ID: 975661849

View in Genome Browser
Species Human (GRCh38)
Location 4:76696471-76696493
Sequence CCAGTACCTTCTCTTTGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975661844_975661849 9 Left 975661844 4:76696439-76696461 CCGCAGCTGGATTTGTGAAATGG 0: 1
1: 0
2: 1
3: 13
4: 184
Right 975661849 4:76696471-76696493 CCAGTACCTTCTCTTTGTCGTGG No data
975661843_975661849 17 Left 975661843 4:76696431-76696453 CCATTGATCCGCAGCTGGATTTG 0: 1
1: 0
2: 2
3: 14
4: 185
Right 975661849 4:76696471-76696493 CCAGTACCTTCTCTTTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975661849 Original CRISPR CCAGTACCTTCTCTTTGTCG TGG Intronic
No off target data available for this crispr