ID: 975661117

View in Genome Browser
Species Human (GRCh38)
Location 4:76689701-76689723
Sequence TGGTGAGTGAGGAGGGCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 677
Summary {0: 1, 1: 1, 2: 1, 3: 54, 4: 620}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975661109_975661117 8 Left 975661109 4:76689670-76689692 CCGGGGGCGGCGGCCGCGAGGCG 0: 1
1: 0
2: 2
3: 57
4: 380
Right 975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG 0: 1
1: 1
2: 1
3: 54
4: 620
975661104_975661117 18 Left 975661104 4:76689660-76689682 CCCGAGCAGCCCGGGGGCGGCGG 0: 1
1: 1
2: 3
3: 39
4: 395
Right 975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG 0: 1
1: 1
2: 1
3: 54
4: 620
975661106_975661117 17 Left 975661106 4:76689661-76689683 CCGAGCAGCCCGGGGGCGGCGGC 0: 1
1: 0
2: 6
3: 57
4: 454
Right 975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG 0: 1
1: 1
2: 1
3: 54
4: 620
975661108_975661117 9 Left 975661108 4:76689669-76689691 CCCGGGGGCGGCGGCCGCGAGGC 0: 1
1: 0
2: 5
3: 52
4: 488
Right 975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG 0: 1
1: 1
2: 1
3: 54
4: 620
975661098_975661117 26 Left 975661098 4:76689652-76689674 CCTGGAGCCCCGAGCAGCCCGGG 0: 1
1: 0
2: 5
3: 53
4: 393
Right 975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG 0: 1
1: 1
2: 1
3: 54
4: 620
975661112_975661117 -5 Left 975661112 4:76689683-76689705 CCGCGAGGCGAGCGGCGATGGTG 0: 1
1: 0
2: 0
3: 4
4: 42
Right 975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG 0: 1
1: 1
2: 1
3: 54
4: 620
975661103_975661117 19 Left 975661103 4:76689659-76689681 CCCCGAGCAGCCCGGGGGCGGCG 0: 1
1: 0
2: 1
3: 35
4: 223
Right 975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG 0: 1
1: 1
2: 1
3: 54
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975661117 Original CRISPR TGGTGAGTGAGGAGGGCGGC TGG Intronic
900190242 1:1350016-1350038 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190258 1:1350056-1350078 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190274 1:1350096-1350118 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190290 1:1350136-1350158 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190306 1:1350176-1350198 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190322 1:1350216-1350238 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190338 1:1350256-1350278 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190354 1:1350296-1350318 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190370 1:1350336-1350358 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190386 1:1350376-1350398 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190402 1:1350416-1350438 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190418 1:1350456-1350478 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190434 1:1350496-1350518 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190450 1:1350536-1350558 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190466 1:1350576-1350598 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190482 1:1350616-1350638 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190498 1:1350656-1350678 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190514 1:1350696-1350718 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190530 1:1350736-1350758 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190546 1:1350776-1350798 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190562 1:1350816-1350838 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190578 1:1350856-1350878 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190594 1:1350896-1350918 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190610 1:1350936-1350958 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190626 1:1350976-1350998 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190642 1:1351016-1351038 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190658 1:1351056-1351078 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190674 1:1351096-1351118 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190690 1:1351136-1351158 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190706 1:1351176-1351198 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190722 1:1351216-1351238 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190738 1:1351256-1351278 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190754 1:1351296-1351318 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190770 1:1351336-1351358 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190786 1:1351376-1351398 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900190802 1:1351416-1351438 GGGGGAGTGAGGAGGGGGCCTGG + Intergenic
900206979 1:1435820-1435842 CGGTGAGTGCGGCGGGCGGCCGG + Exonic
900342088 1:2194255-2194277 TGGTGCGGGAGGTGGCCGGCAGG + Intronic
900667942 1:3828140-3828162 TGGTGAGGGAGGCGGGAGGCAGG + Intronic
900857886 1:5200584-5200606 GGATGAGTGAGGAGGGCAGCAGG - Intergenic
901386126 1:8910474-8910496 TGGAGAATGAGGAAGGTGGCAGG + Intergenic
901421069 1:9151573-9151595 CGGTGGGTGGTGAGGGCGGCTGG - Intergenic
901653736 1:10757406-10757428 TGGTGTGAGAGGATGGTGGCTGG - Intronic
901925008 1:12560577-12560599 TGGTGAGTGAGGAGCAGGGGAGG - Intergenic
902208595 1:14888230-14888252 TGATGAGAGAGGAAGGAGGCCGG - Intronic
902515911 1:16989584-16989606 TGGTGCCTGAGGAGGGAGACAGG + Intronic
903181765 1:21608459-21608481 TGGGGAGTGGGGAGGGCGGAGGG + Intronic
903533923 1:24053887-24053909 TGGTGAGAGAGCATGGGGGCAGG + Intergenic
903582886 1:24385372-24385394 TGGAGAGTGAGGCAGGCAGCAGG + Intronic
903849096 1:26295634-26295656 TGGTGAGTGAGGAGGGGAATGGG - Intronic
904333708 1:29784029-29784051 TGGTGAGGGAGGAGGGAGGATGG - Intergenic
904469867 1:30729649-30729671 AGGAGAGCGAGGAGGGAGGCAGG - Intergenic
904565217 1:31424690-31424712 GGGTGTGTGAGGAGGGGGCCGGG + Exonic
904565992 1:31428806-31428828 TGGTTAGTGAGGTGGGTGGTAGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
905011244 1:34748295-34748317 AGGAGAGTGAGGAGGGAGACAGG - Intronic
905171286 1:36111209-36111231 TGGGGAGTGATGAGGGTGGCTGG - Intronic
905240863 1:36580681-36580703 TGAGGAGGGAGGAGGGAGGCTGG + Intergenic
905804210 1:40864019-40864041 GGGGGAGTGAGGAGGGCCTCAGG + Intergenic
907045878 1:51299760-51299782 TGTAGAGTGAGGTGGGTGGCTGG - Intronic
908256571 1:62308452-62308474 TGGTGAGTGAGGAGGGGTAGGGG - Intronic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
910544175 1:88395521-88395543 TGGTGTGTGGGGAAGGCGGAAGG + Intergenic
911781589 1:101886391-101886413 TGGGAAGGGAGGAGGCCGGCTGG + Intronic
912019356 1:105087603-105087625 TGGAGAGTGAGGAGAACGGTGGG + Intergenic
912449450 1:109760248-109760270 GGGTGAGTGAGGAGGAAGACTGG - Intronic
912781862 1:112557737-112557759 TGGGGAGTGAGGAGAACAGCAGG + Intronic
913229789 1:116732199-116732221 TGGTAAGAGAGGAGGACAGCGGG - Intergenic
914918397 1:151831829-151831851 AGGGGAGGGAGGAGGGCGGAGGG + Exonic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915469141 1:156115305-156115327 CGGGGAGTGGAGAGGGCGGCGGG + Intronic
915598959 1:156910463-156910485 AGGTGGGAGAGGTGGGCGGCGGG - Intronic
915839079 1:159201098-159201120 TGGGGAGGGAGGAGGGCGGGGGG + Exonic
917925879 1:179788843-179788865 TGGTGAGTGAGGCAGGCTGGAGG - Intronic
918099460 1:181361074-181361096 TGGTGAGTGGTGAGGGTGACTGG - Intergenic
918126780 1:181590769-181590791 TGGTGAGTGGGGAGAGTGGGAGG - Intronic
918295171 1:183149681-183149703 TGGTGTGTGAGGAGGGGTGTGGG - Intergenic
918524117 1:185446550-185446572 TTGTCAGTGAAGAGGGTGGCTGG + Intergenic
919451256 1:197775331-197775353 TGGTGGGTGGGGTGGGAGGCGGG - Intronic
919724816 1:200874614-200874636 TTGTGAGTGAGAAGGGCAGGGGG - Intergenic
919892158 1:201983165-201983187 AGGTGAGGGTGCAGGGCGGCTGG - Intronic
920031819 1:203042099-203042121 TGGTGTGTGAGGGAGGCTGCAGG + Intronic
920035358 1:203061650-203061672 AGGACAGTGAGGAGGGCAGCTGG + Exonic
920038578 1:203081749-203081771 TGGGGAATGAGGAGGGCAACTGG - Intergenic
920335921 1:205245077-205245099 TGGTCAGGAAGGAGGGCAGCAGG + Intronic
920652463 1:207849053-207849075 TGGTGAGAGAGGAGATTGGCAGG - Intergenic
920666196 1:207964262-207964284 CGGTGAGAGTGGAGGGTGGCGGG + Intergenic
921676615 1:217983168-217983190 TGTTGAGGGAGGAGGGAGGAGGG + Intergenic
921845041 1:219869430-219869452 TGGGGTGTGGGGAGGGGGGCGGG + Intronic
922170467 1:223150332-223150354 AGCTGAGTGAGGAGGGAGGATGG - Intergenic
922784154 1:228274840-228274862 AGGTGAGTGTGGGGGGCAGCAGG + Exonic
922784426 1:228276059-228276081 GGAGGAGTGAGGAGGGAGGCGGG + Intronic
924090156 1:240493212-240493234 CGGTGAGCGAGGAGGGCTGCCGG - Exonic
924329091 1:242924458-242924480 TGGTGAGGGAGGAAGGCAGTGGG + Intergenic
924624751 1:245688828-245688850 ACGCGGGTGAGGAGGGCGGCAGG + Intronic
1063393147 10:5663384-5663406 GGGTGAGTGATGAGGGAGTCAGG - Intronic
1063749541 10:8927143-8927165 TGGTGCCTCAGGAGGGAGGCTGG - Intergenic
1064138948 10:12774060-12774082 TGGTGCGGGGGGAGGGGGGCGGG + Intronic
1065869690 10:29945802-29945824 AGGTGAGAGAGGAGGAGGGCTGG - Intergenic
1066380562 10:34897796-34897818 TGGCGGGTGAGGAGTGCAGCTGG + Intergenic
1066432179 10:35362792-35362814 TGGGGAGTGAGGAGCGCCTCTGG - Intronic
1067720444 10:48723889-48723911 TGGTGAGTGAGCATGGGGTCTGG + Intronic
1068172164 10:53407981-53408003 TGGTGAATGAGAAGGGCTGTTGG - Intergenic
1068465140 10:57380158-57380180 TGGAGACTGAGAAGGGCGGGAGG + Intergenic
1068955666 10:62817346-62817368 GGGTGTGTGAAGAGGGCAGCGGG - Intronic
1069995663 10:72340768-72340790 ATGTGAGTGAGGAGGGCGCCAGG - Exonic
1070321510 10:75358290-75358312 CGGTGAGTGAGGAGGAGGCCGGG - Intergenic
1070541245 10:77416978-77417000 TGACGAGTGGGGAGGGCAGCCGG - Intronic
1070599658 10:77856847-77856869 TGGTCAGTGAGGAGGGGTGGTGG + Exonic
1070627272 10:78060268-78060290 TGGTGAGGGAGTAGGGCAGTGGG + Intergenic
1072263204 10:93702354-93702376 GGGTGTGTGAGGAGGGCTGTGGG - Exonic
1072681989 10:97514350-97514372 TGGGGAGGGATGAGGGTGGCAGG - Intronic
1073242337 10:102066679-102066701 TGGTGTTTGAGGAGGCCTGCGGG + Exonic
1074419929 10:113299752-113299774 AGGTGAGGGAGGAAGGCCGCCGG + Intergenic
1075222664 10:120598603-120598625 TTGTGAGAGAGGAGAGCAGCAGG - Exonic
1076787790 10:132759699-132759721 TGCAGGGTGAGGAGGGCGCCGGG - Intronic
1076873050 10:133202903-133202925 TGGGGAGAGAAAAGGGCGGCCGG + Intronic
1077292430 11:1804137-1804159 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292448 11:1804187-1804209 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292454 11:1804203-1804225 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292472 11:1804253-1804275 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292478 11:1804269-1804291 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292484 11:1804285-1804307 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077593901 11:3514985-3515007 AGGTGAGTGAGGAGATCTGCAGG + Intergenic
1078567190 11:12426386-12426408 TGGTGAGTAAGGAGGGGGAGTGG + Intronic
1079375501 11:19888298-19888320 TGGTGAGAGGGGAGCGTGGCAGG - Intronic
1079719363 11:23790846-23790868 TGGGGTGGGGGGAGGGCGGCGGG - Intergenic
1080785798 11:35473877-35473899 GGGTGAGTGAGGAAAGCGGGAGG + Intronic
1081566873 11:44265667-44265689 GGTTGGGTGAGGTGGGCGGCAGG + Intronic
1081575417 11:44316206-44316228 TGGTGAGTCACGCGGTCGGCTGG - Intergenic
1081591127 11:44423916-44423938 TGGTGAGTGAGGCGGGGGGAGGG - Intergenic
1081603694 11:44513304-44513326 GGGAGAGTGAGGAGGGAGGATGG + Intergenic
1081751047 11:45511609-45511631 AGATGAGAGAGGAGGGCAGCTGG - Intergenic
1083509910 11:63199550-63199572 AGCTAAGTGAGGAGGGAGGCGGG - Intronic
1083619386 11:64041474-64041496 AGGGGAGTGAGGAGGGTGCCCGG + Intronic
1083922694 11:65788969-65788991 AGGTGAGGGTGGAGGGCGGAGGG - Intronic
1084421656 11:69063506-69063528 TGGCAAGAGCGGAGGGCGGCAGG - Intronic
1084554852 11:69869456-69869478 TGGTGAGTGAGGACTGAGGCAGG - Intergenic
1084612438 11:70212204-70212226 TGGATAGTGAGGAAGGCTGCAGG - Intergenic
1085418803 11:76337980-76338002 TGGAGTGGGAGGAGGGGGGCAGG - Intergenic
1085592421 11:77776112-77776134 TGCTGAGGGAGGAGGACTGCTGG + Intronic
1085732856 11:79013918-79013940 TGGGGAGTGAGCAGGGAGGGAGG - Intronic
1087250440 11:95893080-95893102 TAGTGAGTGAGGAGGATGGGTGG - Intronic
1088239257 11:107757083-107757105 TGGTGAATGAGCAGAGCTGCTGG - Intergenic
1088469546 11:110178030-110178052 TGGTGGGTGGGGAGGGCAGATGG - Intronic
1088859803 11:113789313-113789335 TGGTCAGTGAGAAGGTCGGAGGG + Intergenic
1088939574 11:114439674-114439696 AGGTGAGTGAGGTCGGCGGGGGG + Exonic
1089065131 11:115656831-115656853 TGGTTAGTGAGGTAGGAGGCAGG + Intergenic
1089109710 11:116045595-116045617 TGGTGAGTGAGTAGGGTTGCTGG - Intergenic
1089297824 11:117480594-117480616 AGGGAAGTGAGGAGGGCAGCAGG + Intronic
1089350697 11:117820111-117820133 TGGTGACAGAGGAGGGAGACAGG + Exonic
1089639509 11:119838519-119838541 TTGAGAGTGAGGAGGTGGGCTGG + Intergenic
1089730049 11:120513680-120513702 TGGTGAGGCAGGCGGGAGGCTGG - Intronic
1090075700 11:123578846-123578868 TGGTGAGTGAGGATGGCAGGAGG + Intronic
1090458045 11:126866631-126866653 GGGGCAGTGAGGAGGGTGGCAGG - Intronic
1090503728 11:127287242-127287264 TGGGGAGGGGGGAGGGGGGCGGG - Intergenic
1090776153 11:129967905-129967927 TGGTGAGTGGGTAGGGCTGTGGG - Intronic
1090776295 11:129968769-129968791 TGGTGAGTGGGTAGGGCTGTGGG - Intronic
1090784001 11:130032425-130032447 TGGAGAGAGAGGAGGTTGGCAGG - Intergenic
1090908204 11:131095835-131095857 AGGAGAGTGAGGAGGGATGCAGG - Intergenic
1092964294 12:13626821-13626843 TGGTGAGGGGGGAGGGGGGAGGG - Intronic
1095066089 12:37777382-37777404 TGGGGTGGGGGGAGGGCGGCGGG - Intergenic
1096749240 12:53748260-53748282 TGGAGAGGGAAGAGGGCGGGCGG - Intergenic
1096992528 12:55816990-55817012 TGGTGTGTGAGGAAGGCTGGCGG + Intronic
1097014305 12:55974338-55974360 TGGTGAGTCGGGAAGGCGGCTGG + Intronic
1097698633 12:62798685-62798707 AGGTGAATGAGGAGGAAGGCTGG - Intronic
1098885358 12:75955321-75955343 GGGTGAGTGAGGAGGGCTTGGGG - Intergenic
1099972283 12:89512653-89512675 GGCTGAGGGAGGCGGGCGGCTGG + Intronic
1101686962 12:107034051-107034073 GGGTGAGACAGGAGGTCGGCAGG + Intronic
1101886081 12:108663673-108663695 TGGGGAGAGTGGAGGGAGGCAGG + Intronic
1102518428 12:113465096-113465118 TGGAGAGGGAAGAGGGTGGCAGG - Intronic
1103978026 12:124716479-124716501 TGGTGTGTTAGCAGGGCGGCTGG + Intergenic
1106232038 13:27827967-27827989 TGGTGTGACAGGAGGGAGGCAGG - Intergenic
1106354905 13:28972188-28972210 TGGAAGGTGAGGAGGGTGGCAGG + Intronic
1107094305 13:36518184-36518206 GGGTGAGTGAGAAGGGAGACTGG + Intergenic
1108068956 13:46607795-46607817 TGGCGAGTGAGGGGTGCGGCAGG + Intronic
1108459110 13:50647357-50647379 TGGTGAGAGGGGAGGGCAGTAGG + Intronic
1109182143 13:59226314-59226336 TGGTGAATGAGGAGTGAGGGTGG - Intergenic
1113779480 13:112968130-112968152 TGGGGAGTGAGGTGGGGGGGGGG + Intronic
1114454408 14:22845873-22845895 AGGTGGACGAGGAGGGCGGCGGG + Exonic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114562456 14:23603160-23603182 TGGGCAGGGAGGAGGCCGGCAGG + Intergenic
1117050477 14:51854945-51854967 TGGAGATTGAAGAAGGCGGCTGG - Intronic
1117059387 14:51946658-51946680 TGGTGAGGGAGTAGGGCTGGAGG - Intronic
1118096754 14:62546146-62546168 TGGGGAGGGGGGAGGGGGGCGGG - Intergenic
1118303640 14:64636526-64636548 AGGTGGGTGACGAGGGTGGCAGG + Intergenic
1119548897 14:75493662-75493684 TGGAGAGTGGGGAGGGGGACTGG + Intergenic
1119729195 14:76940311-76940333 AGTTGAGAGAGGAGGGGGGCTGG - Intergenic
1119879836 14:78091519-78091541 TGGTGAGAGAAGGGGCCGGCAGG - Intergenic
1119970480 14:78964815-78964837 TGGTGAGTGACTAGGGCAGAGGG - Intronic
1120033451 14:79668693-79668715 TGGTGTGTAAGGAAGGGGGCGGG + Intronic
1120870668 14:89334249-89334271 TGGGGAGTGAGGCGGGCTGGGGG + Intronic
1120881370 14:89417258-89417280 CGGGGAGGGAGGAGGGCGGAGGG + Intronic
1121103277 14:91264489-91264511 AGGTGAGTGCGCCGGGCGGCCGG - Intergenic
1121170882 14:91853306-91853328 AGGTGAGAGAGGAAGGTGGCTGG + Intronic
1121437203 14:93927693-93927715 TGGGGACTGAGGAGGGGGGCTGG + Intronic
1122079599 14:99257585-99257607 CGGAGCGTGAGGAGGGTGGCGGG + Exonic
1122263920 14:100538057-100538079 TGGGGGCTGAGGCGGGCGGCAGG + Exonic
1122779792 14:104138782-104138804 TGGAGAGGGAGGCGGGCGGCGGG + Intronic
1122899519 14:104776548-104776570 TGGGGAGTGAGGATGGCTACAGG + Intronic
1125029756 15:35064316-35064338 AGGGGAGAGAAGAGGGCGGCAGG - Intergenic
1125491070 15:40148773-40148795 TGGTGGGTGAGGACCGGGGCTGG + Intergenic
1125714434 15:41811234-41811256 AGGTGAGTGAGGAAGAGGGCTGG + Exonic
1128012041 15:64306971-64306993 TTGTGGGTGGGGAGGGGGGCGGG + Intronic
1128250002 15:66157237-66157259 TTGGGAGTGAGGAGGGAGGCTGG - Intronic
1129263754 15:74383161-74383183 GGGGGAGTGAGCAGGGCCGCAGG + Intergenic
1131701568 15:94942672-94942694 GAGTGAGAGTGGAGGGCGGCAGG - Intergenic
1132729210 16:1352305-1352327 TGGTGAGTGAGGAGCGCTGTTGG + Exonic
1132851912 16:2028638-2028660 TGGGGAGAGAGGAGGGCTGGGGG + Intronic
1133040600 16:3058332-3058354 CGGTGAGTGGGGCCGGCGGCGGG + Exonic
1133283327 16:4679323-4679345 TGCTGAGTGAGCTGGGCGGCCGG + Intronic
1133341144 16:5037025-5037047 TGGTGGGAGAGGAGGGCCGTGGG + Intronic
1133647597 16:7778788-7778810 TGGTCAGTGGGGAGGGAGGTGGG + Intergenic
1134052873 16:11149181-11149203 TGGTGAGTCAGGCAGGCAGCGGG + Intronic
1135552445 16:23408397-23408419 GGGTGAGTGGGGCGGGAGGCAGG + Intronic
1135583680 16:23650431-23650453 TGGTGTGTGGGGAGGGAGGGAGG - Intronic
1135872794 16:26166296-26166318 GGGTCAGTGAGGAGGGAGGGAGG + Intergenic
1136230414 16:28882588-28882610 TGGTGAGTGACAGGGACGGCTGG + Exonic
1136344369 16:29665410-29665432 TGCTGGGTGAGGATGGCAGCAGG - Exonic
1136617963 16:31410305-31410327 TGGCGAGTGATGCGGGTGGCAGG + Intronic
1137530386 16:49275579-49275601 TGGGGAGGGAGGAGGCAGGCTGG + Intergenic
1137574370 16:49589037-49589059 TGTTGACAGAGGAGGGCTGCTGG - Intronic
1137677862 16:50312759-50312781 CGGGGAGTGGGGAGGGGGGCGGG - Intronic
1137859065 16:51828088-51828110 TGGTGAGTGAGAAGGAAGCCTGG - Intergenic
1138026006 16:53523020-53523042 AGGTCAGTGAGGAGAGCAGCAGG - Intergenic
1138187090 16:54985110-54985132 TGCTGGGTGAGGAGGGCTCCTGG - Intergenic
1138396757 16:56710381-56710403 TGGTCAGTGGTGAGGGTGGCTGG - Intronic
1139650931 16:68361732-68361754 TGGAGAGTGAGGAGGGCCGCAGG - Exonic
1140173658 16:72633141-72633163 TGGGGAGGGAGGAGGGTGGAGGG + Intergenic
1141234340 16:82201419-82201441 TGATGTGTGAGGAGGTCAGCTGG + Intergenic
1141558128 16:84849334-84849356 TGGTGGGTGAGGGGAGGGGCTGG + Intronic
1142311626 16:89317525-89317547 TGGTGAGTGGGGCGTGAGGCTGG - Intronic
1142406361 16:89892372-89892394 TGCTGGGGGTGGAGGGCGGCGGG + Intronic
1142801348 17:2347952-2347974 TGGTGACTGAGGAGGCAGGCTGG - Intronic
1144057953 17:11558543-11558565 TGGGGAGTGAGGAGGGGGCTAGG + Exonic
1146169819 17:30624451-30624473 TGGTCAGTGAGAAGGTCGGAGGG + Intergenic
1146343271 17:32040481-32040503 TGGTCAGTGAGAAGGTCGGAGGG + Intronic
1146466631 17:33091323-33091345 GGGTGAGTGTGGAGGGCTGTTGG + Intronic
1146792609 17:35760953-35760975 TGGTGAGTGGGGCTGGAGGCAGG + Exonic
1147042932 17:37731853-37731875 TGGTGAGTGAGGGGGGGCGGGGG + Intronic
1147168219 17:38604541-38604563 TGGTGGGAGAGGACGGCGGAGGG - Intronic
1147336365 17:39728922-39728944 TTGTGAGTGAGGAGAGTGGTGGG + Intronic
1147374504 17:40015844-40015866 TGGTGAGTGAGGTGGGTGAGAGG + Exonic
1147901730 17:43790818-43790840 TGGAGAGTGGGGGTGGCGGCAGG + Intergenic
1149084373 17:52696808-52696830 TGGTAAGTGAGGAGACCGGTGGG - Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1150005231 17:61464944-61464966 TGCTGAGGGAGGAGTGCAGCAGG + Intronic
1150060508 17:62065119-62065141 TGGTGAGTGCCGGGGCCGGCGGG - Exonic
1150269578 17:63854926-63854948 TGGTCAGTGAGGAAGGGGGTGGG + Intergenic
1150358080 17:64505644-64505666 TGTTGGGGTAGGAGGGCGGCCGG - Intronic
1150653956 17:67027437-67027459 TGGGGACTGAGCAGGGCAGCAGG + Intronic
1150683540 17:67302244-67302266 GGGAGACTGAGGAGGGCGGGTGG - Intergenic
1150782680 17:68135536-68135558 TGGTCAGTGAGAAGGTCGGAGGG - Intergenic
1150786262 17:68165378-68165400 AGGGGAGGGAGGAGGGAGGCGGG + Intergenic
1151157567 17:72137121-72137143 TGGAGAGTGAAGAGGGAGGAAGG + Intergenic
1152405724 17:80096847-80096869 TGCTGAGGGAGGAGCGAGGCTGG - Intronic
1152751386 17:82064034-82064056 TGGTGAGCTTGGAGGACGGCAGG - Intronic
1152757396 17:82092666-82092688 TGGTGAGTGGGGCGGGGGGGGGG + Intronic
1153644713 18:7184962-7184984 TCGTGAATGTGGAGGGCAGCAGG - Intergenic
1153924596 18:9824967-9824989 TGGGGAGGGAGAAGAGCGGCAGG - Intronic
1154110790 18:11566762-11566784 TGCTCAGTGAGGAGGGAGACAGG - Intergenic
1155709096 18:28853531-28853553 TGGAGAGTGTGGAGGGTGGGAGG + Intergenic
1156449403 18:37258581-37258603 AGGTGAGTGGGGAGGGCAGGAGG + Intronic
1156475999 18:37405733-37405755 TGTTGAGGGAAGAGGGCGGTGGG + Intronic
1156481925 18:37441738-37441760 TGGTGAGTGGGGAGGCAAGCTGG - Intronic
1156561129 18:38127017-38127039 TGGTGGGGGTGGAGGGGGGCAGG - Intergenic
1157196685 18:45625602-45625624 TGGGGATAGAGGAGGGTGGCAGG - Intronic
1157867309 18:51197544-51197566 GGGTGGGTGGGGACGGCGGCGGG + Intronic
1158278101 18:55790702-55790724 TGGTCAGTGAGAAGGGCAGCTGG - Intergenic
1160266713 18:77344766-77344788 TGGTGTGATAGGAGGGAGGCTGG - Intergenic
1160359074 18:78255465-78255487 GGGGGTGTGAGGAGGGCGTCAGG - Intergenic
1160771901 19:835730-835752 TGGGGGGTGTGGAAGGCGGCCGG + Intergenic
1160818136 19:1045660-1045682 TGGTGGGGGAGGGGGGCGGGGGG - Intronic
1160867505 19:1262377-1262399 TGCTGGGAGAGGAGGGCGGGTGG - Intronic
1161231557 19:3177294-3177316 TGGCGTCTGAGGAGGGAGGCAGG - Intronic
1161455322 19:4366971-4366993 TGGTCAGTGAGAAGGTCGGAGGG - Exonic
1161741994 19:6026953-6026975 TGGGGAGGGAGGTGGGCGGCAGG + Intronic
1161752863 19:6110336-6110358 CGGGGAGTGTGGGGGGCGGCGGG - Intronic
1161836294 19:6649352-6649374 TGAAGAGTGAGGAGGAGGGCGGG - Intergenic
1161981208 19:7631383-7631405 TGGTGGGAGAGGTGGGCGGGGGG + Intronic
1162013657 19:7832115-7832137 CTGGGAGTGGGGAGGGCGGCGGG - Intronic
1162147455 19:8621429-8621451 TGGTGAGTGAGCGGGGAGGAAGG + Intergenic
1162439870 19:10686365-10686387 GGGTGGGTGAGGTGGGAGGCTGG - Intronic
1162467152 19:10849117-10849139 GGGTGAGTGAGGTGGGTGGCAGG - Intronic
1162573518 19:11485829-11485851 TGGGGAGAGATGAGGGCAGCTGG + Intronic
1162809027 19:13153370-13153392 GGGTCAGAGGGGAGGGCGGCCGG - Exonic
1163315075 19:16535951-16535973 AGGTGGGTGAGGAGGTGGGCAGG - Intronic
1163536872 19:17881939-17881961 TGCTGTGTGAGGAAGGCAGCGGG - Exonic
1163580362 19:18135117-18135139 TGCTGAGTGAGGCGGGTGGCTGG + Intronic
1163755522 19:19104330-19104352 TGGTGAGGGGTGAGGGAGGCGGG + Intronic
1163768924 19:19179111-19179133 TGGGAAGTGAGGAGGGCAGCGGG + Intronic
1165741952 19:38210040-38210062 TGGGGAGAGACGCGGGCGGCAGG - Intergenic
1165896261 19:39142967-39142989 TGGTCAGTGAGGAGGCCCCCAGG - Intronic
1166073105 19:40397972-40397994 TGGGGAGAGAGGAGAGAGGCAGG + Intronic
1166569537 19:43784898-43784920 TTCTGAGGGAGGAGGGGGGCTGG + Intergenic
1167045290 19:47045832-47045854 TGGAGAGGCAGGAGGGCGGGTGG - Intergenic
1167238235 19:48327622-48327644 TGGTGAGGGGTGAGGGCGGCGGG + Exonic
1167689516 19:50976197-50976219 TGACAAGTGAGGAGGGAGGCTGG - Intergenic
1167853494 19:52219863-52219885 TGGTGAGTGAGGAGGCCTGGGGG + Exonic
1167869449 19:52355608-52355630 TGGTGGCTGAGGTGGGCGACAGG - Intronic
1202649740 1_KI270706v1_random:169582-169604 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
926116432 2:10216484-10216506 TGGGGAGTGGGGAGGACGGGAGG + Intergenic
927006933 2:18861014-18861036 TGGTGAGGGATGCGGGCTGCAGG + Intergenic
927356495 2:22179211-22179233 TGGTGAGGGAGGAAGCCGGTGGG + Intergenic
927465206 2:23331612-23331634 TGGTGAGTGAGGAGAGGGAAGGG + Intergenic
929558057 2:42937686-42937708 TGGTGGGGGAGGAGGGCGGGAGG - Intergenic
930700635 2:54456111-54456133 TGGGGAGGGAGGAGTGCGGAGGG + Intergenic
933166924 2:79086791-79086813 ATGTGAGTGAGGAGAGCAGCAGG - Exonic
933486871 2:82935325-82935347 TAATGAGTAAGGAGGGCAGCTGG - Intergenic
934655854 2:96116571-96116593 TGGGGAGCGGGGAGAGCGGCTGG + Intergenic
934708481 2:96500737-96500759 TGCTGCGGGAGGAGAGCGGCTGG - Exonic
934773671 2:96923847-96923869 AGGTGAGTGAGCCGGGAGGCAGG - Intronic
935196598 2:100820066-100820088 TGGAGAGGGAGGAGGGTGGAGGG + Intergenic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
937382042 2:121387183-121387205 TGGTGTGTCGGGAGGGCGTCCGG + Exonic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938092860 2:128444637-128444659 TGGTGAGAGAGGAGGGGAGCAGG - Intergenic
938128895 2:128694007-128694029 AGGTGTGTGAGCCGGGCGGCAGG - Intergenic
938367345 2:130745147-130745169 TGGTGGGTGAGGAGCCCTGCGGG - Intergenic
939525722 2:143291393-143291415 GAGTGAGTGAGGAGGGAGGGAGG - Intronic
940731455 2:157397738-157397760 TGGGGTGGGAGGAGGGCGGAGGG - Intergenic
941540014 2:166770646-166770668 TGGGGAGGGAGGAGGCAGGCTGG - Intergenic
942461103 2:176169489-176169511 TGGTGGGTGAAGATGGGGGCAGG - Exonic
944743845 2:202635981-202636003 GGGTGAATGAGGCGGGCGGGCGG - Intronic
945819121 2:214641596-214641618 AGTTGAATGAGGAGGGAGGCAGG + Intergenic
946212923 2:218162084-218162106 AGGTGAGTGAGGAGGGAGTTAGG - Intergenic
946428696 2:219613426-219613448 GGGTGAGTGAGGGGGGAGGTGGG + Intronic
947774509 2:232697233-232697255 TGGAGAGTGGGGAGGGAAGCGGG + Intergenic
947846581 2:233249272-233249294 TGGTGAGTTAGGAGGAGGGCAGG + Intronic
948035601 2:234855928-234855950 TGGTGAGGGAGAATGGAGGCTGG - Intergenic
948266003 2:236635755-236635777 TCGGGAGTGGGGAGGGCGGGTGG - Intergenic
948563262 2:238867771-238867793 TGGTGAGTTAGGAGGCCAGGAGG + Intronic
948577638 2:238964962-238964984 TGGGGAAGGAGGAGGGCGGAAGG - Intergenic
948871966 2:240805138-240805160 AGGGGAGTGGGGAGGGAGGCGGG + Intronic
948874861 2:240820867-240820889 TGGGGCGAGAGGAGGGCGGGGGG - Intergenic
948962044 2:241346948-241346970 AGGTGAGTGAGGATGGCTGCAGG - Intronic
949001960 2:241620031-241620053 TGGTGAGTGAGGAGTGAGTGAGG + Intronic
949002041 2:241620477-241620499 TGGTGAGTGAGGAGTGAGTGAGG + Intronic
949059486 2:241948875-241948897 AGGTGGGTGAGCAGGGCTGCGGG + Intergenic
1170148837 20:13206562-13206584 TGGTGAGACAGGAGGGAGGAAGG + Intergenic
1170578127 20:17680220-17680242 AGGAGTGTGAGGAGGGAGGCGGG + Intronic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1170874136 20:20234878-20234900 TGGTGTGTGAGGAGGGATTCTGG - Intronic
1172245758 20:33443877-33443899 GGGTGGGTCAGAAGGGCGGCGGG + Exonic
1172772447 20:37389483-37389505 GGGTGAGGGAGGAGCGAGGCAGG - Intronic
1172805624 20:37609677-37609699 GGACGAGTGAGGAGGGCTGCTGG - Intergenic
1172996412 20:39073268-39073290 TGGTGAGGGGGGTGGGTGGCAGG - Intergenic
1173645732 20:44632066-44632088 TGGTTGTTGAGGAGGGAGGCTGG - Intronic
1174174520 20:48636442-48636464 TGGTGAGTGAGTGGGGCGGGAGG - Exonic
1174198057 20:48787121-48787143 TGGTGAGGAAGGAGGGTGTCAGG - Intronic
1174306465 20:49617398-49617420 TGCAGGGTGAGGAGGGTGGCGGG - Intergenic
1174401518 20:50278461-50278483 GGGTGAGTGAGGAGGAAGGCTGG - Intergenic
1174526390 20:51175317-51175339 TTGTGGGTGATGAGGGCTGCAGG + Intergenic
1174631783 20:51964620-51964642 TGTTGAGGGAGGAGAGAGGCTGG + Intergenic
1174682622 20:52423463-52423485 TGGTGAGTGAGGGTGGGTGCAGG - Intergenic
1174682636 20:52423523-52423545 TGGTGAGTGAGGGGGGGTGCAGG - Intergenic
1175199047 20:57265832-57265854 TGGCGGTGGAGGAGGGCGGCGGG - Exonic
1175373544 20:58509212-58509234 TGCTGAGTGAGGAAGCAGGCAGG + Intronic
1175784574 20:61704492-61704514 TTCTGAGAGAGGAGAGCGGCTGG + Intronic
1176274203 20:64254670-64254692 TGCCGAGTTAGGAGGGAGGCGGG + Intergenic
1176548883 21:8213188-8213210 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176556778 21:8257401-8257423 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176567814 21:8396223-8396245 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176575717 21:8440442-8440464 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1176602082 21:8802965-8802987 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
1176625906 21:9091762-9091784 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
1178169937 21:30028950-30028972 TGGGGAGAGAGGAGGGTGGGAGG + Intergenic
1179243762 21:39612848-39612870 TGATAGGTGAGGAGGCCGGCGGG - Intronic
1179452231 21:41474670-41474692 GGGTGAGTGAGGAGGTGAGCGGG + Intronic
1179821605 21:43940330-43940352 TGGTGAGTGAGGCCGGGGCCCGG + Intronic
1179926036 21:44534320-44534342 TGGTGTGTGAGGGGTGGGGCTGG + Intronic
1179926056 21:44534376-44534398 TGGTGTGTGAGGGGTGGGGCTGG + Intronic
1179926063 21:44534396-44534418 TGGTGTGTGAGGGGCGGGGCTGG + Intronic
1179926085 21:44534456-44534478 TGGTGTGTGAGGGGTGGGGCTGG + Intronic
1180551051 22:16541722-16541744 TGGGGTGAGAGGAGGGCGGAGGG - Intergenic
1181997910 22:26897626-26897648 TGGAGAGTGGGAAGGGAGGCTGG + Intergenic
1184240972 22:43211107-43211129 TGGTGGGTGTGGAGGGGTGCAGG + Intronic
1184663786 22:45977223-45977245 CGGCGAGCGAGGAGGGCGGGCGG - Intergenic
1184784540 22:46665361-46665383 TGGGGACAGAAGAGGGCGGCTGG - Intronic
1185110135 22:48896206-48896228 GGGTGAGGGAGGAGGGAGGATGG + Intergenic
1185295377 22:50050548-50050570 AGGTGGGGGAGGAGGGCAGCAGG - Intronic
1203253768 22_KI270733v1_random:129496-129518 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203261824 22_KI270733v1_random:174575-174597 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
949414509 3:3800276-3800298 CGGGGAGGGAGGAGGGCTGCCGG + Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950122111 3:10488763-10488785 TGGTGAGAGAGGATGGTGGCTGG - Intronic
950439904 3:13004526-13004548 AGGAGAGGGAGGAGGGAGGCGGG - Intronic
950463999 3:13142526-13142548 TGGTGAGGGAGCTGGGCAGCAGG - Intergenic
950578039 3:13844866-13844888 AGGTGGGTGAGGAGAGGGGCAGG - Intronic
952337943 3:32421054-32421076 GGGTGGGAGAGGAGGGCAGCAGG - Intronic
952635894 3:35530282-35530304 TGGTGAGGGTGGAGGGTGGTGGG + Intergenic
953463168 3:43097472-43097494 TGGGGAGGGAGGAGAGGGGCAGG + Intronic
953703073 3:45211462-45211484 TGGTTAGTGGGGAGGGGGGATGG + Intergenic
954538292 3:51377540-51377562 TGGTGAGGGAGGGAGGCGACAGG + Intronic
954662151 3:52231905-52231927 TGGGAAGTGAGGAGGGGAGCTGG - Intronic
957660076 3:83138633-83138655 TGGTGTGGGAGGAGGGGGGAGGG + Intergenic
958260299 3:91372856-91372878 TGGTGAGTGAGTAGAGCCCCGGG + Intergenic
958735650 3:98006769-98006791 TGGAGGGTGAGGAGGGCAGAGGG + Intronic
959723327 3:109516159-109516181 TGGTCAGAGAGGAGTTCGGCTGG - Intergenic
961424174 3:126831883-126831905 TGCTGAGTGAGGAGTGCGAGGGG + Intronic
961663541 3:128482896-128482918 TGGTGAGTGTGGGGGGCTGGGGG + Intronic
962492559 3:135908470-135908492 TGTTGAGTGTGGAGCGCTGCTGG + Intergenic
963320909 3:143807989-143808011 CGGTGAGAGAGGATGGTGGCCGG + Intronic
964607570 3:158573382-158573404 GGGGGCGGGAGGAGGGCGGCGGG + Intronic
967118400 3:186361930-186361952 TGGTGAGGTAAGACGGCGGCCGG - Exonic
967911824 3:194548762-194548784 TGGGGAGGGAGGAGGGAGGCAGG + Intergenic
968082579 3:195856897-195856919 GGGTGAGCGGGGTGGGCGGCTGG + Intergenic
968616388 4:1579429-1579451 GGGCGAGTGCGGAGGGCGGGGGG - Intergenic
969501804 4:7558057-7558079 TGTTGAGTGAGGAGGGGTCCTGG + Intronic
969612178 4:8233512-8233534 AGGTGAGTGATGAGGGATGCAGG + Exonic
973097673 4:46223222-46223244 TGGTGAGTGTGGTGGAGGGCTGG - Intergenic
973365404 4:49204772-49204794 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
973638452 4:52880920-52880942 AAGTGAGTGAGGAGAGAGGCTGG + Intronic
974062634 4:57049436-57049458 TGGTGGGTGAGCAGGACTGCTGG - Intronic
975525888 4:75350484-75350506 TGGTAGGTGAGGAGTGGGGCTGG - Intergenic
975661117 4:76689701-76689723 TGGTGAGTGAGGAGGGCGGCTGG + Intronic
975711897 4:77169242-77169264 TGATGAGGGAGGAGGGAGGTGGG - Exonic
976222615 4:82770175-82770197 TGGGGTGTGGGGAGGGGGGCAGG - Intronic
976538980 4:86251316-86251338 TGGGGAGGGAGGAGGGGGGAGGG - Intronic
977443734 4:97101982-97102004 TGGTGAGTAAGAAGGGGAGCAGG - Intergenic
977886098 4:102253161-102253183 GGGCGAGCGGGGAGGGCGGCGGG + Intronic
981027590 4:140092565-140092587 GAGTGAGTGAGCAGTGCGGCGGG - Intronic
983058618 4:163129056-163129078 TGGTGGGGGTGGAGGGCGGAGGG + Exonic
983209649 4:164945743-164945765 TGGTGAGTGAGGAGAACGTGAGG - Intergenic
984206476 4:176792796-176792818 GGGGGCGGGAGGAGGGCGGCGGG + Intergenic
985381318 4:189398135-189398157 TGGGGAGTGAGGATGGTGGTTGG + Intergenic
1202762780 4_GL000008v2_random:126397-126419 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
985606261 5:859798-859820 TACTGAGGGAGGAGGGCTGCAGG - Intronic
985684161 5:1272985-1273007 TGGTGACTGTGGATGGCGGTTGG - Intronic
985684263 5:1273498-1273520 TGGTGACTGTGGATGGCGGTTGG - Intronic
985684295 5:1273643-1273665 TGGTGACTGTGGATGGCGGTTGG - Intronic
985684324 5:1273788-1273810 TGGTGACTGTGGATGGCGGTTGG - Intronic
985732148 5:1555325-1555347 TCGTGTGTGAGGAGGGCGCCCGG - Intergenic
985837017 5:2278937-2278959 TGGTGGGAGCGGCGGGCGGCGGG + Intergenic
985948358 5:3203872-3203894 TGGGGAGGGAGGTGGGCAGCTGG + Intergenic
986712671 5:10499307-10499329 TGGCGAGTCAGGATGGCGCCTGG + Intergenic
987294366 5:16537051-16537073 TGGTCAGGGAGGAGGCAGGCAGG - Intronic
987314042 5:16707692-16707714 CGGTGACTGAGGTGGGCAGCTGG - Intronic
988029124 5:25739507-25739529 TGGTGGGTCAGGAGGGTGGGCGG - Intergenic
992553882 5:77884840-77884862 TGATGAGAGAAGAGGGCGGAGGG + Intergenic
993644205 5:90443160-90443182 TGGGGAGTGGGGAGGGGGGAGGG - Intergenic
994639561 5:102389977-102389999 GGCTGAGTGAGGAGGGAGGATGG - Intronic
996221958 5:120944229-120944251 TGGTGAGTGAACAGAGGGGCTGG + Intergenic
997442365 5:133917877-133917899 TGGTCAATGAGGAGCGCGCCTGG + Intergenic
998161506 5:139815201-139815223 TGGAGACTGAGGAGGGTGGAGGG - Intronic
999202568 5:149826651-149826673 TCTGGAGTGAGGAGGGCGGGAGG - Exonic
999254937 5:150204926-150204948 TGGTAACTGGGGAGGGCGGGAGG + Exonic
999282347 5:150374048-150374070 TGGGGAGTGGGGAGGGAAGCAGG + Intronic
999369677 5:151046243-151046265 TAGGGAGTGAGGAGAGTGGCTGG - Intronic
1000285174 5:159820444-159820466 TGGAGGGTGAGGAGGGCAGGGGG - Intergenic
1000381700 5:160635335-160635357 AGGTGAGTGAGGAGGGGGAGAGG + Intronic
1001415988 5:171545180-171545202 TGGAGAGTGAGGAGGGTGTATGG + Intergenic
1001532592 5:172474355-172474377 TGGTAAGTAACGAGGGAGGCAGG + Intergenic
1001715070 5:173808709-173808731 TGGTGAGTGTGTGGGGAGGCGGG - Intergenic
1001741744 5:174058585-174058607 TGGAGACGGAGGAGGGCTGCTGG + Intronic
1002071423 5:176680732-176680754 GGGTGACTGAAGAGGGCAGCCGG - Intergenic
1002278131 5:178116143-178116165 TGGTGGGGGAGGAGGGAGGGAGG - Intronic
1002441113 5:179265065-179265087 GGGTGAGTGGGGTGGGCAGCGGG - Intronic
1002467730 5:179416161-179416183 TGGGCACTGAGGAGGGAGGCAGG - Intergenic
1002897794 6:1389521-1389543 GAGGGAGCGAGGAGGGCGGCCGG + Intergenic
1003190138 6:3867280-3867302 AGGCGAGTGATGAGGGGGGCTGG + Intergenic
1003815703 6:9837758-9837780 TCCTGAGGGTGGAGGGCGGCAGG + Intronic
1003873453 6:10418731-10418753 TGGTGGGTGAGGAGGCAGGGGGG - Intronic
1004074022 6:12329008-12329030 AGGTGAGTCAGGTGGGCGTCCGG - Intergenic
1004750628 6:18558366-18558388 TGGTGAGTATGGAGTGAGGCTGG - Intergenic
1005426257 6:25705879-25705901 TGCAGAGAGAGGAGGGAGGCTGG - Intergenic
1005852493 6:29832011-29832033 TGGTGTGGGAGGAGGGAGGGAGG + Intergenic
1005945195 6:30590212-30590234 TGGTGAGTGAGCTGGGCTGTGGG + Exonic
1006155140 6:32009724-32009746 TGGAGACTGATGGGGGCGGCTGG - Intergenic
1006161450 6:32042458-32042480 TGGAGACTGATGGGGGCGGCTGG - Exonic
1006298207 6:33179410-33179432 TGGTGAGTGAGCAGGGTGCTCGG - Exonic
1006385298 6:33727345-33727367 TGGTGAGCGTGGACAGCGGCCGG + Intronic
1006448171 6:34091431-34091453 GGGTGAGGGTGGAGGGCCGCGGG - Intronic
1006670639 6:35727930-35727952 CGGTGAGTGGGCAGGGCTGCGGG + Intronic
1006835775 6:36998059-36998081 TCGTCAGTGTGGAGGGCAGCGGG + Intergenic
1006943051 6:37765636-37765658 CGGGGAGAGAGGAGGGTGGCGGG + Intergenic
1007023152 6:38543067-38543089 TGGTGAGTCAGGGGAGGGGCAGG - Intronic
1007683504 6:43650539-43650561 TGGTGAGTGAAGAGGAGAGCAGG + Exonic
1007767083 6:44166931-44166953 TGTTGTGTGGGGAGGGCGGCGGG + Intronic
1008994932 6:57647538-57647560 TGGTGAGTGAGTAGAGCCCCAGG - Intergenic
1009183467 6:60546299-60546321 TGGTGAGTGAGTAGAGCCCCAGG - Intergenic
1011708739 6:90029468-90029490 TGGAGAGTGAGGTGGGAGGCTGG - Intronic
1014250295 6:119108714-119108736 TGGAGAGTGAAGAGAGCTGCTGG + Intronic
1017168341 6:151431419-151431441 TGGTGGGTGAGCAGGCAGGCAGG + Intronic
1017311546 6:152982684-152982706 GGGTCCGGGAGGAGGGCGGCTGG - Intronic
1018036695 6:159888200-159888222 TGGAGAGTCAGGAGGGCAGGGGG - Intergenic
1018722973 6:166587905-166587927 GAGTGAGTGAGGAGGGCGCAGGG - Intronic
1018790392 6:167143762-167143784 TGGGGAGGAAGGAGGGCGGGTGG - Intergenic
1018893047 6:167996185-167996207 TGGTGAGGGGGGAGTGGGGCAGG - Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019409126 7:899012-899034 AGGTGAGGGGGGCGGGCGGCCGG - Exonic
1019478201 7:1254311-1254333 CGGTGGGTGGGGAGGGCCGCTGG - Intergenic
1019929048 7:4211362-4211384 CAGGGAGTGAGGAGGCCGGCCGG + Intronic
1020005689 7:4782871-4782893 AGGGCAGGGAGGAGGGCGGCTGG - Intronic
1020090008 7:5333546-5333568 TGGGGTGGGAGGAGGGCTGCTGG - Intronic
1021121737 7:16803234-16803256 TTGTGAGTGAGGAGGGAGGGAGG + Intronic
1021340877 7:19460851-19460873 TGGGGAGTGGGGAGGGGGGAGGG + Intergenic
1021874176 7:25033044-25033066 TGCTGAGTGTGGAGGGCGCAGGG + Intergenic
1022155883 7:27662021-27662043 TGGTATGAGAGGAGGGAGGCAGG + Intronic
1022503469 7:30896704-30896726 TGGTGGGTGAGGTGTGGGGCTGG - Intergenic
1022624031 7:32015521-32015543 TGGTGGGTGGGGTGGGGGGCAGG - Intronic
1022972524 7:35530735-35530757 TAGGGAGTGAGGAGTGGGGCTGG - Intergenic
1023083140 7:36544483-36544505 TGGTGTGTGAGAAGGGGTGCTGG - Intronic
1023518854 7:41030816-41030838 TGGTGAGTGAGGAGAAAGGGAGG + Intergenic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1023841406 7:44100634-44100656 CGGGGAGTGGGGAGGGGGGCAGG - Intergenic
1024944950 7:54799169-54799191 TGGGGAGTGAGGGGAGCAGCTGG - Intergenic
1025021659 7:55485234-55485256 TGGTGGGTGGGGAGGTGGGCTGG - Intronic
1025627407 7:63233868-63233890 TGGTGAGAGAGAAGGCCGACTGG - Intergenic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1025924508 7:65946183-65946205 TGGTGATTGAGGAGAGTGACAGG - Intronic
1025931829 7:66001412-66001434 TGGTGATTGAGGAGAGTGACAGG - Intergenic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1027233480 7:76284841-76284863 AGCTGAGTGAGGAGTGGGGCCGG + Intronic
1027234556 7:76290429-76290451 TGGCCAGTGAGGAGGCCGGTAGG - Intergenic
1027730588 7:81867222-81867244 AGGTAAGTGAGGAGGGTGGCAGG + Intergenic
1028244384 7:88459409-88459431 TGGTGTGAGATGAGGGAGGCAGG - Intergenic
1029414734 7:100435827-100435849 GGGTGAGGGGGGCGGGCGGCCGG - Exonic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1031491789 7:122398764-122398786 TGAGGGGTGGGGAGGGCGGCGGG - Intronic
1031972496 7:128074724-128074746 TAGTGTGTGAGGAGGACGGGAGG - Intronic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1033278312 7:139988932-139988954 TGGTGTGTGAGGGGAGAGGCAGG + Intronic
1033339217 7:140479076-140479098 GCGGGAGGGAGGAGGGCGGCCGG - Intronic
1034438926 7:151076836-151076858 TGGGGAGAGGAGAGGGCGGCAGG + Intronic
1034443680 7:151101069-151101091 TGGTGAGTGATGCGGACGCCAGG - Intronic
1034875500 7:154721321-154721343 TGGTGGGTCAGGGGTGCGGCTGG - Intronic
1034967973 7:155403264-155403286 TGGTGGGTGAGGAGGGAGCCGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035464245 7:159064453-159064475 TTGTGAGTGAGGATGATGGCGGG + Intronic
1035587275 8:785862-785884 GGGTGAGGGAGGAGGGAGGCCGG - Intergenic
1035606152 8:930925-930947 AGATGAGTGGGGAGGGAGGCAGG + Intergenic
1035743862 8:1947657-1947679 TGGGGTGTGAGGATGGGGGCAGG - Intronic
1035824406 8:2629143-2629165 TGGTGAGAGAGGAGTTTGGCGGG - Intergenic
1037221970 8:16534615-16534637 TGGGGAGGGAGGAGGGGGGAGGG + Intronic
1039920710 8:41892321-41892343 TGCTGAGAGAGGAAGGCTGCAGG + Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040495966 8:47965924-47965946 AGGTGAGTGAGGCAGGAGGCAGG + Intronic
1040738497 8:50541407-50541429 TGGTGAGGGAGGAGGGCAAGAGG - Intronic
1041161089 8:55044458-55044480 TGGTGTGGAAGGAGGGCGGAGGG + Intergenic
1042713719 8:71748061-71748083 TGGTGATTGGGGAGGGTGGAGGG - Intergenic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043754485 8:83985821-83985843 TGGTGAGGTAGGAGGCTGGCAGG + Intergenic
1045038211 8:98194110-98194132 TGGAGAGTGCTGAGGGCGGGTGG + Intronic
1045995249 8:108354261-108354283 TAGTGAGTGAGGGAGGGGGCAGG + Intronic
1046876187 8:119257193-119257215 TGGTGTGGGAGGAAGGGGGCGGG + Intergenic
1048582803 8:135744310-135744332 TGGTTAGTGAGCAGGGAGTCTGG + Intergenic
1048968023 8:139628144-139628166 TTGTAGGGGAGGAGGGCGGCAGG + Intronic
1049562122 8:143317114-143317136 TGGGGAGTGCGGTGGGCGCCGGG + Intronic
1049622768 8:143606041-143606063 TGGTGAGTGAGGGTGGCCCCTGG - Exonic
1049674858 8:143884904-143884926 TGGTGAGTGAGGGGGGCAGATGG - Intergenic
1049693210 8:143971787-143971809 TGGTGAGGGGGCAGGGGGGCCGG - Intronic
1049707405 8:144049259-144049281 GGGTGGCTGAGGAGGGCGGCGGG + Intergenic
1050259420 9:3825895-3825917 TGCTGAGGAAGGAGGGCTGCAGG + Intronic
1051567998 9:18522581-18522603 TGGGGTGTGGGGAGGGGGGCGGG - Intronic
1052288160 9:26810876-26810898 TGGGGAGTGAGGAGGACTTCTGG - Intergenic
1053360959 9:37486355-37486377 TGGTGGGTGAGGGGGTCAGCAGG - Intronic
1053416072 9:37947568-37947590 TGCAGAGTCAGGAGGGCGGCAGG - Intronic
1056896818 9:90559082-90559104 CTGTGAGTGAAGAGGGTGGCTGG + Intergenic
1056950071 9:91034719-91034741 TGGTGAGTGAGGAAGAAGGAAGG - Intergenic
1057799626 9:98182447-98182469 TGGGGAGTGTGGAGGAGGGCTGG - Intronic
1058081073 9:100701710-100701732 TGGGGAGTGTGGGGGGCGGAAGG - Intergenic
1058128779 9:101226265-101226287 GGATGAGTGAGGAGGGGGGAGGG - Intronic
1060401574 9:123352860-123352882 TGTGGAGTGAGGAGGGCAGGGGG + Intergenic
1060455736 9:123794137-123794159 TCGTGAGAGAGGAGGCCAGCGGG + Intronic
1060552088 9:124490447-124490469 TGGGGAGTGAGGTGGGTGGCCGG + Intronic
1060701133 9:125748901-125748923 AGGAGAGGGAAGAGGGCGGCTGG - Intronic
1060793764 9:126501764-126501786 TGATGAGCGAGGAGGGCCGCAGG - Intronic
1061251159 9:129427323-129427345 TGGTGAGACTGGCGGGCGGCGGG + Intergenic
1062342397 9:136099618-136099640 TGGTGTGTGTGCGGGGCGGCGGG + Intergenic
1062391771 9:136336722-136336744 TGGTGAGGGAGGGCGGAGGCTGG + Intronic
1062400661 9:136371303-136371325 CGGTGAGTGACGGGGGAGGCGGG - Exonic
1062540614 9:137040201-137040223 AGGTGAGGGTGCAGGGCGGCGGG + Intronic
1062577384 9:137215017-137215039 AGGTGAGATGGGAGGGCGGCAGG + Exonic
1062656578 9:137606837-137606859 TGGTGTGTGGTGAGGCCGGCTGG + Intronic
1203749078 Un_GL000218v1:62183-62205 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
1203470168 Un_GL000220v1:112644-112666 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203477989 Un_GL000220v1:156616-156638 TGGTGGGGGAGGAGGAAGGCGGG + Intergenic
1203543543 Un_KI270743v1:111278-111300 CAGTGAGTGAGGTTGGCGGCTGG - Intergenic
1186137035 X:6532819-6532841 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137058 X:6532882-6532904 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137079 X:6532941-6532963 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137098 X:6533000-6533022 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137108 X:6533033-6533055 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137131 X:6533096-6533118 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137166 X:6533192-6533214 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137200 X:6533285-6533307 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137210 X:6533314-6533336 TGGTGTGTGAGGAGGGAGGGAGG - Intergenic
1186137220 X:6533347-6533369 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137242 X:6533409-6533431 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137265 X:6533472-6533494 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137277 X:6533505-6533527 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186137289 X:6533538-6533560 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186267153 X:7844201-7844223 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267165 X:7844234-7844256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267187 X:7844296-7844318 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267197 X:7844325-7844347 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267209 X:7844358-7844380 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186267232 X:7844421-7844443 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186297754 X:8169208-8169230 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297766 X:8169241-8169263 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297778 X:8169274-8169296 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297790 X:8169307-8169329 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297802 X:8169340-8169362 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297814 X:8169373-8169395 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297826 X:8169406-8169428 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297838 X:8169439-8169461 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297848 X:8169468-8169490 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297860 X:8169501-8169523 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297872 X:8169534-8169556 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297884 X:8169567-8169589 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297894 X:8169596-8169618 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297906 X:8169629-8169651 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297916 X:8169658-8169680 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297928 X:8169691-8169713 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297942 X:8169728-8169750 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297954 X:8169761-8169783 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297966 X:8169794-8169816 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186297980 X:8169831-8169853 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1186324860 X:8466568-8466590 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324894 X:8466663-8466685 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324904 X:8466692-8466714 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324953 X:8466834-8466856 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186324999 X:8466960-8466982 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325012 X:8466993-8467015 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325024 X:8467026-8467048 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325056 X:8467117-8467139 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325066 X:8467146-8467168 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325095 X:8467234-8467256 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186325105 X:8467263-8467285 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186789100 X:12979805-12979827 TGGGGAGTGTGGAGTGCGGAGGG - Intergenic
1187019415 X:15364715-15364737 TGCTGAGAGAGGAGGGTGGAAGG + Intronic
1187255011 X:17634709-17634731 TGGTGTGTGTTGAGGGCGGGTGG + Intronic
1190492012 X:50991854-50991876 TGGTGAGTGGAGAGGGTGCCAGG + Intergenic
1190501150 X:51079826-51079848 TGGTGAGTGGAGAGGGTGCCAGG - Intergenic
1192234500 X:69287124-69287146 GAGGGACTGAGGAGGGCGGCTGG - Intergenic
1192930885 X:75804940-75804962 GGGGGAGGGAGGAGGGGGGCGGG - Intergenic
1196819587 X:119692591-119692613 CGGTGAGTGGCGAGGGGGGCGGG - Intronic
1198177825 X:134173029-134173051 TAGTGGGTGAAGAGGGCGCCTGG - Intergenic
1198994581 X:142559802-142559824 TGGTGAATGAGGAGAGCAGTTGG + Intergenic
1199928105 X:152490726-152490748 TGGGGAGTGGGGAGGGGGGAGGG + Intergenic
1200051279 X:153433133-153433155 TGGGGAGGGATGAGGGTGGCAGG + Intergenic
1200076490 X:153553841-153553863 TGGAGAGTGTGGAGGATGGCCGG + Intronic
1200149884 X:153946208-153946230 TGGGGAGGCAGGAGGGAGGCTGG - Intergenic
1200685428 Y:6254495-6254517 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200687814 Y:6273104-6273126 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200990957 Y:9345736-9345758 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200993616 Y:9366029-9366051 GGGTGAATGAGGATGGCGGAGGG + Intronic
1200996278 Y:9386347-9386369 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1200998793 Y:9454902-9454924 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201001448 Y:9475211-9475233 GGGTGAATGAGGATGGCGGAGGG + Intronic
1201004113 Y:9495513-9495535 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201006769 Y:9515825-9515847 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201009421 Y:9536131-9536153 GGGTGAATGAGGATGGCGGAGGG + Intergenic
1201047455 Y:9901598-9901620 GGGTGAATGAGGATGGCGGAGGG - Intergenic
1201059840 Y:10036101-10036123 TGGTGAGTGCGGTGGGCTGTGGG + Intergenic
1201162434 Y:11177196-11177218 CAGTGAGTGAGGTTGGCGGCTGG + Intergenic
1201226469 Y:11823569-11823591 TGGTGAGGGAGGAAGGCAGTGGG + Intergenic
1201438500 Y:13985183-13985205 TGGTGTGTGGGGAGGGAGACAGG - Intergenic
1201438636 Y:13985609-13985631 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201438657 Y:13985667-13985689 TGGTGTGTGGGGAGGGAGGGAGG - Intergenic
1201445916 Y:14057041-14057063 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic
1201445937 Y:14057099-14057121 TGGTGTGTGGGGAGGGAGGGAGG + Intergenic
1201446073 Y:14057525-14057547 TGGTGTGTGGGGAGGGAGACAGG + Intergenic