82611766 TCATAGAAGCAGAGAGTAGAAGG + Intergenic
1141357824 16:83365183-83365205 CCTGAGAACCAGAGAGCTGATGG + Intronic
1141476111 16:84274611-84274633 CTAGAGAAACTGAGACTTGAGGG - Intergenic
1141625859 16:85260758-85260780 ACAGGGAAGCAGAGAGTAGATGG - Intergenic
1141855230 16:86676736-86676758 CCAGAAAAGCACAGAGTGGTAGG + Intergenic
1142595116 17:1026177-1026199 CCAGAGAACCAGAGAGGCAAAGG + Intronic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1146505209 17:33399043-33399065 CCAGAGAAGCAGAGAAAAGAAGG + Intronic
1146514968 17:33482035-33482057 CCAGAGCAGCAGAGAGCTGAGGG - Intronic
1147168070 17:38603843-38603865 CCAGGCAAGCTGAGAGTTGCTGG - Intronic
1147744563 17:42687376-42687398 CCAGAGTCGGAGAGGGTTGAGGG - Intronic
1147986031 17:44308422-44308444 CGGGAGAAGCAGAGATTGGAAGG - Intronic
1148994601 17:51698744-51698766 TCACAGAAGCAGAGAGTAGGTGG - Intronic
1149538507 17:57451105-57451127 CCAGAGGAGCAAAGTGTTGGGGG + Intronic
1149591295 17:57831768-57831790 CCAGAGGAGCACAGAGCTAAGGG - Intergenic
1150854707 17:68740917-68740939 ACAGAGAAGCAGAGAAGAGAAGG + Intergenic
1151200357 17:72463452-72463474 CCAGGGACACTGAGAGTTGAGGG - Intergenic
1151582906 17:74990244-74990266 CCAGAGAAGCAGAGGCCTGCCGG - Intronic
1153958626 18:10121240-10121262 TCACAGAAGCAGAGAGCAGAAGG + Intergenic
1154343685 18:13525273-13525295 CCAGAAAAACAGAGAGCTTAAGG - Intronic
1154408607 18:14121135-14121157 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1154437229 18:14356240-14356262 TCAAAGAAACAGAGAGATGAAGG + Intergenic
1155174590 18:23291273-23291295 CCTGAGAAGAACAGAGTTCAAGG + Intronic
1156297333 18:35804542-35804564 CCAGTGAAGCAGAGGGTTGTGGG + Intergenic
1156362531 18:36396453-36396475 CAAGAGATGCAGAAAGTTAAAGG - Intronic
1156888826 18:42166341-42166363 ACAGAGAAGCAGAGCCCTGAGGG - Intergenic
1157317327 18:46603272-46603294 CAAGGCAAGCAGGGAGTTGAGGG + Intronic
1157851827 18:51061384-51061406 CCATAGAGACAGAGAGTAGAAGG - Intronic
1158306619 18:56113346-56113368 ACAGAAAAGAATAGAGTTGAGGG - Intergenic
1158908718 18:62039111-62039133 ACAGAGAAGCAGAGGATTGAAGG - Intergenic
1159151063 18:64523947-64523969 ACAGAGAAGAAGAGAGTGAAGGG - Intergenic
1159451325 18:68605788-68605810 TCATAGAAGCAGAGAGGAGAAGG - Intergenic
1159846456 18:73466904-73466926 TCATAGAAGCAAAGAGTAGAAGG + Intergenic
1162099272 19:8330042-8330064 CCAGAGAGGCAGAGTGAGGAGGG + Intronic
1162760870 19:12887444-12887466 CCAAAGAAGGAGAGACTTGGGGG + Intergenic
1162977654 19:14217751-14217773 AGAGAGGAGCGGAGAGTTGAGGG + Intergenic
1163349744 19:16768889-16768911 AAAGAGAAGCAGATAGTTCAAGG - Intronic
1163538627 19:17893433-17893455 GCAGAGAAGCAGAGAAAGGAGGG + Intronic
1164157257 19:22604194-22604216 CCAGAGCTGCAGACAGCTGAGGG + Intergenic
1164557674 19:29266204-29266226 CGGGAGGAGCAGCGAGTTGACGG - Intergenic
1164573571 19:29391907-29391929 GCAGACAAGGAGAGAGTGGAGGG - Intergenic
1164798024 19:31051835-31051857 CCTGAGAACCTGGGAGTTGATGG + Intergenic
1167197004 19:48036473-48036495 TCATAGAAGCAGAGAGTAGAAGG + Intronic
1168102819 19:54149971-54149993 CCAGAGAAACAGAGCTTTGGAGG - Intronic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925119858 2:1409898-1409920 TCATGGAAGCAGAGAGTGGATGG + Intronic
925273669 2:2633854-2633876 TCACAGAAGCAGAGAGTAGATGG - Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925518296 2:4709572-4709594 ACTCAGAAGCAGAGAGTAGAGGG + Intergenic
925557770 2:5151347-5151369 ACAGAGCAGCATAGAGTTGTGGG - Intergenic
926796289 2:16621783-16621805 TCAGAGAGCTAGAGAGTTGAGGG - Intronic
927395578 2:22646753-22646775 CCAGAGAACCAGAGAGCCAAAGG - Intergenic
927429915 2:23018846-23018868 CCAGAGAAACAGAGCTCTGAGGG - Intergenic
927542233 2:23923315-23923337 TCACAGAAGCAGAGAGTAGAAGG + Intronic
927795403 2:26043803-26043825 CCAGAGAGGAATAGTGTTGATGG + Intronic
929068441 2:38004659-38004681 TCATAGAAGGAGAGAGTAGAAGG - Intronic
929461796 2:42107400-42107422 AAAGAGAAGCAAAGAGCTGAAGG - Intergenic
929936218 2:46296560-46296582 CCTGAGATGCAGTGACTTGAGGG + Intronic
930055172 2:47246323-47246345 CCAGAGAAACTGAGATCTGAAGG - Intergenic
930257289 2:49106854-49106876 ACAGAGCTGCAGAGAGCTGAGGG - Intronic
930522239 2:52482034-52482056 CCATAGAGGCAGAGGGTAGAAGG + Intergenic
930749738 2:54922850-54922872 TCACAGAAGTAGAGAGTAGAAGG + Intronic
931079973 2:58758040-58758062 CCAGAAAAGAAAAGAATTGAAGG - Intergenic
931249004 2:60513998-60514020 TCAGAGAAGGACAGACTTGAGGG + Intronic
932266933 2:70375869-70375891 TCATAGAAACAGAGAGTAGAAGG - Intergenic
932400711 2:71479308-71479330 CCACAGAAAAAGAGTGTTGAAGG - Intronic
932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG + Intergenic
932956945 2:76363090-76363112 TCAGAAAAGAAGAGAGTTGAGGG + Intergenic
933048200 2:77565982-77566004 GAAGAGAAGGAGAGAGATGAGGG - Intronic
933113028 2:78428565-78428587 TCATAGAAACAGAGAGTAGACGG + Intergenic
935637219 2:105258554-105258576 CCTGAGAACCAGGGAGCTGATGG - Intergenic
935724809 2:106014233-106014255 GCACAGAAGCAGAGAGTAGAAGG - Intergenic
935738826 2:106128581-106128603 CCTGAGAACCAGAGAGCCGAGGG - Intronic
939135227 2:138285673-138285695 CCACAGAGGCAGAGATTGGATGG - Intergenic
939286127 2:140132491-140132513 CAAGAGAAACAGAAAGTTCAAGG + Intergenic
939597811 2:144148929-144148951 CAAGAAAAGCAAAGAGATGATGG - Intronic
939628761 2:144510366-144510388 CCAGCGGACCAGAGAGGTGAGGG - Intronic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
941714506 2:168749548-168749570 CCAGAAAAGGAGACAGTTGCTGG - Intronic
941754613 2:169171639-169171661 CCAGAGAAGTAGAGGGAGGAAGG - Intronic
941839374 2:170063774-170063796 CCATGGAAGCAAAGAGTTGGAGG - Intronic
941993838 2:171582704-171582726 TCATAGAAGCAGAGAGTAGTTGG - Intergenic
942503597 2:176618276-176618298 CCAGAGACTCTGAGAGTTAATGG + Intergenic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944058702 2:195548817-195548839 GCAGAGAAGGAGAGAATAGAAGG - Intergenic
944150830 2:196556465-196556487 TCATAGAAACAGAGAGTAGAAGG - Intronic
945059922 2:205899946-205899968 GTATAGAAGCAGAGAGATGAGGG + Intergenic
945322305 2:208438795-208438817 CAAGAGAAGTAGTGAGTTGAAGG + Intronic
945559000 2:211314822-211314844 TCAGAGACAAAGAGAGTTGATGG - Intergenic
945560155 2:211329889-211329911 CCTAAGCAGCAGAGAGTTGTTGG - Intergenic
945660553 2:212680640-212680662 ACAGAGAAGCAGGGAGATCAGGG + Intergenic
945819143 2:214641775-214641797 CCAGAGAAGCAGGTGGTAGATGG - Intergenic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
947044968 2:225971387-225971409 CCTGAGAAGGAGAAAGTTAATGG + Intergenic
947133121 2:226950225-226950247 TCACAGAAGCAGAGAGCAGAAGG - Intronic
947220409 2:227786353-227786375 CCATAAAAGGAGAAAGTTGATGG - Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
948022612 2:234748420-234748442 CAAGAGATACAGAGAGGTGAAGG + Intergenic
948062522 2:235052183-235052205 ACAGAGAGGCAGAGAGAAGAAGG - Intronic
948569835 2:238910966-238910988 TCAGAGAAGCAGGGAGGTGGTGG - Intergenic
948577302 2:238963216-238963238 ACAGAGAAGCAGAGGGTTACAGG - Intergenic
948583943 2:239006812-239006834 ACAGTGGAGCAGAGAGTGGAAGG - Intergenic
948634515 2:239326795-239326817 CCAGAGAAGCAGCCAGCTGCTGG - Intronic
948762946 2:240203948-240203970 GCAGGGAAGCAGAGGGCTGAGGG + Intergenic
948912831 2:241013266-241013288 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1169135510 20:3194869-3194891 CTAGAGAAGCAGAGAAATCAGGG + Intronic
1169833762 20:9854707-9854729 TAAGAGAATCAGAGAGTTGATGG + Intergenic
1170317866 20:15061973-15061995 CTAGAGAAGCTGAGAGTTAGAGG + Intronic
1170456852 20:16541654-16541676 CCAGAGAAGCAGACATCTGTGGG + Intronic
1171239270 20:23551840-23551862 CTGGAGATGCAGAGAGTTGGGGG + Intergenic
1172281565 20:33711454-33711476 GCAGAGAACCAGAGAGTTTGTGG + Intronic
1172394167 20:34587678-34587700 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1173267211 20:41495414-41495436 TCATAGAAGCAGAGAGTAAATGG + Intronic
1173426672 20:42949147-42949169 CCAGGGAGGCAAAGAATTGATGG - Intronic
1174140905 20:48412986-48413008 CCAGAAATGCTGACAGTTGATGG + Intergenic
1174736954 20:52973469-52973491 CCAGAGAAGGCGAGAGAGGACGG - Intronic
1174754068 20:53140846-53140868 CCAGGGAAGGGGTGAGTTGAGGG + Intronic
1175272910 20:57747242-57747264 CCAGAGGGGCAGAGCTTTGAGGG + Intergenic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175469387 20:59216339-59216361 CCAGTGAAGCAGAGAAGGGAAGG - Intronic
1175525242 20:59629263-59629285 CCAGAGAAGCAGAGGCCTGGGGG - Intronic
1175739782 20:61412532-61412554 ACAGAGAAACAGAGAGGTGGAGG + Intronic
1176163211 20:63659031-63659053 CCAGAGAAGGACGGAGTTGTGGG + Intronic
1176183496 20:63765218-63765240 CCAGAGGAGCCGGGACTTGAGGG - Intronic
1176737874 21:10568855-10568877 CCACTGAAGCAGAGAACTGATGG - Intronic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177383177 21:20371936-20371958 AAAGAGAAGAAGAGATTTGAAGG + Intergenic
1177410911 21:20729695-20729717 GCAGAAAAGCACAGAGTTTAGGG + Intergenic
1177461453 21:21416201-21416223 CCAAAGAGGGAGAGAGATGAGGG + Intronic
1178129265 21:29552308-29552330 CTAGTGAATAAGAGAGTTGAAGG - Intronic
1178682415 21:34684009-34684031 GAAGAGAAACAGTGAGTTGAGGG - Intronic
1178823760 21:35998312-35998334 CCAGAAAAGCAGAGATTGGAAGG + Intronic
1178895935 21:36556978-36557000 TCACAGAAGCAGAGAGTAGATGG - Intronic
1178935221 21:36856021-36856043 CCATAGAAACAGAAAGTAGATGG + Intronic
1179355513 21:40655065-40655087 CCAGAGAAGGAGAGAGAAAATGG + Intronic
1179457720 21:41510589-41510611 CCAGAGAACTAGAGAGCAGATGG + Intronic
1179976333 21:44869734-44869756 TCAGAGGCGCAGAAAGTTGAAGG - Intronic
1180014191 21:45072305-45072327 CCAGAGCAGCAGAGAGCGGATGG - Intergenic
1181568089 22:23751683-23751705 CCTGGGATGCAGAGAGTTGGGGG - Intergenic
1182583128 22:31327204-31327226 CCAGAGAAGCAGAGTGCCAATGG - Exonic
1182674899 22:32031512-32031534 GCTGAGAAGCAGAGAGGGGAGGG - Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1183318164 22:37148242-37148264 CCAGAGGGGCACAGAGCTGAGGG + Intronic
1183362322 22:37389186-37389208 CCAGAGAGGGAGAGAGAAGAGGG + Intronic
1183814776 22:40290581-40290603 GCAGAGAAGCAGAGAGCTGAAGG - Intronic
1183897810 22:40983181-40983203 GCTGAGAAGCAGAGAGATGGGGG + Intergenic
1184108417 22:42381782-42381804 CAAGGTAAGCAGAGAGGTGAGGG - Exonic
1184247525 22:43243212-43243234 CCAGAGAATCAGGGCTTTGATGG + Intronic
949269265 3:2195107-2195129 TCACAGAAGCAGAGAGTATAAGG - Intronic
949403789 3:3693694-3693716 GCAGAGAAGCAGAGAGATGCAGG + Intergenic
950694267 3:14685699-14685721 TCATAGAAGCAGAGAGTGAATGG - Intronic
950900159 3:16490381-16490403 TCAGAGAAGCAGAGAAAGGAGGG + Intronic
950976981 3:17257005-17257027 GAAGAGAAGGAGAGAGTGGAAGG + Intronic
951041084 3:17989457-17989479 CCAGAGAAAGAGAGAGGTGGGGG - Intronic
951068416 3:18295604-18295626 ACAGAGCAGCACAGAGTTCAGGG + Intronic
952932339 3:38369879-38369901 CCAGAGAACCAGAGACAAGAGGG - Intronic
953366019 3:42345947-42345969 CCAAAGCGGCAGAGAGTTTAGGG - Intergenic
953565548 3:44028949-44028971 ACAGAGTAGCAGGGAGTTTAGGG - Intergenic
954381089 3:50219610-50219632 CAAGAGATGGAGAGAGATGAGGG - Intronic
954577145 3:51682829-51682851 CCAGAGCTGCAGACAGTTGAGGG + Intronic
955407998 3:58637564-58637586 CCAGAGCACCTGAGAGATGATGG - Intronic
955606006 3:60704814-60704836 CCAGAGAATCAAGTAGTTGATGG - Intronic
956090909 3:65666162-65666184 CGAGAGTAACAGGGAGTTGATGG - Intronic
956319853 3:67984693-67984715 CCACAGAGGCAGAGACTAGAAGG - Intergenic
956721248 3:72119731-72119753 CCCGAGAACCAGAGAGTTGATGG - Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957708017 3:83815292-83815314 ACAGGGAATCAGATAGTTGATGG + Intergenic
958722525 3:97862054-97862076 GCAAAGAAGCAGACAGTTAAGGG + Intronic
958722887 3:97867178-97867200 GCAAAGAAGCAGACAGTTAACGG + Intronic
959309423 3:104714537-104714559 ACATAGAAACAGAGAGTCGAAGG + Intergenic
959369781 3:105508905-105508927 ACACAGAAACAGAGAGTGGATGG - Intronic
959665351 3:108914821-108914843 CCAGAGAAATGGAGAGTGGAGGG - Intronic
960056960 3:113282763-113282785 ACAGAGCAGCAGAGAGGTGGGGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960474070 3:118102403-118102425 TCATAGAGGCAGAGAGTAGAAGG - Intergenic
960958804 3:123054573-123054595 CAAGAAAAGCAGAGAGGGGATGG + Intergenic
960992365 3:123320314-123320336 CCTGAGAAACAGGGTGTTGAAGG - Intronic
961437442 3:126929149-126929171 TCAGAGAAGGATAAAGTTGAAGG - Intronic
961597466 3:128029901-128029923 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
961638726 3:128351124-128351146 GGAGAGAAGCAGAGAGCTGTGGG + Intronic
961648660 3:128406315-128406337 TCATAGAAGCAGAGGGTAGAAGG + Intronic
963379652 3:144511796-144511818 CCAGAGAAGCAAAGAAGTTATGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964744294 3:159997837-159997859 CAAGAGAAGGAGATAGGTGATGG - Intergenic
965632107 3:170743625-170743647 TCATAGAAGCAGAGAGTAGACGG - Intronic
965932659 3:174065748-174065770 CCAGAGAGGGAGAGAGTACAAGG - Intronic
966135445 3:176693075-176693097 CCAGAAAAGCATAAACTTGAGGG + Intergenic
966298753 3:178455004-178455026 CCAGAGCAGCTGACAGTCGAGGG + Intronic
966739933 3:183223146-183223168 CCAAAGAATCATAGAGTTGGAGG - Intronic
967910161 3:194536073-194536095 CCAGGGAAGCAGAGATTGCAGGG + Intergenic
969051528 4:4376701-4376723 CAAGAGAGGCAGAGACTGGAGGG - Intronic
969301368 4:6299271-6299293 CAAGAGGAGCAGAGGGCTGAGGG - Intronic
969512739 4:7628775-7628797 CCAGAGAAGGACAGTGGTGATGG + Intronic
970033192 4:11701262-11701284 CCAGATCAGCAGAGAGTTTAGGG - Intergenic
970291616 4:14579011-14579033 CCAGAGCATCACAGTGTTGAGGG + Intergenic
970360951 4:15308401-15308423 GCACAGAAGACGAGAGTTGAGGG - Intergenic
970676479 4:18455955-18455977 ACAGAGAAGCAAAAAGTTCAGGG + Intergenic
970972062 4:21996486-21996508 TCATAGAAACAGAAAGTTGAAGG + Intergenic
971032011 4:22648412-22648434 TCATAGAAGCACAGAGTAGAAGG - Intergenic
971041323 4:22755472-22755494 TCAAAGAGGCAGAGAGTAGATGG - Intergenic
971369277 4:26002933-26002955 CCAAAGCAGCAGAGAGGTGCTGG - Intergenic
971924783 4:32994110-32994132 CCAGAGAAGCAAATTGTTGGTGG - Intergenic
972818516 4:42671998-42672020 CCATACTAGCAGAGTGTTGATGG + Intergenic
973312150 4:48721261-48721283 TCAGAGAGGTAGAGAGTGGAGGG + Intronic
974097590 4:57381566-57381588 TCATAGGAGCAGAGAGTAGAAGG + Intergenic
974108780 4:57501855-57501877 GCAGAGAAGCAGAGATTGTAGGG + Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
976274535 4:83262764-83262786 CTATAGCAGCAGTGAGTTGAAGG - Intronic
979515563 4:121605853-121605875 ACACATAAGCAGAGAGTGGAGGG - Intergenic
979927310 4:126583284-126583306 CCATTTCAGCAGAGAGTTGAGGG + Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980610646 4:135156899-135156921 TCATAGAAACAGAGAGTAGAAGG + Intergenic
980871443 4:138615636-138615658 ACAGAGAAGCAGAGAATAGAAGG + Intergenic
981622460 4:146717921-146717943 TCAAAGAAGCAGAGAGCAGAAGG - Intronic
981779837 4:148415693-148415715 ACAGAGAAGTAGAGAGTTCTGGG - Intronic
981872950 4:149508248-149508270 CTAGAGAAGCTGAGAGAAGAGGG + Intergenic
982348168 4:154384721-154384743 CCAGGGAAGCAGAGATTGAAGGG + Intronic
982488166 4:155994153-155994175 CCCAAGAAGGAGAGAGGTGAGGG + Intergenic
983010323 4:162538226-162538248 CCAGAGAAGAAGAGAGAATACGG + Intergenic
983940010 4:173528558-173528580 CGGCATAAGCAGAGAGTTGAGGG - Intronic
983981658 4:174005016-174005038 CCAGAGGAGCAGATAGCAGAGGG + Intergenic
984940016 4:184922685-184922707 CCAGGGAAGCAGAGTGGGGAGGG + Intergenic
986662162 5:10068970-10068992 TCATAGAAGCTGAGAGTGGAAGG - Intergenic
986746567 5:10750106-10750128 GCAGAGACTCAGAGACTTGAAGG - Intronic
987712954 5:21527861-21527883 CTAGAGAAACAGAAAGCTGATGG - Intergenic
987761524 5:22169039-22169061 CTAGAGAAACAGAGATTGGATGG - Intronic
988200189 5:28057955-28057977 CCTGAGAACCAGGGGGTTGATGG + Intergenic
988317501 5:29649557-29649579 CCAGATAAGCAGAGATATGGGGG + Intergenic
988741641 5:34079734-34079756 TCATAGAAGCAGAGAGTAAAAGG + Intronic
988955375 5:36311104-36311126 CCAGAGAGACAGAGACTGGAAGG + Intergenic
990012049 5:51011506-51011528 GGAGAGAAGCAGAGAGGTCAAGG + Intergenic
990886922 5:60605112-60605134 CAATAGAAGCAGAGATTAGATGG + Intronic
991896312 5:71402506-71402528 CTAGAGAAACAGAGATTGGATGG - Intergenic
992728346 5:79632103-79632125 CCAGAGAAACAGAGTGCAGAAGG + Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993093579 5:83457054-83457076 TCATAGAAGCAGAGAATAGAAGG + Intergenic
993892659 5:93491828-93491850 CCTGAGAACCAGGGAGCTGATGG - Intergenic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
995924062 5:117347954-117347976 TCAGAATAGAAGAGAGTTGATGG - Intergenic
997645143 5:135477029-135477051 CAAGAGAAGGAGAGAGGGGAGGG - Intergenic
997884057 5:137615131-137615153 TCAGAGAGGCTGAGAGATGAGGG - Intergenic
997942173 5:138168082-138168104 CCAGGGAAGAATAGAGGTGAAGG + Intronic
998205296 5:140153280-140153302 GCAGAGAAGCAGTGAGAGGAAGG + Intergenic
998229335 5:140349827-140349849 CCACAGAAGCATAGAGATGGCGG - Intergenic
998399782 5:141842660-141842682 CCAGAGAAGTAGAGAGAAGAGGG + Intergenic
998750768 5:145319040-145319062 ACAGAGAAGCAGAGAAGAGAAGG - Intergenic
999190339 5:149742420-149742442 CCAGAGTGGCAGAGTATTGAGGG - Intronic
999194009 5:149769813-149769835 CCAGAGAAGGAGATAAGTGAAGG - Intronic
999275337 5:150326176-150326198 CCAGAGAGGCATGGAGTGGAGGG - Intronic
1000063875 5:157678789-157678811 CAAAAGAAGCACAGAGTTCAAGG - Intronic
1000212306 5:159119086-159119108 ACAGAGCAGCAGCGAGCTGAAGG - Intergenic
1000386082 5:160675855-160675877 CCAGAGAAGCAGGGGGGTGGGGG + Intronic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1001946576 5:175783816-175783838 CCTGAGAACCAGAAAGCTGATGG + Intergenic
1002523336 5:179803229-179803251 CCAGAGAGGCAGGGTGTGGAGGG - Intronic
1003021830 6:2516689-2516711 CCAGAATAGCAAAGAGTTGAAGG - Intergenic
1003232621 6:4268293-4268315 CCTGAGAACCACAGAGCTGATGG - Intergenic
1003559684 6:7170399-7170421 CAGGAGCAGCAGAGAGGTGAGGG + Intronic
1003933211 6:10948455-10948477 TCATAGAAACAGAGAGTAGAAGG + Intronic
1004815787 6:19310649-19310671 TCACAGAAGCAAAGAGTAGAAGG + Intergenic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005721297 6:28605047-28605069 TCAGAAAAGCAGAGAGTTGGAGG - Intronic
1006628036 6:35411311-35411333 GCAGAGTAGCAGAGTGCTGAAGG + Intronic
1007549633 6:42719250-42719272 CCAGAGAAGCAGGGAGGCGGGGG - Intronic
1010796599 6:80123470-80123492 CCAGAGATACAAAGAGTTGCTGG - Intronic
1011558160 6:88589937-88589959 CCTGAGTACCAGAGAGGTGAAGG + Intergenic
1011806013 6:91073327-91073349 CCTGAGATCCAGAGAGCTGATGG + Intergenic
1011941507 6:92848779-92848801 CCAGAGAAGAAGAGAGCTTCTGG - Intergenic
1012008916 6:93754745-93754767 CCATAGAGGCAGAGATTGGAGGG + Intergenic
1012037005 6:94155172-94155194 CCAGAGTAGCAGAGATATCAAGG - Intergenic
1012436470 6:99220065-99220087 CCAGAGCAGCAGAGATTCCAGGG - Intergenic
1013349452 6:109292122-109292144 ACAAAGCAGCAGAGAATTGAAGG + Intergenic
1013394032 6:109716181-109716203 CCAGAGATGCAGAGATTTAAGGG - Intronic
1013443582 6:110197623-110197645 TCATAGAAGCAGAGAGTGAATGG - Intronic
1013570356 6:111417547-111417569 CCAGTGAAGCAGAGTGAGGAGGG - Intronic
1014829461 6:126084884-126084906 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1015334910 6:132025825-132025847 CCAGAGAGAGAGAGAGATGAGGG + Intergenic
1017294616 6:152779207-152779229 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1017463213 6:154670904-154670926 CCAGAACAGCTGAGACTTGAGGG - Intergenic
1018321752 6:162617977-162617999 CCTGAGGTGCAGAGATTTGAAGG + Intronic
1018332235 6:162742087-162742109 TCACAGAAGCAAAGAGTAGAAGG - Intronic
1018444803 6:163845901-163845923 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1018519677 6:164633479-164633501 TCACAAAAGCAGAGAGTAGAAGG - Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019143592 6:169962909-169962931 CCAGAGCAGCGGAGAGGAGAAGG - Intergenic
1019988865 7:4678670-4678692 GCAGAGAAGCAGAGGGATGCAGG - Intergenic
1020378226 7:7512171-7512193 TCACAGAAGCACAGAGTAGAAGG + Intronic
1020980819 7:15066055-15066077 GCAGAGAAACAGAGAGATGGGGG - Intergenic
1021246376 7:18267477-18267499 TCATAGAAGTAGAGAGTAGAAGG - Intronic
1021421180 7:20446290-20446312 CCAGAGAAAAAGAGTGTTTATGG - Intergenic
1021489533 7:21203696-21203718 CCAGAGAAGATGGGAGTTGGGGG + Intergenic
1022208111 7:28181916-28181938 ACAGAGATGCATAGAGTTTATGG - Intergenic
1023034329 7:36117459-36117481 CCAGAGCAGAAGACTGTTGAAGG + Intergenic
1024020898 7:45367797-45367819 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1024157040 7:46636526-46636548 CTATAGAAGCAGAGAATTGGAGG - Intergenic
1025257504 7:57394868-57394890 TCACAGAAGCAGACAGTAGAAGG - Intergenic
1025736331 7:64150455-64150477 CCAGAGAAGAAGAAAGATGTTGG + Intronic
1026914409 7:74111488-74111510 CCTTAGAAGCAGACAGTTGTGGG + Intronic
1026929757 7:74217304-74217326 CCAGAGTAGCTGGGAGTAGAGGG - Intronic
1027189265 7:75988305-75988327 CCAGACCAGCAGGAAGTTGAAGG + Exonic
1027991714 7:85371321-85371343 CCAGAAAAGCACAGTGTTGCAGG + Intergenic
1028302119 7:89213192-89213214 ACAGAGATGCAGAAAGATGATGG + Intronic
1029036021 7:97522954-97522976 CCAGAGATACACAAAGTTGATGG - Intergenic
1029128088 7:98309113-98309135 CCAGCGAAGTAGAGAGTGGCAGG - Intronic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1030386537 7:108874098-108874120 CCAGAGAAGGAGAGAAGAGAAGG + Intergenic
1030550358 7:110951078-110951100 TCATAGAAACAGAGAGTAGAAGG + Intronic
1032321942 7:130893700-130893722 CCAGGCAAGGAGAGAGATGATGG + Intergenic
1032631184 7:133653877-133653899 CCAGGGCAGCAGAGAATTCAGGG + Intronic
1032962317 7:137050749-137050771 TCATAGAAACAGAGAGTAGAAGG + Intergenic
1033464077 7:141575211-141575233 GAAGAGAAGCAGAGTATTGAGGG + Intronic
1033575576 7:142680747-142680769 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1033881320 7:145887273-145887295 GCAGAGAAGGAGAGAGGAGAAGG - Intergenic
1034088496 7:148342134-148342156 CCACCGCAGCAGAGAGTAGAAGG - Intronic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035063126 7:156084123-156084145 TCACAGAAGCAGAGAGCAGAAGG - Intergenic
1035305573 7:157929272-157929294 TCAGAGGAGCAGAGAGCGGATGG - Intronic
1036548168 8:9792148-9792170 CCAGAGAAGAACACAGTTGGAGG + Intergenic
1037932767 8:22892092-22892114 CCAGGGAAGGAGAAAGTAGAGGG + Intronic
1038181505 8:25233046-25233068 GCAGAGAACCAGAGAGAAGAGGG - Intronic
1038227787 8:25672844-25672866 CCTGAGAAGTAGAGAGCTCAAGG + Intergenic
1038283322 8:26184908-26184930 TCACAGAAGCAGAGAGTAGAGGG + Intergenic
1039446703 8:37638856-37638878 CCAGAGAAAGAGGGAGTGGAGGG + Intergenic
1040314734 8:46254949-46254971 AGAGACAAGCAGAGAGTAGAAGG + Intergenic
1040579940 8:48689496-48689518 TCAAAGAAGCAGAGACCTGAGGG + Intergenic
1040582614 8:48709434-48709456 ACAGGCAAGCAGAGAGTTAAGGG - Intergenic
1040947123 8:52895219-52895241 TTAGAGACGCAGGGAGTTGAAGG - Intergenic
1041653776 8:60328124-60328146 TCACAGAAGCAGAGAGTAGAAGG + Intergenic
1041821018 8:62032942-62032964 CCCAAGCACCAGAGAGTTGAGGG + Intergenic
1042217104 8:66438032-66438054 CCAGAGATGGAGTGAGTTGAGGG + Intronic
1043029139 8:75109462-75109484 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
1043172167 8:76979272-76979294 CCAGAGAGGCAGAGACTGAATGG + Intergenic
1043374068 8:79627807-79627829 TCATAGAAGCAGAGAGTAGAAGG - Intronic
1043543211 8:81286530-81286552 GCAGAGAAGGGGAGAGATGATGG - Intergenic
1043730884 8:83679080-83679102 GCAGAGAAACAGAGAGTTAGAGG + Intergenic
1044485845 8:92753346-92753368 CCAGGGAAGCAGTGAATTAAAGG - Intergenic
1045952775 8:107870316-107870338 CCATAGAAGCACTGAGTTTAAGG - Intergenic
1047072013 8:121355736-121355758 TCATAGAAGTAGAGAGTGGATGG - Intergenic
1047184692 8:122622121-122622143 CCTGAGAGCCAGAGATTTGATGG - Intergenic
1047220995 8:122918013-122918035 CAAGAGTAGCAGAGTCTTGAGGG - Intronic
1047320785 8:123780035-123780057 CTAGTGATCCAGAGAGTTGAGGG - Exonic
1047364098 8:124196406-124196428 AGAGAAAAGCAGATAGTTGAGGG - Intergenic
1047425764 8:124744774-124744796 CCATAGAGACAGAAAGTTGAAGG - Intergenic
1047425903 8:124746762-124746784 CCATAGAGACAGAAAGTTGAAGG - Intergenic
1047808732 8:128384900-128384922 ACAGAGAAGTTGAGAGTTTATGG - Intergenic
1047888996 8:129286487-129286509 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1048036618 8:130683197-130683219 GCAGAGAAGCAGACAGTTGGAGG - Intergenic
1048506372 8:135025828-135025850 CCAAAGAAGCAAAGGGGTGAAGG - Intergenic
1049815908 8:144599929-144599951 CCAGGGAAGAAGAGATGTGATGG + Intronic
1050444768 9:5708477-5708499 CCAGATAAACAAAAAGTTGAGGG - Intronic
1051224642 9:14886022-14886044 TCATAGAAGTAGAGAGTAGAAGG - Intronic
1051567152 9:18513336-18513358 ACATAGAAGCAGACAGTAGAAGG - Intronic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1051830300 9:21268417-21268439 CCAGAAAAGCAGAGAGGAAATGG + Intergenic
1052422354 9:28259562-28259584 ACAGGGAAGAAGAGAGATGAAGG + Intronic
1052559503 9:30066925-30066947 TCATGGAAGCAGAGAGGTGAAGG + Intergenic
1052793637 9:32902170-32902192 GCAGAGAAGGAGAGAGGAGAAGG + Intergenic
1052889192 9:33681598-33681620 CCACAGAAGCAGAGAGTAGAAGG + Intergenic
1053048337 9:34937951-34937973 CGTGAGAATCAGAGTGTTGAAGG + Intergenic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1055099210 9:72445866-72445888 CCAGAGAAGCAGACCGCTGAGGG - Intergenic
1055176759 9:73327899-73327921 TCATAGAAGCAGAGAGTAGAAGG - Intergenic
1055178426 9:73350920-73350942 TCATAGAAGCAGACAGTAGAAGG - Intergenic
1055510086 9:76987516-76987538 AGAGAGAAAGAGAGAGTTGAGGG + Intergenic
1056105750 9:83344653-83344675 CCTGAGAACCAGAGAGTCAATGG - Intronic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056389776 9:86130333-86130355 GCGGTGAAGCAGAGAGTTGGGGG - Intergenic
1056459007 9:86791356-86791378 ACAGAGTCGCAGTGAGTTGAGGG + Intergenic
1056750725 9:89349085-89349107 CCAGGGAGGCTGAGAGTTGCAGG + Intronic
1056814554 9:89791988-89792010 CCAGGGTAGCAAAGAGTAGAGGG - Intergenic
1057602656 9:96472113-96472135 CCAAAGGGCCAGAGAGTTGAAGG - Intronic
1057961552 9:99462272-99462294 ACAGAGAAGCAGATAGAAGAGGG - Intergenic
1058354010 9:104061228-104061250 CCTGAGAAGCAGAGAAAAGAGGG + Intergenic
1058752767 9:108054959-108054981 TCAGAGAAACACAGGGTTGAAGG + Intergenic
1058913364 9:109541671-109541693 CAAGAGAGGCAGTGAGGTGAAGG + Intergenic
1059003682 9:110377900-110377922 TCATAGAAGCAGAGAGTAGATGG - Intronic
1059384030 9:113950288-113950310 CCAGAGAAGGACAGAGGTGGGGG - Intronic
1059526327 9:114993945-114993967 ACAGAGGGGCAGAGACTTGATGG - Intergenic
1059675864 9:116538489-116538511 GCAGAGAACCACAGAGCTGAAGG + Intronic
1059722068 9:116969568-116969590 CCAGAGAAACACAGAGATGAGGG + Intronic
1059750090 9:117239430-117239452 CCAGAGAAGCAGGCAGATGTTGG + Intronic
1059950261 9:119454898-119454920 TCAGGGAGGCAGTGAGTTGAGGG - Intergenic
1060364921 9:123001687-123001709 ACTGAGACTCAGAGAGTTGAGGG - Intronic
1060727003 9:126012864-126012886 CCAGAGAGGGACAGAGTAGAGGG + Intergenic
1186212311 X:7262334-7262356 CCACAGGAGAAAAGAGTTGAAGG + Intronic
1186533943 X:10328077-10328099 CCACAGGTGCAGAGAGCTGAAGG + Intergenic
1188190908 X:27170586-27170608 CCCCAGAAGGAGAGAATTGACGG + Intergenic
1189316632 X:40061562-40061584 GGGGAGAAGCAGTGAGTTGAGGG + Intronic
1189576563 X:42359800-42359822 CCATAGAGGCAGAGACTGGAGGG - Intergenic
1189655696 X:43243323-43243345 CCAGAGCAGCAGATCTTTGAGGG - Intergenic
1189926188 X:45958067-45958089 TAAGAGAGGGAGAGAGTTGAAGG + Intergenic
1190016698 X:46833743-46833765 GCAGAGATCCAGAGAGGTGAAGG - Intergenic
1190578208 X:51863151-51863173 TCATAGAAACAGAGAGTGGATGG - Intronic
1190711709 X:53076469-53076491 ACAGAGAGACAGAGAGATGAGGG - Intronic
1190733200 X:53238051-53238073 TCAGAGAATCTCAGAGTTGAGGG - Intronic
1190879398 X:54482344-54482366 CCAGAGAAGCAGGGAGGAGGTGG - Intronic
1191105397 X:56769130-56769152 CCAGAGAGGGAGGGAGCTGAAGG - Intergenic
1191106390 X:56774532-56774554 CCAGAGAGGGAGGGAGCTGAAGG - Intergenic
1191107383 X:56779934-56779956 CCAGAGAGGGAGGGAGCTGAAGG - Intergenic
1192193091 X:69007086-69007108 CCAAAGAAGAACAAAGTTGAAGG - Intergenic
1192305286 X:69952737-69952759 CCCCAGAAGAGGAGAGTTGAGGG - Intronic
1192488341 X:71550859-71550881 TCATAGAAACAGAGAGTAGAAGG + Intronic
1192592872 X:72375482-72375504 CCTGAGAACCAGAGGGCTGATGG + Intronic
1192792727 X:74399125-74399147 CCAGTGAAGAAGAGAGTGAAGGG - Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1194142579 X:90223101-90223123 CCAGAGAAGAAGAGAGAATAAGG + Intergenic
1194716474 X:97291873-97291895 CCTGACAACCAGATAGTTGAAGG - Intronic
1194940415 X:100002658-100002680 TCACAGAAGCAGACAGTGGAAGG + Intergenic
1194947847 X:100090717-100090739 CCAGGGAAGCAGTGAGTGAACGG + Intergenic
1195029789 X:100915155-100915177 CCAGAGGTCCAGAGAGATGACGG + Intronic
1195111726 X:101657067-101657089 CCAGAGAAGCGGAGACTTCCAGG - Exonic
1195412063 X:104578208-104578230 GCAGAGAAGCAAAAAGATGAGGG + Intronic
1197270209 X:124417194-124417216 AAAGAGAAGAAAAGAGTTGAGGG - Intronic
1197998260 X:132404032-132404054 GCATAGAAACAGAGAGTAGAAGG - Intronic
1199195834 X:145029259-145029281 CCAGAGGCTCAGAGAGTTGAAGG + Intergenic
1199482364 X:148311558-148311580 ACTGAGACTCAGAGAGTTGAAGG + Intergenic
1199690747 X:150307438-150307460 CCAGAGAAGCCGAGTCTTTAAGG + Intergenic
1199775452 X:151006956-151006978 TCATAGAGGCAGAGAGTAGAAGG - Intergenic
1200488333 Y:3792202-3792224 CCAGAGAAGAAGAGAGAATAAGG + Intergenic
1201472499 Y:14349731-14349753 CCAGTGAAGCAAAGGGTTGGGGG - Intergenic
1201585354 Y:15554227-15554249 CCACAGGAGAAAAGAGTTGAAGG + Intergenic
1202338686 Y:23837086-23837108 CCAGAGAAGTTGTGAGTTCATGG + Intergenic
1202532080 Y:25832986-25833008 CCAGAGAAGTTGTGAGTTCATGG - Intergenic
1202596129 Y:26542168-26542190 CCACCGAAGCAGAGAACTGATGG - Intergenic