ID: 975661073

View in Genome Browser
Species Human (GRCh38)
Location 4:76689531-76689553
Sequence GCGCGGTGGCGCGGTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 8, 3: 42, 4: 269}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975661061_975661073 6 Left 975661061 4:76689502-76689524 CCCCGGCCCACCGTGCAGCTGTA No data
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661060_975661073 14 Left 975661060 4:76689494-76689516 CCGCGCTGCCCCGGCCCACCGTG 0: 1
1: 0
2: 1
3: 40
4: 306
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661063_975661073 4 Left 975661063 4:76689504-76689526 CCGGCCCACCGTGCAGCTGTAGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661058_975661073 21 Left 975661058 4:76689487-76689509 CCTCCAGCCGCGCTGCCCCGGCC 0: 1
1: 0
2: 4
3: 68
4: 645
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661064_975661073 0 Left 975661064 4:76689508-76689530 CCCACCGTGCAGCTGTAGCCGCG No data
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661062_975661073 5 Left 975661062 4:76689503-76689525 CCCGGCCCACCGTGCAGCTGTAG 0: 1
1: 0
2: 1
3: 10
4: 155
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661065_975661073 -1 Left 975661065 4:76689509-76689531 CCACCGTGCAGCTGTAGCCGCGG No data
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661059_975661073 18 Left 975661059 4:76689490-76689512 CCAGCCGCGCTGCCCCGGCCCAC 0: 1
1: 0
2: 4
3: 56
4: 508
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661067_975661073 -4 Left 975661067 4:76689512-76689534 CCGTGCAGCTGTAGCCGCGGCGC No data
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975661073 Original CRISPR GCGCGGTGGCGCGGTGGCGC AGG Intronic