ID: 975661073

View in Genome Browser
Species Human (GRCh38)
Location 4:76689531-76689553
Sequence GCGCGGTGGCGCGGTGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 8, 3: 42, 4: 269}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975661061_975661073 6 Left 975661061 4:76689502-76689524 CCCCGGCCCACCGTGCAGCTGTA 0: 1
1: 0
2: 0
3: 3
4: 124
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661060_975661073 14 Left 975661060 4:76689494-76689516 CCGCGCTGCCCCGGCCCACCGTG 0: 1
1: 0
2: 1
3: 40
4: 306
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661064_975661073 0 Left 975661064 4:76689508-76689530 CCCACCGTGCAGCTGTAGCCGCG 0: 1
1: 0
2: 0
3: 0
4: 35
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661062_975661073 5 Left 975661062 4:76689503-76689525 CCCGGCCCACCGTGCAGCTGTAG 0: 1
1: 0
2: 1
3: 10
4: 155
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661063_975661073 4 Left 975661063 4:76689504-76689526 CCGGCCCACCGTGCAGCTGTAGC 0: 1
1: 0
2: 0
3: 10
4: 135
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661067_975661073 -4 Left 975661067 4:76689512-76689534 CCGTGCAGCTGTAGCCGCGGCGC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661059_975661073 18 Left 975661059 4:76689490-76689512 CCAGCCGCGCTGCCCCGGCCCAC 0: 1
1: 0
2: 4
3: 56
4: 508
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661058_975661073 21 Left 975661058 4:76689487-76689509 CCTCCAGCCGCGCTGCCCCGGCC 0: 1
1: 0
2: 4
3: 68
4: 645
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269
975661065_975661073 -1 Left 975661065 4:76689509-76689531 CCACCGTGCAGCTGTAGCCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG 0: 1
1: 1
2: 8
3: 42
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975661073 Original CRISPR GCGCGGTGGCGCGGTGGCGC AGG Intronic
900353400 1:2247994-2248016 ACGGGGGGGCGCGGTGGCGGGGG + Intronic
901577247 1:10210805-10210827 GCGCGGGGGCGCGGGGGGCCGGG - Exonic
902813453 1:18902492-18902514 GCGCGGCGGAGCGCGGGCGCCGG + Exonic
903184764 1:21622665-21622687 GCGCGGTGTCCCGGGGCCGCGGG - Intronic
903777123 1:25800291-25800313 GCGCGGCGGCGCGGTGGCGCGGG - Exonic
903925230 1:26826923-26826945 GCGCGGCGGGGCGGGGGCGGCGG - Exonic
904054295 1:27660001-27660023 GGGCGGTGGGGCGGCCGCGCCGG - Intergenic
907136224 1:52142052-52142074 GCGCTGTGGCCCAGCGGCGCCGG + Intergenic
907364126 1:53945845-53945867 CCGCGGTGGCGGGGTGGGGCGGG - Exonic
907849002 1:58236098-58236120 GCGGGGTGGGGCGGGGGGGCGGG - Intronic
907883983 1:58576664-58576686 CGGCGGTGGGGCGGTGGCGCAGG + Exonic
908242410 1:62198518-62198540 GCGGGGTGGGGCGGCGGCGGGGG - Intronic
910337680 1:86154133-86154155 GCGGGGTGGGGCGGGGGGGCTGG - Intronic
912492697 1:110070701-110070723 GCGCGGGGGCGCGGAGCCCCCGG + Intronic
913959462 1:143327618-143327640 GCGCGGAGAGGCCGTGGCGCCGG + Intergenic
914053822 1:144153191-144153213 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
914125324 1:144813174-144813196 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
914790893 1:150876579-150876601 GGGGGGTGGCGCGGCGGCGGTGG - Exonic
916651767 1:166839896-166839918 GCCCGGGGGCGCGGCGGCGGTGG + Intronic
916666994 1:166975589-166975611 GGGCGGCGGGGCGGAGGCGCGGG - Intronic
920886826 1:209937983-209938005 GCGCGGTGGGGCGGTGGGGTGGG + Intergenic
921207115 1:212858418-212858440 GCGGGGGAGCGAGGTGGCGCCGG + Exonic
923506754 1:234611057-234611079 GCGCTGTGACGCGGCCGCGCTGG - Intergenic
923678592 1:236100973-236100995 GCGGGGCCGCGCGGTGTCGCTGG - Intergenic
1062817750 10:513467-513489 GCGCGGTGGAGGAGAGGCGCGGG - Intronic
1062857516 10:786651-786673 GTGCGGGGGCGGGGTGGGGCGGG + Intergenic
1063458957 10:6203455-6203477 GCGGGGCGGGGCGGAGGCGCGGG + Intronic
1063582909 10:7325247-7325269 GGGTGGGGGCGCGGTGGCTCAGG - Intronic
1064086530 10:12349762-12349784 GCGCGCTGGGGAGGGGGCGCCGG - Exonic
1066602360 10:37123398-37123420 GCGGCCTGGCGCGGTGGCTCAGG - Intergenic
1069021430 10:63492525-63492547 GCGTGGTGGCGTGGTGGCGTGGG + Intergenic
1069761834 10:70816321-70816343 GCGCGGGGCCGCGGTGGGGCGGG + Intronic
1072591664 10:96832864-96832886 GCGTGGGGGAGGGGTGGCGCAGG - Intronic
1073206135 10:101770418-101770440 GCTCGGTGGTGTGGTGGCCCCGG + Exonic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073521826 10:104138392-104138414 GGCCGGTGGCACGGTGGCTCAGG + Intronic
1076909281 10:133379220-133379242 GCGAGGGGGCGGGGAGGCGCTGG - Exonic
1077065538 11:639563-639585 GCGCGGGGGCGCCGGGGCGCGGG - Intronic
1077201491 11:1309642-1309664 GCGCAGTGGGGCGGTGCCGGGGG - Intronic
1077272571 11:1688441-1688463 GCGTGGTGGCTCTGTGGCTCCGG - Intergenic
1077404566 11:2377398-2377420 GCGCGGGGGCGCGGGGGCGCGGG - Exonic
1081872955 11:46391586-46391608 CCGCGGCGGCGCGGGGGCGGGGG - Intergenic
1083419760 11:62546212-62546234 TCGCGGAGGCGCGGAGGCGCTGG + Intronic
1083684782 11:64369640-64369662 GCGGGGCGGAGCGGTGGCGCCGG + Intronic
1084124465 11:67089891-67089913 GCCGGGCGGCGCGGTGGCTCAGG + Intergenic
1085073691 11:73571885-73571907 GGGCGGTGGGGCGGTGGGGCAGG - Intronic
1085574423 11:77589761-77589783 GCGGGGAGGCGGGGAGGCGCGGG - Exonic
1087634440 11:100687133-100687155 GCGAAGGGGCGGGGTGGCGCTGG + Intergenic
1090333377 11:125947744-125947766 GCGAGGTGGCTCCGTGGAGCTGG + Intergenic
1091558671 12:1594423-1594445 GGGCGTGGGCGCGGCGGCGCGGG - Intronic
1091567805 12:1661598-1661620 GAGCGGTGGCGCGGTGACAGGGG - Intergenic
1092487435 12:8914636-8914658 GCGGGGAGCCGCGGTCGCGCCGG + Exonic
1093542224 12:20300637-20300659 ACGCGGTCGCGGGGTGGGGCGGG + Intergenic
1093958677 12:25250559-25250581 GCGCGCGGACGCGGCGGCGCGGG - Intronic
1094051670 12:26226984-26227006 GGGCGGAGGCGCGGTGGCCCCGG - Intronic
1096007187 12:48183161-48183183 GCACGGTGGCGCTCTGGAGCCGG - Intergenic
1096250976 12:50032570-50032592 GCGGGGTGGCGTGGGGGCGCGGG + Intronic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096777918 12:53974959-53974981 ACGGGGTGGCGCAGTGGCGGGGG + Intronic
1096946737 12:55415005-55415027 GCGGGGAGCCGCGGTCGCGCCGG - Intergenic
1097051020 12:56223240-56223262 CCGGGGTGGAGCGGTGGGGCGGG + Intronic
1098161067 12:67648731-67648753 GCGCGGGGGCGCGCGCGCGCGGG + Exonic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1103595502 12:122022416-122022438 GCGCGGCGGCCCGGAGGCGGCGG + Intronic
1103749866 12:123151150-123151172 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1104568420 12:129904361-129904383 GCGCGGACGCGCGGTGGCGGCGG + Intergenic
1106248743 13:27968619-27968641 GCGCGGCGGCCGGGTGGTGCGGG + Exonic
1108074821 13:46668727-46668749 GCGGGGTGGCGGGGTGGCGGGGG + Intronic
1110568598 13:76980323-76980345 GAGCGCTGGCGCGTTGGCGATGG + Intergenic
1111672351 13:91347730-91347752 GCGAAGTGGCGCGAAGGCGCAGG - Intergenic
1112507165 13:99982013-99982035 TCGAGGCGGCGCGGAGGCGCAGG + Exonic
1113120045 13:106916441-106916463 GCGGGGTGGGGCGGGGGGGCCGG - Intergenic
1113806132 13:113110727-113110749 ACGCGTTGGCGCGCCGGCGCCGG - Exonic
1113820660 13:113209878-113209900 GAGCGGGGGCGCCGGGGCGCCGG + Intronic
1113897916 13:113777495-113777517 GAGGGGAGGCGCGGTGGCCCCGG + Intronic
1116018247 14:39432076-39432098 CCCGGGTGGCGCGGTGGCGGCGG - Exonic
1116657003 14:47665817-47665839 GCGGGGTGGGGCGGGGGCGGGGG - Intronic
1116916779 14:50532728-50532750 GCGCGGTGGCGCGGTCGGGAGGG - Intronic
1117875984 14:60249877-60249899 GGGCGGTGGCGGGGAGGCGGGGG + Intronic
1117964064 14:61189140-61189162 TCGCGGGGGCGCTGGGGCGCTGG - Intronic
1119403250 14:74378560-74378582 GCGCGGGGGCCCGGAGGCCCTGG - Intergenic
1121226176 14:92323396-92323418 GCGAGTGGGCGCGGCGGCGCGGG + Intronic
1121368016 14:93332625-93332647 GGGCTGAGGCGCGGCGGCGCCGG - Intronic
1122993297 14:105248974-105248996 CGGCGCTGGCGCGGGGGCGCTGG - Exonic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1124652432 15:31483763-31483785 ACGCTCTGGCGCGCTGGCGCCGG + Exonic
1127867251 15:63042756-63042778 GCGCGGTCGGGCGGAGGAGCGGG - Exonic
1128161102 15:65423126-65423148 GGGCCGTGGCGCGCGGGCGCAGG - Intergenic
1128547750 15:68579231-68579253 CCGCGGCGGAGCGGGGGCGCGGG - Exonic
1130564526 15:84982078-84982100 CCGCGGCGGCCCGGAGGCGCCGG + Exonic
1131475384 15:92734215-92734237 GCGCGGCGGGGCGGAGGCGGAGG - Intronic
1132348200 15:101121223-101121245 GCCAGGTGGGGAGGTGGCGCGGG + Intergenic
1132741268 16:1414506-1414528 GCGCGGAGGCCGGGGGGCGCGGG + Intronic
1132875716 16:2135986-2136008 GCCCGGTCGCGCTGTGGCGAAGG - Intergenic
1132947131 16:2537951-2537973 GCGCGGGGGCGGGGCGGCGCCGG + Exonic
1132968558 16:2673452-2673474 GCGCGGGGGCGGGGCGTCGCGGG - Intergenic
1134121342 16:11586854-11586876 GCGCGGGGACGCCGGGGCGCGGG - Intronic
1134519270 16:14911367-14911389 GCCCGGTCGCGCTGTGGCGAAGG + Intronic
1134706940 16:16310022-16310044 GCCCGGTCGCGCTGTGGCGAAGG + Intergenic
1134960600 16:18402102-18402124 GCCCGGTCGCGCTGTGGCGAAGG - Intergenic
1138161974 16:54762951-54762973 GAGGGGTGGCGTGGTGGAGCAGG - Intergenic
1139451353 16:67029853-67029875 GCGCGGGGCCGCGGCGGCCCAGG + Intronic
1139952635 16:70679568-70679590 GGGCGGTGGGGCTGTGGAGCGGG + Intronic
1142855126 17:2724803-2724825 GCACGGTGGCGCGGTGGCTGCGG + Intergenic
1143212262 17:5197097-5197119 GGGCCCTGGCGCGGTGGCTCAGG - Intergenic
1143562809 17:7705428-7705450 GCGCTCTGCCGCGGGGGCGCGGG + Exonic
1144586907 17:16492421-16492443 GGGCCGTGGCGCGGGGGCGAGGG + Intergenic
1144769573 17:17752200-17752222 GCGGGGCGGCGCGCGGGCGCAGG + Intronic
1144779794 17:17802039-17802061 GCACGGTGGCACTGTGGCTCTGG + Intronic
1145077509 17:19867855-19867877 GCGCGGGGCCGCGGCGGTGCGGG - Exonic
1145885744 17:28381390-28381412 GCGCAGTGGCGCAGCAGCGCGGG - Exonic
1146057750 17:29589583-29589605 GAGCGGCGGCGGGGCGGCGCGGG - Intronic
1148493472 17:48037823-48037845 GCGCGGAGGCGGGGCGGCGGCGG - Intronic
1148557022 17:48584910-48584932 GCGGGGTGGGGCGGTGGGGGAGG - Intronic
1148615785 17:48998498-48998520 GCGGGGTGGCGCGGCGGCGGCGG + Intronic
1148899601 17:50866109-50866131 GCGCGGCAGGGCGGGGGCGCGGG + Exonic
1149678509 17:58487771-58487793 CTGCAGTGGCGCGGTGGCGGCGG + Exonic
1149893690 17:60412408-60412430 GGGCGGTGGGGCGGGGGAGCAGG + Intronic
1150217120 17:63476997-63477019 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1151559173 17:74861557-74861579 GCGCGGCGGGGCGGGGGCGGGGG + Intergenic
1152541916 17:80981141-80981163 CCGCGGGGGCGCGGGGGCGGGGG - Intergenic
1152551993 17:81034767-81034789 AGGCGGGGGCGGGGTGGCGCAGG - Intergenic
1152729194 17:81961467-81961489 GCGGGGGGGGGCGGCGGCGCCGG - Intronic
1152748509 17:82051983-82052005 GCGCGGGGGCGCGGAGGCCCGGG - Exonic
1154130500 18:11733133-11733155 GCCTGGTGGCGCTGTGGCACAGG + Intronic
1154130504 18:11733141-11733163 GCGCTGTGGCACAGGGGCGCTGG + Intronic
1159489074 18:69106207-69106229 GCGCTGGAGTGCGGTGGCGCTGG + Intergenic
1160668525 19:344724-344746 GCGCGGACGCGCGGGGGCGGGGG + Intronic
1160698822 19:496841-496863 GCGCGGAGGGGAGGGGGCGCAGG + Intronic
1160698933 19:497167-497189 GCGCGGAGGGGAGGGGGCGCAGG + Intronic
1160736151 19:663239-663261 GCGGGGCGGAGCGGGGGCGCGGG + Exonic
1160821761 19:1062283-1062305 GCGCGGTGTCCCGGAGGCCCAGG + Exonic
1160853547 19:1206052-1206074 GCGGGGCGGCGCGGCGGCGGGGG - Intronic
1160896942 19:1407560-1407582 GGGCGGCGGCGCGGCGGCGCGGG + Intronic
1161089130 19:2351536-2351558 GCGCTGTGGCGCTCTGGCGCCGG + Exonic
1161101817 19:2425276-2425298 GCCCGGGGCCGCGGTGGTGCGGG + Intronic
1162795972 19:13087907-13087929 GCGAGCTGGCGCGGCCGCGCAGG + Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163508024 19:17719690-17719712 GCGGGGTGGGGCGGCGGCGGCGG + Intronic
1163720586 19:18896410-18896432 GCGCGGTGGGGTGGGGGAGCGGG - Intronic
1163725158 19:18919192-18919214 GCGCAGGGGCGCGGGGACGCTGG - Intronic
1164648137 19:29873744-29873766 GCGCGGGGGCGCGGGGGCGCTGG - Intergenic
1165305420 19:35000250-35000272 GCGCCGTGACGCGGCGGGGCGGG + Intronic
1165774039 19:38394762-38394784 GAGCGGAGGAGCGGCGGCGCTGG - Exonic
1165924919 19:39320866-39320888 GGGAGGGGGCGCGGTGCCGCGGG + Intergenic
1165936142 19:39390213-39390235 GAGCGGTGGGGCAGTGGGGCTGG - Intronic
1166518313 19:43463408-43463430 GCGAGGTTGCGCGCTGGGGCGGG - Intronic
1166959298 19:46488241-46488263 TCGCGGTGGGGAGGTGGCGGGGG + Intronic
1166975121 19:46601343-46601365 GCGCGGACGCGCGGCGGAGCTGG + Exonic
1167311294 19:48739345-48739367 CCCCGGAGGCGCCGTGGCGCGGG + Exonic
1167368090 19:49065082-49065104 GGGCGGGGGCGGGGCGGCGCCGG + Intergenic
1167643781 19:50695247-50695269 GCCGGGGGGCGCGGGGGCGCGGG + Intronic
1202693298 1_KI270712v1_random:105849-105871 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
925730598 2:6917517-6917539 GCGCGGGCGCGGGGAGGCGCGGG + Exonic
927213198 2:20651115-20651137 GGGCGGGGACGCGGTGACGCGGG - Intergenic
928143540 2:28751677-28751699 GTGCGGTTGCGCGGCGGCCCAGG + Intronic
929778829 2:44944497-44944519 GAGCGGCGGCGCGGGGGAGCCGG + Intronic
931321348 2:61177324-61177346 GCGCGGGGACGCGGGGACGCGGG - Intergenic
931348718 2:61470488-61470510 GCGCGGTGGCGCGGCCGCCGCGG - Intronic
933953270 2:87348710-87348732 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934237501 2:90245055-90245077 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934275689 2:91571610-91571632 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
934566978 2:95346603-95346625 GCGCGGGGGCGCGGCGGCGGCGG - Intronic
937895963 2:126977009-126977031 GGGCAGTGGCGGGGTGGTGCTGG - Intergenic
938338978 2:130522998-130523020 GCGCGCGGGTGCGGGGGCGCGGG + Intronic
938350860 2:130597752-130597774 GCGCGCGGGTGCGGGGGCGCGGG - Intronic
942043348 2:172085169-172085191 GGGCGGCGGCGCGGAGCCGCTGG + Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
943185228 2:184598608-184598630 GCGCGGTGGCCGGGCGGAGCGGG - Exonic
944114477 2:196171777-196171799 GCGCGGCGGCGTGGCGGCGCAGG + Intronic
946311200 2:218883537-218883559 GCGCGGGGGCGGGGCGGGGCGGG - Intronic
946908987 2:224442378-224442400 GCGCGGTGGGGCGGGGGTCCGGG - Intergenic
947549899 2:231038225-231038247 GCGCGGGCGGGCGGTGGCTCGGG + Intronic
948491674 2:238317093-238317115 GCGGGGTGGCGGGGGGGTGCAGG + Intergenic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
948669674 2:239559810-239559832 GCGGGGTGGGGGGCTGGCGCCGG + Intergenic
948893092 2:240916468-240916490 GCGCGGGGGCGCGGGGGCACGGG - Intergenic
949014529 2:241702016-241702038 GCGCGGGCGGGCGGTGCCGCGGG - Intronic
949040079 2:241844033-241844055 GGTCGGGGGCGCGGGGGCGCGGG + Intergenic
949040083 2:241844041-241844063 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949040087 2:241844049-241844071 GCGCGGGGGCGCGGGGGCGCGGG + Intergenic
949079860 2:242088451-242088473 GGGCGGGGGCGGGGGGGCGCAGG - Intergenic
949079863 2:242088459-242088481 GCGCGGGGGGGCGGGGGCGGGGG - Intergenic
949079869 2:242088467-242088489 GCGCGGGGGCGCGGGGGGGCGGG - Intergenic
949079875 2:242088475-242088497 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079879 2:242088483-242088505 GCGCGGGGGCGCGGGGGCGCGGG - Intergenic
949079883 2:242088491-242088513 GTGTGGGGGCGCGGGGGCGCGGG - Intergenic
1170585089 20:17728418-17728440 GCGGGGTGGAGCGGGGGCGCTGG - Intronic
1170756354 20:19210500-19210522 GCGGGGTGGGGCGGGGGGGCCGG - Intergenic
1172083231 20:32358705-32358727 GCGGGCTGGGGCGGTGGCGCGGG - Exonic
1172277294 20:33686528-33686550 GCGGGATGGGGCGGCGGCGCGGG + Intergenic
1172474452 20:35226654-35226676 GCGCGGAGGCGGGGGCGCGCTGG + Exonic
1172529310 20:35619118-35619140 GCGCGGGGGCGCGGGGGCTGGGG - Intronic
1175243703 20:57568476-57568498 GCGGGGTGGCTAGGTGGGGCCGG + Intergenic
1175562043 20:59939249-59939271 GCGCGGTGGCGCGGGCCCGCAGG - Exonic
1175562044 20:59939257-59939279 AGGCGGTGGCGCGGTGGCGCGGG - Exonic
1175715500 20:61252393-61252415 GCGCGGGGGAGCGGCGGCGGCGG + Intergenic
1176148045 20:63574143-63574165 GGGCGGAGGGGCGGGGGCGCGGG - Intronic
1176249904 20:64115659-64115681 GCACGGCTGTGCGGTGGCGCAGG + Intergenic
1178417110 21:32412823-32412845 GCGCGGCGGGGCGGAGGCGCAGG - Exonic
1178707647 21:34888848-34888870 GCGCGGCGGCGGGGGCGCGCGGG - Intronic
1179563966 21:42234920-42234942 CCGCGGCGGAGCGGCGGCGCGGG + Intronic
1179977047 21:44874076-44874098 GCGCGGTGCTTCGGTGGCGGAGG + Intergenic
1180014763 21:45074803-45074825 GCGCGGGGCCGCGGCGGCTCGGG + Intronic
1181162041 22:20965137-20965159 GCGGGGGGGCGGGGAGGCGCGGG - Exonic
1182586343 22:31346160-31346182 GCGCACGGGGGCGGTGGCGCGGG + Exonic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183535623 22:38398929-38398951 GCGCGGGGGCGGGGTGGGGCGGG - Intergenic
1183903347 22:41022188-41022210 GCGCGGGGCGGCGGAGGCGCGGG + Intergenic
1185413484 22:50697725-50697747 GCGGGGGGGCGCGGGGGGGCGGG + Intergenic
949993744 3:9600680-9600702 GGGCGGGGGCGCTGGGGCGCTGG + Intergenic
952418911 3:33114073-33114095 GCGCGATGGAGCCGGGGCGCCGG + Exonic
956805336 3:72804411-72804433 GCGGGGTGGGGGGGTGGTGCCGG - Intronic
958453860 3:94306074-94306096 GCGGGGTGGCGGGGGGGCGGGGG + Intergenic
960110314 3:113838879-113838901 GGGCGGTGCCGCGGCGGCGGAGG + Exonic
961696603 3:128709641-128709663 GCGCGGGGGCGGGGTGTGGCGGG - Intergenic
961817177 3:129557060-129557082 GTGCGGTGGCTCGGCGGCGGGGG - Intronic
962808899 3:138945782-138945804 GCCCCGTGGTGCGGTGGGGCAGG + Exonic
963870301 3:150408720-150408742 GGGCGGTGGGGCTGTGGCGCGGG - Exonic
966808762 3:183825637-183825659 GGGCGGTGCTGCGGCGGCGCGGG - Intergenic
967820914 3:193837878-193837900 GCGGGGTGGGGCGGTGGCAGTGG + Intergenic
968434127 4:576251-576273 GCGCGGGGTCGCGGCGGCGGCGG - Intergenic
968551478 4:1225899-1225921 TCGGGGTGGCGAGGTGACGCGGG - Intronic
968834846 4:2955585-2955607 GCCAGGAGGCGCTGTGGCGCAGG - Intronic
968879797 4:3293040-3293062 GCGCGCGCGGGCGGTGGCGCGGG + Intronic
969295772 4:6270033-6270055 GGGCAGTGGCGCGGTGGCTGTGG + Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
971244101 4:24912973-24912995 GCGCAGCGGCTCGGAGGCGCCGG - Intronic
971457369 4:26857687-26857709 GCGCGGGGCTGCGGTGGCGCAGG + Intronic
973774798 4:54233177-54233199 GCGCAGGGGCGCAGGGGCGCAGG + Intronic
975661073 4:76689531-76689553 GCGCGGTGGCGCGGTGGCGCAGG + Intronic
975821021 4:78270534-78270556 GCGGGGGGGCGGGGTGGCGGGGG - Intronic
979674815 4:123398796-123398818 GAGCGGCGGCGCGGTGGCCCAGG + Intronic
982616151 4:157637978-157638000 GCGCGGCTGCGCTGCGGCGCGGG - Intergenic
983649779 4:170026466-170026488 GCCGGGCGGCGCGGAGGCGCGGG + Intronic
985749753 5:1667388-1667410 GAGCGGTGGCGCCGTTGCCCTGG + Intergenic
985896301 5:2751573-2751595 GGGCGGCGGCGGGGTGGCGGTGG + Exonic
992067478 5:73120778-73120800 CCGCGGCAGCGCGGAGGCGCTGG + Intronic
997013763 5:129906235-129906257 GCGCGCTGGCACGGTGGGGATGG - Intronic
997635128 5:135399060-135399082 ACGCGGCGGCTCGGTGGCGGCGG + Exonic
998353003 5:141513330-141513352 GGGCGGGGGCGGGTTGGCGCCGG + Intergenic
1001495975 5:172188043-172188065 GGCCGGGGGCGCGGTGGCGCCGG + Exonic
1001566154 5:172700752-172700774 GCGGGGTGGGGTGGTGGGGCGGG - Intergenic
1001633928 5:173196460-173196482 GTGCAGTGGCGAGGTGGCCCTGG - Intergenic
1001773418 5:174312027-174312049 GCGCGGGGGCGCGGGGGCTCGGG + Intergenic
1003086262 6:3063826-3063848 GCGCGTTCGCGCGGCGGCGGAGG - Intergenic
1003112128 6:3259222-3259244 GGGCGGCGGGGCGGGGGCGCGGG + Intronic
1003112131 6:3259230-3259252 GGGCGGGGGCGCGGGGGCGCCGG + Intronic
1003875878 6:10436179-10436201 GCGCGGTGGCGAGTGGGCGACGG - Intergenic
1004262142 6:14117756-14117778 GAGCTGTGGCGCGCGGGCGCCGG - Exonic
1005385199 6:25279123-25279145 GTGCGGTGCTGCGGTGGCGGCGG - Intronic
1006642453 6:35496381-35496403 GCGCGGTGCCGCGGCTGCGCTGG - Intronic
1010703455 6:79078342-79078364 GCGCCGGGGGGCGGGGGCGCGGG - Intergenic
1010985000 6:82413493-82413515 GCTCGGTGGCTCAGTGGCCCAGG + Intergenic
1011448958 6:87472949-87472971 GCGCGGGGGCGCGGAGGGGGCGG + Intronic
1012398344 6:98824809-98824831 GCGCGGTGGCTGCGCGGCGCTGG + Intergenic
1012410120 6:98947627-98947649 AAGCGGAGGCGCGGGGGCGCGGG + Intronic
1012410123 6:98947635-98947657 GCGCGGGGGCGCGGGGCCGCGGG + Intronic
1014137592 6:117907393-117907415 GCGCGGGGGCGCGGAGCTGCCGG - Intergenic
1014156720 6:118119489-118119511 GCGGGGTGGAGGGGGGGCGCCGG - Intronic
1015496600 6:133889634-133889656 GCGCGTTGGCGGCGTTGCGCTGG - Exonic
1016328223 6:142927001-142927023 GCGCGGCGGCGCGGCGGCGCGGG + Intronic
1016982323 6:149864397-149864419 GCGCGGGGGCGGGGCCGCGCGGG - Intergenic
1018017815 6:159727612-159727634 GCGCGGTGGCCCGGGGGGCCCGG + Intronic
1019365073 7:628986-629008 CCGCGGTGGCGGAGTGGCACGGG - Intronic
1019406324 7:885996-886018 GCGGGGGAGCGCGGTGGCGAGGG + Intronic
1019735202 7:2647027-2647049 GCGCGGTGGGGCGGGGACGGAGG + Intronic
1021969370 7:25951396-25951418 GGGCGGTGGCGCGTGGGGGCGGG + Intergenic
1022698029 7:32728753-32728775 GGGCGGCGCCGCGGTGGCCCCGG + Intergenic
1023937264 7:44748863-44748885 GGGCGGCGGCGCGATGGCGCGGG + Intronic
1024578376 7:50782618-50782640 GCGCGGTGGCCCCGAGGCCCCGG - Intronic
1026994482 7:74606607-74606629 GAGCGGTGGAGCGGGGGCGGCGG - Intergenic
1027059361 7:75073459-75073481 GCGCGGTCGGGCGCCGGCGCGGG + Exonic
1028621582 7:92834003-92834025 GCGCGGGGGAGGGGAGGCGCCGG + Intronic
1029238701 7:99143682-99143704 GCGAGGGGGCGCCGGGGCGCGGG + Intronic
1029238728 7:99143810-99143832 GGGCTGGGGGGCGGTGGCGCTGG - Exonic
1029425830 7:100493634-100493656 GCGGGGTGGGGCTGTGCCGCGGG - Exonic
1030733556 7:113017724-113017746 GTGCGGGGGCACGGTGGCGCGGG + Intergenic
1031317255 7:120273310-120273332 GCTCGGCAGCGCGGGGGCGCGGG - Intergenic
1031317277 7:120273379-120273401 CGGCGTTGGCGCGGTGGGGCCGG - Intergenic
1031986554 7:128167722-128167744 GCGCGGGGGCGCGGGAGCCCCGG + Intergenic
1034255287 7:149721447-149721469 GCGTGGTGGCCAGGTGGGGCTGG - Exonic
1034418723 7:150978182-150978204 GCGCGGGGACGCGGCGGAGCGGG - Exonic
1035747927 8:1974606-1974628 GAGCCGCGGCGCGGTGGGGCGGG - Intronic
1036033248 8:4994123-4994145 GCGGGGTGGGGCGGGGGCCCAGG + Intronic
1037473944 8:19237848-19237870 TCGTGGTGGCGATGTGGCGCAGG + Intergenic
1038540502 8:28386333-28386355 GTGCGGGGGCGCGGAGGCGCGGG - Intronic
1038575717 8:28701844-28701866 GCCCGGTGGCTCGGGGGCCCGGG + Intronic
1039212694 8:35235348-35235370 GGGCGGTGACGCGGCGGCGCTGG - Intergenic
1040038842 8:42896768-42896790 CGGCGGCGGCGCGGCGGCGCGGG + Intronic
1041281079 8:56211540-56211562 GCTGGGGGGCGCGGTGGGGCGGG + Intergenic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1049391186 8:142372528-142372550 GCGGGGTGGAGCGGGGGTGCTGG + Intronic
1049756602 8:144313733-144313755 GCGGGGAGGCGGGGAGGCGCGGG - Intronic
1050845206 9:10208231-10208253 GCGGCGGGGCGCGGTGGCTCAGG + Intronic
1053003368 9:34589871-34589893 GCGCGCGGCCGCGGAGGCGCGGG - Intronic
1055501473 9:76906274-76906296 GCGCCGTGGCGCGTGGGCGGAGG + Intergenic
1057313501 9:93955395-93955417 GCGGGGCGGGGCGGTGACGCGGG - Intergenic
1057432163 9:95004731-95004753 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057432187 9:95004783-95004805 GCGCGGGGGCGCGGGGCGGCCGG + Intronic
1057832687 9:98419095-98419117 GCCCGGGGGGGCGGTGGAGCAGG + Intronic
1059102534 9:111484051-111484073 GCGCGGCGGCGCGGTTAGGCCGG - Exonic
1061248374 9:129413272-129413294 GCGGCGGGGCGCGTTGGCGCGGG - Intergenic
1061317109 9:129803230-129803252 GCTCCGGGGCGCGGCGGCGCTGG + Exonic
1061828212 9:133274925-133274947 GCGCGGTGGCGCGGCCTGGCGGG - Intronic
1062022578 9:134326391-134326413 GCGCGGGCGCGCGGCGGCGGGGG + Intronic
1062484652 9:136769248-136769270 GAGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062484667 9:136769282-136769304 GAGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062484694 9:136769341-136769363 GAGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062484720 9:136769401-136769423 GGGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062484737 9:136769435-136769457 GGGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062484768 9:136769502-136769524 GGGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062484799 9:136769569-136769591 GGGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062484815 9:136769602-136769624 GAGGGGTGGCGGGGTGGCGGGGG - Intergenic
1062565439 9:137162099-137162121 GCCGGGTGGCGGGGTGGCGGCGG + Intronic
1189374330 X:40454883-40454905 GCCGGGCGGCGCGGTGGCTCAGG - Intergenic
1190654474 X:52598880-52598902 GGGCGGTGGCGGGGTGGGGGAGG - Intergenic
1190789585 X:53686458-53686480 GCGCGGAGGCGCGGAGGTGGCGG - Intronic
1195113026 X:101666153-101666175 GGGCGGTGGGGCGGGGGCGGGGG + Intergenic
1197655147 X:129108658-129108680 GCGCGGCGGGGCGGTGGGGTGGG + Intergenic
1199771141 X:150976081-150976103 GAGCAGGGACGCGGTGGCGCTGG + Intergenic