ID: 975661564

View in Genome Browser
Species Human (GRCh38)
Location 4:76693691-76693713
Sequence GAGTCATTTTTTAAGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975661555_975661564 26 Left 975661555 4:76693642-76693664 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 308
975661558_975661564 -2 Left 975661558 4:76693670-76693692 CCACTGCACCTGGCCCTTGATGA 0: 2
1: 6
2: 70
3: 503
4: 2799
Right 975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 308
975661559_975661564 -10 Left 975661559 4:76693678-76693700 CCTGGCCCTTGATGAGTCATTTT 0: 1
1: 1
2: 3
3: 20
4: 282
Right 975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 308
975661553_975661564 29 Left 975661553 4:76693639-76693661 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 308
975661556_975661564 25 Left 975661556 4:76693643-76693665 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG 0: 1
1: 0
2: 0
3: 23
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975661564 Original CRISPR GAGTCATTTTTTAAGGTTGT GGG Intronic
903813860 1:26050267-26050289 GAGTAATATTTTTAGGTTTTAGG - Intergenic
906927555 1:50135302-50135324 AAGTCATTTGTTTAGGATGTAGG + Intronic
907060050 1:51412910-51412932 GAGTTATTTTTTAAGCAAGTTGG - Intronic
909960245 1:81831617-81831639 GATATATTTCTTAAGGTTGTTGG + Intronic
910086796 1:83412602-83412624 GCCTCATTTTTTAATGTTTTAGG + Intergenic
910246582 1:85144842-85144864 GAATCTTTTTATGAGGTTGTAGG - Intergenic
910363199 1:86435686-86435708 GAGTCAACTTTTAAAGTTTTAGG + Intronic
910504886 1:87939005-87939027 GAAGCATTTTTTAATGTTGTAGG - Intergenic
911033022 1:93509899-93509921 GCGCCATTTTTTAAGCCTGTCGG - Intronic
911394395 1:97287758-97287780 GCGCCATTTTTTAAGCCTGTCGG + Intronic
915929351 1:160049518-160049540 GAGGCATTACTTAAGGTTGTAGG - Intronic
916508645 1:165451577-165451599 GAGTAATTTTTTAAGCTTCCTGG - Intergenic
916858171 1:168773462-168773484 GATACATTTTTTATGATTGTAGG - Intergenic
917524302 1:175773596-175773618 GAGTAATTTTTTTTGGTTGGGGG + Intergenic
919101943 1:193106118-193106140 GCGTCACTATTTAAGGTTGGGGG + Intergenic
919717011 1:200789000-200789022 GAGGTGTTTGTTAAGGTTGTTGG + Intronic
920528181 1:206684154-206684176 GAGACCTTTTCAAAGGTTGTGGG - Intronic
921297575 1:213719072-213719094 GGGCCATTGTTTAAGGTTGTTGG + Intergenic
922206026 1:223447291-223447313 GTGCCATTTTTTAAGCCTGTCGG - Intergenic
922302267 1:224311898-224311920 TAGTCATTTTTTTAGGATATGGG - Intronic
923107210 1:230863893-230863915 GACTCATTTTTTAAGGAAGGTGG - Intronic
923721769 1:236473190-236473212 AAGTCATTTTATATGGTGGTAGG + Intronic
1063326608 10:5109921-5109943 GCGCCATTTTTTAAGCCTGTCGG - Intronic
1066687644 10:37995730-37995752 GTGCCATTTTTTAAGCCTGTTGG - Intergenic
1067842600 10:49693340-49693362 GAATCATTTTTTGAGGCTTTTGG + Intronic
1068698580 10:59995697-59995719 GAGGCAATTTTTATAGTTGTGGG + Intergenic
1069160648 10:65087167-65087189 CAGACAATTTTTAAGGTTATGGG + Intergenic
1070231643 10:74573835-74573857 GCGCCATTTTTTAAGCCTGTTGG + Intronic
1070893006 10:79956467-79956489 GTGCCATTTTTTAAGCCTGTTGG - Intronic
1072063704 10:91843466-91843488 GAGTCATATTCTAAGGTACTGGG + Intronic
1072368292 10:94737379-94737401 GAGTCTTTTTCTAGTGTTGTGGG + Intronic
1073661481 10:105480853-105480875 GCGCCATTTTTTAAGCCTGTTGG + Intergenic
1074348763 10:112714361-112714383 GAATCATTTTATAAACTTGTTGG + Intronic
1074424256 10:113337367-113337389 GAGTCATATTTAAAGGTTTAGGG - Intergenic
1074965317 10:118486246-118486268 GACTTATTTATAAAGGTTGTTGG - Intergenic
1075624528 10:123952179-123952201 GAGTGATTATTCAAGGTTATTGG + Intergenic
1075828551 10:125382931-125382953 GATTCATTTTTAAAAGTTCTAGG - Intergenic
1077771296 11:5221804-5221826 GTGCCATTTGTTAAGCTTGTTGG + Intergenic
1077804634 11:5578392-5578414 GAGTTATTTTTTGAGGTGCTGGG - Intronic
1077950784 11:6954563-6954585 GCGCCATTTTTTAAGCCTGTCGG + Intronic
1078985843 11:16595937-16595959 GAGTGGTTATTTAAGGTTTTTGG - Intronic
1080384194 11:31800926-31800948 GAGTTGCTTTTTAAGGTTGTGGG - Intronic
1080432388 11:32210834-32210856 TAGTCATTCTTTTTGGTTGTTGG - Intergenic
1080579455 11:33630484-33630506 GCGCCATTTTTTAAGCCTGTCGG + Intronic
1081039376 11:38192043-38192065 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1081922594 11:46792816-46792838 GACACATCTTTTAAGGTTTTGGG + Intronic
1082669663 11:56019121-56019143 AAATCATTTTTTAAGTTTTTGGG - Intergenic
1083073023 11:60006406-60006428 GAGTCTTTTTTCATGTTTGTTGG + Intergenic
1084031259 11:66481951-66481973 GAGTCAATCTTTAAGGTTTAGGG + Intronic
1085105575 11:73839752-73839774 TATTCATTTTTTATGGTTATAGG - Intronic
1085838753 11:79985716-79985738 GAGACAGTATTTTAGGTTGTAGG + Intergenic
1086541029 11:87913438-87913460 GGGTCATTTTTTAATGTTCAGGG - Intergenic
1088370541 11:109083899-109083921 GTGCCATTTTTTAAGCCTGTTGG + Intergenic
1089023139 11:115239098-115239120 GAGGCATTTTAAAAGGCTGTAGG - Intronic
1090551907 11:127829050-127829072 GTGTCATGTTTTTAGGTTATTGG - Intergenic
1093274197 12:17103762-17103784 GATTCAATTTTTAACATTGTGGG + Intergenic
1093693688 12:22136832-22136854 GCGTCGTTTTTTAAGCCTGTCGG - Intronic
1093777917 12:23099100-23099122 GAGTAATTTTTTAAAATTCTAGG - Intergenic
1093787065 12:23205052-23205074 AATTCAGTTTTTAAGGATGTGGG + Intergenic
1094611815 12:32001928-32001950 GAGTCAAATTTTATGGTTTTTGG - Intergenic
1094877985 12:34672778-34672800 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1095209421 12:39475482-39475504 GTGCCATTTTTTAAGCCTGTTGG + Intergenic
1095661445 12:44741620-44741642 GTGCCATTTTTTAAGCCTGTTGG - Intronic
1096144708 12:49270274-49270296 GAGTCATTTTTTAAAAATCTGGG + Intronic
1096926850 12:55157276-55157298 GTGCCATTTTTTAAGCCTGTTGG + Intergenic
1097063827 12:56305645-56305667 GAAACATTTTTTAAGTTAGTTGG + Intronic
1097209289 12:57353429-57353451 AAGACATTTTTTAAAGTTTTTGG - Intronic
1098028355 12:66229756-66229778 GAGGGATTGTTTTAGGTTGTGGG - Intronic
1098705320 12:73680699-73680721 AAGTCAATTTTTCAGGTTGAAGG - Intergenic
1099019724 12:77388643-77388665 TAGTCAGCTCTTAAGGTTGTTGG + Intergenic
1100808998 12:98318721-98318743 GGGGCATTTTTTAAGGTAGCTGG + Intergenic
1105993616 13:25648816-25648838 GTATCATTTTTTATTGTTGTGGG + Intronic
1107031257 13:35856065-35856087 GTGACATTTTTTAAGGTCTTTGG - Intronic
1108563573 13:51671474-51671496 GAGCGATTTTTCAAGTTTGTTGG + Intronic
1108952008 13:56105921-56105943 GAGTCATATTTTAGGGATGAAGG + Intergenic
1109164578 13:59018051-59018073 GAGTCATTTCTTAAGTTATTAGG + Intergenic
1109988531 13:70021789-70021811 GAGGTATTTTTTAAGGTCTTTGG + Intronic
1110520347 13:76468884-76468906 GAGTCATCTTTGATGGTTTTCGG + Intergenic
1110604327 13:77414092-77414114 GAATCCTTTTTTAAGCTTATTGG - Intergenic
1111764117 13:92505528-92505550 TAGTCACTCTTTAAGGTGGTTGG + Intronic
1114167623 14:20235986-20236008 GTGCCATTTTTTAAGCCTGTCGG + Intergenic
1116235227 14:42271547-42271569 GAGTCTTTTTTCACGTTTGTTGG + Intergenic
1117219536 14:53589028-53589050 GAGTCTTTTTTTCATGTTATTGG + Intergenic
1118791006 14:69093073-69093095 TACTAATTTTTAAAGGTTGTTGG + Intronic
1119299751 14:73562172-73562194 GAGTTATTGTTTAATGTTGTGGG + Intergenic
1121097535 14:91228247-91228269 GACTCAGTTTCTAATGTTGTTGG - Intergenic
1121202198 14:92127642-92127664 GAGTATTTTTATAAGCTTGTGGG + Intronic
1121286765 14:92742099-92742121 GTGCCATTTTTTGAGGTAGTGGG - Intronic
1122330893 14:100911776-100911798 GAGTGATTGTTTAAGGTAGAGGG + Intergenic
1125042919 15:35212746-35212768 GAGCCAGTTTTAAAGGTTTTAGG - Intergenic
1125179297 15:36863527-36863549 GAGTCACATGTTAAGGATGTGGG - Intergenic
1125306060 15:38315992-38316014 GAGTAATTAGTTAAGCTTGTAGG - Intronic
1126818437 15:52477294-52477316 CAATCTTTTTTTAAGGTTCTTGG + Intronic
1127540314 15:59931249-59931271 TAGTCATTGCTAAAGGTTGTGGG + Intergenic
1127840049 15:62823423-62823445 GAGGATTTTTTTAAGGTTTTGGG - Intronic
1128211828 15:65908716-65908738 AAGTCATTTTTGAAAGGTGTAGG + Intronic
1129259826 15:74358931-74358953 GAGTCCTTTTTTTAAGTTGGAGG - Intronic
1129314400 15:74732461-74732483 TAGTCATTTTTTAAGGAAGCCGG + Intergenic
1130191519 15:81740909-81740931 GTGTCATTTTTTAATGTTTTTGG + Intergenic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131386064 15:92008577-92008599 GATTCATTTTTACAGGTTTTGGG + Intronic
1137067726 16:35865924-35865946 GAGTCTTTTTATAAGTTTATTGG + Intergenic
1137830243 16:51537417-51537439 AAGGCATTATTTAAGGTGGTAGG + Intergenic
1137852783 16:51763052-51763074 CAATTATTTTTTAAGGTTGTGGG + Intergenic
1138763427 16:59571080-59571102 GATTCATTTTTTAAGGCCATAGG + Intergenic
1142023301 16:87797823-87797845 GAGGCATTTTGGAAGTTTGTGGG - Intergenic
1144028407 17:11298750-11298772 GAGTCATTTGTTAGTGTTCTTGG - Intronic
1146535669 17:33648425-33648447 CAGTCATTGTTTAAGGCAGTGGG - Intronic
1149025565 17:52023770-52023792 GGGTCATTTTTTTTGCTTGTTGG - Intronic
1149815017 17:59714841-59714863 GAGTAATTTTTTAATTTTTTTGG + Intronic
1150520656 17:65864265-65864287 GAGTCATATTTTAAGATGCTGGG + Intronic
1153467275 18:5402486-5402508 GAGGCATTTTTTAAATTAGTTGG - Intronic
1153662420 18:7336834-7336856 GAGTCATTATTTGGGATTGTGGG - Intergenic
1155169671 18:23258047-23258069 CAGTCATTTTCTAAGGGTGGAGG - Exonic
1155478041 18:26255053-26255075 GGGGCATTTTTTAAGGTGGCTGG - Intronic
1156121996 18:33855734-33855756 GATTCATTTTTTGAGGTTTGAGG + Intronic
1156501524 18:37562664-37562686 GAGTAATTTTTTAAGGTGGCCGG + Intronic
1156966838 18:43104859-43104881 GAGTCATATTTAATGGTTGCAGG - Intronic
1162641028 19:12010492-12010514 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1165175686 19:33928117-33928139 GAGCCATTTCTTTAGCTTGTGGG - Intergenic
926504917 2:13701821-13701843 AAGTAATTTTTTATGCTTGTGGG - Intergenic
927378795 2:22453056-22453078 GAGCCATTTTTAAAGGAAGTGGG + Intergenic
927529069 2:23776946-23776968 CAGTCATATTTTAAGGTACTGGG - Intronic
928310809 2:30207973-30207995 GAGGCCTTTTGTAAGGTTTTGGG + Intergenic
928944608 2:36761193-36761215 GAGTCATTCGTCAAGATTGTGGG - Intronic
929371039 2:41223884-41223906 AAATCATTTATCAAGGTTGTTGG - Intergenic
931210452 2:60189325-60189347 GCGTCGTTTTTTAAGCTTGTTGG - Intergenic
934050901 2:88210054-88210076 GATTCAATATTTCAGGTTGTAGG - Intergenic
934467769 2:94280636-94280658 GAGTTTTTTTTTAACGTGGTAGG + Intergenic
936620861 2:114096163-114096185 TAGTGATTTTTAAATGTTGTTGG + Intergenic
939032679 2:137095155-137095177 GAGGCATAATTTAATGTTGTAGG + Intronic
939116140 2:138063104-138063126 GAGTCATTTTTCATGTTTATTGG - Intergenic
939425400 2:142029995-142030017 GAGTATTTTTCAAAGGTTGTGGG - Intronic
939433325 2:142140018-142140040 GGGACCTTTTTTAAGGTTGGGGG - Intergenic
939460343 2:142490512-142490534 GAGTCCTTTTTTTAAGTTGGAGG + Intergenic
939511186 2:143107301-143107323 GAGACATTTGTGAAGGTTGCAGG - Intronic
940292873 2:152094788-152094810 TAGTCATATTTTAAAGTTTTAGG - Intronic
940956497 2:159734278-159734300 GAGGCTTTTTATAAGGTTGTAGG + Intronic
941360442 2:164544911-164544933 GATTCATTTTTTAAAGATTTGGG - Intronic
942709788 2:178820311-178820333 GTGTGTTTTTTTAAGGTTGGGGG + Intronic
944378858 2:199082794-199082816 TATACATTTTTTAAGGTTCTTGG - Intergenic
944768457 2:202888148-202888170 TTGACATTTTTTGAGGTTGTTGG - Intronic
944935470 2:204562782-204562804 CAGTTTTTTTTTAAGGTTCTGGG - Intronic
945140017 2:206675812-206675834 GAGTTATTTTTCATGTTTGTTGG - Intronic
945340463 2:208646604-208646626 GAGTCTTTTTGTAATCTTGTGGG + Intronic
945800166 2:214419076-214419098 ATGTCATTTATAAAGGTTGTGGG + Intronic
945819091 2:214641125-214641147 GATTCTTTTTTTAAGTGTGTGGG + Intergenic
947382665 2:229560377-229560399 GAACCATTTTTTTAGGTTATTGG - Intronic
1168820086 20:766976-766998 GAGTCATTTTGTCAGGCTTTGGG - Intronic
1169292516 20:4364809-4364831 GAGTCATGTGTCAAGGTCGTGGG + Intergenic
1170161204 20:13313094-13313116 GAGTCATTGGTTAAGGTGGTGGG - Intergenic
1170283546 20:14679026-14679048 GAGTCATTTATTAAGATAGGTGG + Intronic
1170783629 20:19449030-19449052 GAGTCATTTATTAATGAAGTGGG + Intronic
1176154419 20:63611047-63611069 TGGTCATTTCTTAAGGTTTTCGG - Intronic
1177766521 21:25464069-25464091 GTGACAATTTTTAAGGTTGTTGG - Intergenic
1178704594 21:34862756-34862778 AAGCCATATTTTAAGGTTCTAGG + Intronic
1179023256 21:37658003-37658025 GATTCATTTTTGTAGTTTGTGGG + Intronic
1179977332 21:44875734-44875756 GAGTTATTTTTTATGGTAGTTGG + Intergenic
1180256056 21:46628457-46628479 GAATTGTTTTTTGAGGTTGTGGG + Intergenic
1180394993 22:12323308-12323330 GTGACATTTTTTAAGCCTGTTGG + Intergenic
1180404747 22:12541440-12541462 GTGACATTTTTTAAGCCTGTTGG - Intergenic
1180575169 22:16766671-16766693 GTGCCATTTTTTAAGCCTGTTGG - Intergenic
1183844729 22:40532525-40532547 GAGTCATTTTTTATGCATATAGG - Intronic
951071202 3:18330965-18330987 GCGTCATTTTTTAAGCCCGTCGG + Intronic
951429984 3:22595595-22595617 CAGTCATTTTTTTTGGTTGGGGG - Intergenic
952472582 3:33671754-33671776 GCGCCATTTTTTAAGCCTGTCGG - Intronic
952735236 3:36683080-36683102 GAGTCATTGTCAAAAGTTGTGGG - Intergenic
953089449 3:39709207-39709229 GATTCATTTTTGAAGCTTCTTGG - Intergenic
953133198 3:40160698-40160720 GCGCCATTTTTTAAGCCTGTCGG + Intronic
953214777 3:40908113-40908135 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
955400189 3:58585986-58586008 GTTTCATTTCTTAAGGTTGGGGG - Intronic
955589562 3:60520702-60520724 GGGTCATTTTTCAATGTTGTGGG + Intronic
955975536 3:64476096-64476118 GTGTCATTTTTTAAGCCCGTTGG - Intergenic
956537298 3:70290764-70290786 GCGCCGTTTTTTAAGCTTGTCGG + Intergenic
957387487 3:79515827-79515849 TAGTCATTTTTAAAGGTATTTGG + Intronic
957563649 3:81857460-81857482 TAGTCATTTTTTAAAGTTTATGG + Intergenic
957933245 3:86910337-86910359 GAGTCATTTTTGAATGCTTTTGG + Intergenic
958712561 3:97735650-97735672 AAATTATTTCTTAAGGTTGTAGG + Intronic
958870890 3:99557718-99557740 GAGTAATTTTTCATGTTTGTTGG - Intergenic
959156971 3:102678854-102678876 GAGGCATATTTTGGGGTTGTTGG + Intergenic
960338829 3:116450324-116450346 GAGTGATTTTTTAATTGTGTAGG - Intronic
962260989 3:133905793-133905815 GGGTCATTTTATAAGGATATAGG - Intergenic
962489027 3:135872924-135872946 GAGTCAGTTTTTGAGGATGCGGG - Intergenic
962822428 3:139063933-139063955 GAATTATTTTCTAAAGTTGTTGG + Intronic
963399016 3:144773506-144773528 GAATCATGGTTTAATGTTGTAGG + Intergenic
963514717 3:146293750-146293772 GTGCCATTTTCTAAGGCTGTTGG + Intergenic
964580596 3:158231488-158231510 AAGTCATTTATTCAGGATGTGGG - Intronic
965379991 3:167976560-167976582 GAGAAATTATTTAAGGTTTTGGG - Intergenic
965717706 3:171625165-171625187 GCGCCATTTTTTAAGCCTGTTGG - Intronic
965963989 3:174464352-174464374 TGATCATTTTTTAAAGTTGTTGG + Intronic
966099669 3:176251732-176251754 TAGTCATTTTTTAATATTATAGG + Intergenic
967674197 3:192276709-192276731 GAGTAATATGTTAAGGTTTTTGG - Intronic
968950511 4:3689012-3689034 GTGTGATTTTTTAAAATTGTCGG - Intergenic
970027217 4:11636298-11636320 GGCTCATTTTGTAAGATTGTTGG + Intergenic
971368189 4:25994245-25994267 GAGTCTTATTTTGAGGTTCTGGG - Intergenic
972119582 4:35683013-35683035 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
972987788 4:44785716-44785738 GAGACAATTTACAAGGTTGTTGG + Intergenic
973129588 4:46634255-46634277 TTGTCATTTTTTAACATTGTTGG + Intergenic
973591475 4:52446625-52446647 GTGCCATTTTTTAAGGCTGTCGG - Intergenic
975661564 4:76693691-76693713 GAGTCATTTTTTAAGGTTGTGGG + Intronic
976099479 4:81545626-81545648 CAGTTGTTTTTTAAGGTTTTTGG - Intronic
976372702 4:84308686-84308708 GAGACATTTTTTAACCATGTTGG - Intergenic
976963349 4:91005520-91005542 GAATCATTTTTTAAAATTTTTGG + Intronic
977005522 4:91564650-91564672 GAGCTTTTTTTTAATGTTGTTGG + Intronic
977882828 4:102225410-102225432 GATGCATTTTTCAAGGTAGTTGG - Intergenic
977922228 4:102658339-102658361 CAGACATTTTTCAAGGTTGGGGG - Intronic
978060177 4:104327309-104327331 GTGCCATTTTTTAAGCCTGTTGG + Intergenic
979363713 4:119795086-119795108 GGGTCATTGTTTTAGGTTATGGG + Intergenic
979498831 4:121415517-121415539 GATTAATTTTTTGATGTTGTTGG + Intergenic
980484826 4:133442541-133442563 GAAACACTTTTTAATGTTGTTGG + Intergenic
983977300 4:173951110-173951132 GAATCATTTTTTAAGGGTTAAGG + Intergenic
985361706 4:189183084-189183106 GAGTAATTTTTTCATGCTGTGGG - Intergenic
986421529 5:7589285-7589307 GAATCATTTTTTGTTGTTGTTGG - Intronic
987174198 5:15290740-15290762 GAGTAATTTTGTAAGTTTTTTGG + Intergenic
987256789 5:16162913-16162935 GTTTCATTTCTTAATGTTGTTGG - Intronic
988196290 5:28010288-28010310 GATTCTGTTTTTAAGTTTGTGGG + Intergenic
988392256 5:30649966-30649988 GAGTGAAGTTTTGAGGTTGTTGG + Intergenic
988790630 5:34604317-34604339 CAGTCATGTTTTAAGGTATTGGG + Intergenic
988963300 5:36390898-36390920 GAATCATTCTTTCAGGTTGAGGG + Intergenic
989864923 5:46489946-46489968 GAGTAATTTTTTACGTATGTTGG + Intergenic
989866520 5:46517622-46517644 GAGTAATTTTTTACGTATGTTGG + Intergenic
990030268 5:51251044-51251066 GCGCCATTTTTTAAGCTGGTTGG - Intergenic
991392209 5:66158237-66158259 TTTTCATTTTTTTAGGTTGTAGG + Intronic
992981873 5:82183830-82183852 GACATATTTTTTAAGGTTCTTGG - Intronic
993513179 5:88797390-88797412 GAGTCTTTTTTTATCTTTGTTGG + Intronic
993750212 5:91656644-91656666 GTGACATTTTTTATGATTGTTGG - Intergenic
994151408 5:96451873-96451895 GAGTCTTTTTTCATGTTTGTTGG - Intergenic
994586425 5:101715158-101715180 TAGTCTTTTTTCAAGGTTTTTGG + Intergenic
994753047 5:103763069-103763091 GAGTACTTTTTCAAGGTTGAAGG + Intergenic
994994249 5:107039317-107039339 GAGCCATATTTTAGAGTTGTAGG + Intergenic
995276582 5:110284473-110284495 GTGCCATTTTTTAAGGCTGTTGG + Intergenic
995366717 5:111369881-111369903 GTGTTATTTTTTATTGTTGTTGG + Intronic
995786955 5:115841011-115841033 GAGTAATGTTTTATGGTGGTAGG - Intronic
996574617 5:124967510-124967532 GAGTCTTTTTTTTAAGTTGGAGG + Intergenic
1000377103 5:160592726-160592748 GCGCCATTTTTTAAGCCTGTTGG - Intronic
1000473572 5:161676864-161676886 GTGTCATTTCCTAAGGCTGTCGG - Intronic
1000602751 5:163294955-163294977 GAAACATATTTTAAAGTTGTTGG - Intergenic
1000613952 5:163407454-163407476 GAGTCATTTTTTAATATTTTTGG - Intergenic
1003585036 6:7381164-7381186 GAGTCATGTTTTAAGGTACTAGG - Intronic
1003975734 6:11342301-11342323 AAGTCATTTTTTAAAATTTTGGG - Intronic
1006210548 6:32390199-32390221 ATGTCATTTTTACAGGTTGTGGG + Intergenic
1009393076 6:63165876-63165898 AAGTAATATTTTCAGGTTGTGGG + Intergenic
1010250531 6:73702514-73702536 GAATTATTTTTAAAGGGTGTAGG + Intronic
1010274889 6:73957745-73957767 GAGTCTTTTTTTGAGGTACTGGG + Intergenic
1011896078 6:92227583-92227605 GAGTATTTTTTCATGGTTGTTGG + Intergenic
1012561490 6:100586412-100586434 GCGCCATTTTTTAAGCTCGTTGG + Intronic
1012891249 6:104899873-104899895 AAGTCATTTTGTAGTGTTGTAGG - Intergenic
1013230924 6:108161730-108161752 TTGTTATTTGTTAAGGTTGTGGG + Intronic
1014084578 6:117328525-117328547 GGAACATTTTTTAAGGTTATGGG + Intronic
1014987619 6:128031188-128031210 GAGTGATTTTTCAAGAATGTGGG - Intronic
1015802311 6:137072525-137072547 GTGTCATTTTTTATCTTTGTTGG - Intergenic
1018215605 6:161524227-161524249 GAGTCATTTTTCATGGGTGCTGG - Intronic
1020366783 7:7389111-7389133 GGGTTTTTTTTTAAGGTTTTAGG + Intronic
1020929144 7:14371431-14371453 GAGTAATTTTTCATGTTTGTTGG + Intronic
1021276182 7:18654463-18654485 GAGTGAGTTGTTAAGGTTGAAGG - Intronic
1021915470 7:25427469-25427491 AAATCATTTTTTCAGGTTGCAGG - Intergenic
1022085955 7:27067694-27067716 AAGGCATTTTGGAAGGTTGTTGG - Intergenic
1023290384 7:38662269-38662291 TTGTCATTTTTTACTGTTGTTGG - Intergenic
1023323986 7:39032369-39032391 GAGGCATTTTATAAAATTGTTGG + Intronic
1023334576 7:39154941-39154963 GATTCATGCTTTCAGGTTGTAGG + Intronic
1023533972 7:41188375-41188397 GACTCCTTTTATATGGTTGTGGG - Intergenic
1027303675 7:76869083-76869105 GCCTCATTTTTTAATGTTTTAGG + Intergenic
1027520446 7:79200231-79200253 GAGTCATTTTGAAAAGTTTTAGG + Intronic
1027982954 7:85250155-85250177 GCGCCATTTTTTAAGCCTGTCGG - Intergenic
1028252850 7:88556743-88556765 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1028944138 7:96557895-96557917 GAGCCGTTTTTTAAGGCCGTTGG + Intronic
1028945718 7:96577368-96577390 GAGTCACTTTGCAAGGTTTTTGG - Intronic
1028973511 7:96886575-96886597 GAGTTATTTTTTAAAGGTGGTGG - Intergenic
1028989098 7:97030811-97030833 GAGTCACTTTTAAAAATTGTGGG + Intergenic
1029036999 7:97532862-97532884 GAGCCGTTTTTTAAGCCTGTCGG - Intergenic
1029918900 7:104241222-104241244 GAGTTATTTTTTAATACTGTAGG + Intergenic
1030476186 7:110035966-110035988 GTGCCATTTTTTAAGCCTGTTGG + Intergenic
1030775873 7:113533640-113533662 GCGCCATTTTTTAAGCCTGTAGG - Intergenic
1031579213 7:123450890-123450912 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1032492035 7:132330984-132331006 CAGTCATTTTTCAAGGTTCAAGG + Intronic
1032806102 7:135355891-135355913 GAGGGACTTTTTAATGTTGTTGG - Intergenic
1032809231 7:135393860-135393882 AACTCATATTTTCAGGTTGTTGG - Intronic
1033538052 7:142329852-142329874 AAGTTATTTTTTAAAGTTTTGGG + Intergenic
1034759976 7:153662639-153662661 AAGTCATTTTTTAAGTGAGTGGG + Intergenic
1038668489 8:29562505-29562527 GAGTCTTTTCTAAATGTTGTGGG + Intergenic
1039124022 8:34180571-34180593 GAGCCATTTTTCATGTTTGTTGG - Intergenic
1039423013 8:37460582-37460604 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1039683691 8:39771734-39771756 AATTCATTATTTAAGGTTGATGG - Intronic
1040514278 8:48121901-48121923 AAGTGATTTTTTAAGGTGGTGGG + Intergenic
1041053805 8:53962032-53962054 GGGCCATTTTTTAATGTTGCAGG + Intergenic
1041203762 8:55476708-55476730 GTGTCATTTTTTAAGCCTGTTGG - Intronic
1043290549 8:78594898-78594920 GAGTCATCTCTTAAGGTAGGTGG + Intronic
1043786002 8:84400661-84400683 GAGTCATTTTTCAAGGGACTTGG + Intronic
1044455355 8:92386510-92386532 GAGCCATTTTTTAAGCCTATCGG + Intergenic
1044841043 8:96337401-96337423 GTGAAATTTTTTTAGGTTGTGGG + Intergenic
1045655297 8:104380961-104380983 GAGTCATTCTTTAAGATGTTAGG - Intronic
1045775267 8:105794910-105794932 GCGCCATTTTTTAAGCCTGTCGG + Intronic
1046225489 8:111273431-111273453 GAGGCTTTTTTTATGTTTGTTGG + Intergenic
1046896558 8:119479573-119479595 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1048825351 8:138419236-138419258 TTGTCATTTTTTATTGTTGTTGG - Intronic
1051756822 9:20410204-20410226 GTGTCCTTTTTCAAGGTTGTGGG - Intronic
1051921785 9:22275183-22275205 GACTCATTTTTCAGGGTAGTGGG - Intergenic
1052327112 9:27227176-27227198 GAGTCATTTGTTCAGCATGTGGG + Intronic
1052570425 9:30214416-30214438 GGCTTATATTTTAAGGTTGTTGG - Intergenic
1054669990 9:67778626-67778648 TATACATTTTGTAAGGTTGTAGG - Intergenic
1054965202 9:71017436-71017458 TAGTCATTTTTTAGTTTTGTGGG - Intronic
1056296520 9:85198663-85198685 GAGTCATTTTCCAAGGTCCTGGG + Intergenic
1056408761 9:86303481-86303503 GAGTCAGCTTTTCAGGATGTGGG + Intronic
1060324109 9:122595847-122595869 GTGCCGTTTTTTAAGGCTGTCGG + Intergenic
1061528107 9:131185276-131185298 GAGTCATTTTTTTCTGTTTTTGG - Intronic
1062674689 9:137733938-137733960 TTGTCATTTTTTATAGTTGTAGG - Intronic
1203410404 Un_KI270581v1:3355-3377 GTGACATTTTTTAAGCCTGTTGG - Intergenic
1185829385 X:3285488-3285510 GAGTATTTTTTCAAGTTTGTTGG + Intergenic
1186538551 X:10374933-10374955 AAGTATTTTTTTAAGGTTGTTGG - Intergenic
1187091471 X:16101422-16101444 CAGTTATTTCTTAAGTTTGTGGG - Intergenic
1187109476 X:16281835-16281857 GAGTCATTTTTTAGGTTTTCAGG + Intergenic
1187758942 X:22558698-22558720 GAGCCTTTTATTTAGGTTGTGGG + Intergenic
1187789174 X:22929902-22929924 GATTGATTTTTTATTGTTGTAGG + Intergenic
1188189959 X:27160798-27160820 GAGTAATCTTTTAAATTTGTGGG - Intergenic
1188573250 X:31615109-31615131 GAATAATTTTTTAGGGTTATTGG - Intronic
1188843179 X:35040775-35040797 CAGGCATTTTTTTAGTTTGTAGG - Intergenic
1189546358 X:42046343-42046365 AAGTCATTTTTTGACCTTGTTGG + Intergenic
1190378074 X:49810372-49810394 GAGTCTCTTTTCAAGGTTGAAGG - Intergenic
1190392045 X:49941707-49941729 GAGATATTTTTTCTGGTTGTGGG - Intronic
1191157931 X:57295773-57295795 GTGTCCTTTGTTAAGCTTGTTGG - Intronic
1191163293 X:57358884-57358906 GAGTTATTTTTTATTTTTGTGGG + Intronic
1193064469 X:77244569-77244591 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1193620814 X:83750799-83750821 GCGCCATTTTTTAAGCCTGTTGG - Intergenic
1193638498 X:83983057-83983079 CAGTCACTTTTTAAGGCTTTGGG + Intergenic
1193681415 X:84523806-84523828 GAGATAGTTTATAAGGTTGTGGG + Intergenic
1194054528 X:89115632-89115654 GAAATATTTTGTAAGGTTGTTGG + Intergenic
1201398066 Y:13570987-13571009 GTGCCATTTTTTAAGGCTGTTGG - Intergenic
1201447002 Y:14068225-14068247 GAGTCTTATTTTAAGTCTGTTGG - Intergenic
1201600951 Y:15728023-15728045 GCGCCATTTTTTAAGCCTGTCGG + Intergenic
1201739825 Y:17311935-17311957 GTGCCATTTTTTAAGCCTGTTGG - Intergenic
1201988313 Y:19993693-19993715 GTGTCACTTTTTAAGCCTGTTGG + Intergenic
1202064657 Y:20925684-20925706 GTGCCATTTTTTAAGCCTGTTGG + Intergenic