ID: 975661872

View in Genome Browser
Species Human (GRCh38)
Location 4:76696579-76696601
Sequence TGTCATAGGCTGGCCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975661872 Original CRISPR TGTCATAGGCTGGCCTGGCC TGG Intronic
900094067 1:933302-933324 CGACACAGCCTGGCCTGGCCCGG - Intronic
900437441 1:2638079-2638101 TGTGATAAGCTTACCTGGCCAGG + Intronic
900998777 1:6136983-6137005 GGTCCTAGGCTGGCCGGCCCAGG - Intronic
901057893 1:6457278-6457300 AGGCAGAGGCTGGCCTGGCAGGG + Intronic
901070901 1:6517796-6517818 CGGGATAGCCTGGCCTGGCCTGG - Intronic
901237100 1:7672969-7672991 TGTGATAGGCAGACCCGGCCTGG - Intronic
901908354 1:12433840-12433862 TGTATTAGGCAGCCCTGGCCAGG + Intronic
902334736 1:15748394-15748416 TGCCTCAGGCTGGCCTGGGCTGG + Intergenic
903167051 1:21527837-21527859 TGTTAAAGGCTGGCCGGGCGTGG - Intronic
903554626 1:24184464-24184486 TGACGTGGCCTGGCCTGGCCTGG + Intronic
903554627 1:24184469-24184491 TGGCCTGGCCTGGCCTGGCCAGG + Intronic
903762731 1:25710329-25710351 TGTAAAAGCCTGGCCTGCCCAGG + Intronic
904465357 1:30704452-30704474 TGTCCTGGGCTGGCCTGGGTTGG - Intergenic
904818108 1:33220669-33220691 AGTCATAGTCAGGCCTGGCTGGG - Intergenic
905403229 1:37717669-37717691 TCTCATGGCCCGGCCTGGCCAGG + Exonic
905449983 1:38049877-38049899 TGTTAGATGCTGGCCTGGGCTGG + Intergenic
905936636 1:41829095-41829117 TGTGAGTGCCTGGCCTGGCCAGG - Intronic
907897065 1:58701979-58702001 TGTAATGGGCTGGCCGGGCGCGG + Intergenic
908762765 1:67527067-67527089 TGTCATACTCTGGCCGGGCGCGG - Intergenic
911300635 1:96168800-96168822 TCTTATAGGCTGGTCTGGTCAGG - Intergenic
917470588 1:175322951-175322973 TGTCACAGCCTGACATGGCCAGG - Exonic
920033215 1:203049510-203049532 TGTCATCTGTGGGCCTGGCCTGG + Intronic
920088555 1:203435719-203435741 TTCCCCAGGCTGGCCTGGCCTGG + Intergenic
920301237 1:204990310-204990332 CATCATGGCCTGGCCTGGCCTGG - Intronic
924919268 1:248609809-248609831 GGTCATGGGCCGGCCTGCCCTGG - Intergenic
1062855104 10:776071-776093 CGTCTTGGGCTGGCCTTGCCTGG - Intergenic
1063457227 10:6192517-6192539 AGTCATGGGCCGGCCTTGCCTGG + Intronic
1063498080 10:6528383-6528405 TGTCATAGGCTGGGGTGGGGTGG + Intronic
1063773850 10:9237988-9238010 TGGCCTGGCCTGGCCTGGCCTGG - Intergenic
1064911230 10:20404239-20404261 TTTCCTAGGCTGCCCTGACCAGG + Intergenic
1067709530 10:48637079-48637101 TCTCAGAGACTGGCCTGGCAGGG - Intronic
1069419871 10:68237716-68237738 TGTCAGAGACTGGCCAGGCGCGG + Intergenic
1069840903 10:71338784-71338806 TGTCATTTGCTGGCTTGGGCAGG + Intronic
1071328822 10:84541210-84541232 TGTCCAAGGTGGGCCTGGCCTGG + Intergenic
1072200122 10:93150618-93150640 TACCATATGCTGTCCTGGCCAGG + Intergenic
1074350491 10:112732325-112732347 TGGATTATGCTGGCCTGGCCAGG - Intronic
1074358844 10:112809028-112809050 TGTCATTGGCTGGGCCTGCCTGG + Intronic
1076088180 10:127654276-127654298 GGTCTTAGTCTTGCCTGGCCTGG - Intergenic
1076406522 10:130215654-130215676 TGTCCTAACCTGGCCTGGCAAGG + Intergenic
1076742880 10:132496688-132496710 TGTCAGAGGCTGGGCTGGAGGGG + Intergenic
1078954635 11:16177790-16177812 TGTCACATGCTGGCCTCACCTGG + Intronic
1081571431 11:44293852-44293874 GGTCCTGGGCTGGGCTGGCCTGG + Intronic
1081667471 11:44925016-44925038 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1081866607 11:46363753-46363775 TGTCACAGGGCGGCCTGACCAGG + Intronic
1082004537 11:47412305-47412327 TGGCTTGGCCTGGCCTGGCCTGG + Intronic
1082760776 11:57124927-57124949 TGTCCCAGGCTGGCTTAGCCTGG + Intergenic
1083630706 11:64093777-64093799 TGTTCTAGTCTGGCCTGGCCAGG + Intronic
1084468991 11:69344218-69344240 TGACAGGGGCAGGCCTGGCCTGG + Intronic
1085186767 11:74582378-74582400 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1085258594 11:75191340-75191362 TGCCATAAGCTGCTCTGGCCAGG - Intronic
1086981857 11:93206986-93207008 GGTCAGAGGCTGCCCTGGCAAGG - Intergenic
1087180220 11:95134720-95134742 TGTCAGTGGCAGGCCTGGGCTGG - Intergenic
1088920653 11:114257982-114258004 ATTCTCAGGCTGGCCTGGCCAGG - Intronic
1091198593 11:133753085-133753107 TGTTTCAGGCTGGCCTGGCTTGG + Intergenic
1095941308 12:47728955-47728977 TAGAATAGGCTGGCCTGGGCAGG - Intergenic
1095955900 12:47805796-47805818 TGTACTGGTCTGGCCTGGCCTGG - Intronic
1096154090 12:49332263-49332285 TGCCAGAGGCAGGCCTTGCCTGG + Intergenic
1098913222 12:76231877-76231899 AGTCCTTGGCTGGACTGGCCTGG + Intergenic
1098913471 12:76233979-76234001 AGTCCTTGGCTGGACTGGCCTGG - Intergenic
1099025387 12:77459245-77459267 TATCATAGACTGGGGTGGCCAGG + Intergenic
1102038228 12:109784098-109784120 TGACATAAGCTGGCCTGGGGAGG - Intronic
1102483145 12:113237719-113237741 TTTCATAGGCTCACCTGGCCTGG + Intronic
1102698723 12:114820420-114820442 AGTCATAGGGTGGCCGGGCCAGG + Intergenic
1103726157 12:122998308-122998330 CCTCACAGGCAGGCCTGGCCTGG - Intronic
1106323162 13:28660944-28660966 TGTGATAGGCTGGGCTGGAGTGG + Intronic
1107575586 13:41717130-41717152 TTGCATATTCTGGCCTGGCCAGG + Intronic
1109276711 13:60311758-60311780 TGTCATACTATGGCCTGGCTGGG + Intergenic
1111131632 13:83984185-83984207 TGTCCTAGGCTGGCCGGGCGCGG - Intergenic
1111933376 13:94534683-94534705 TGCCATCGGCTGCCCTGGGCAGG + Intergenic
1111959047 13:94789669-94789691 TGTAATAGGTTGGCCAGGCACGG + Intergenic
1112492853 13:99882967-99882989 TGGGCTGGGCTGGCCTGGCCTGG - Intronic
1113600603 13:111565733-111565755 TGTCCTAGGATGCCCTGGTCAGG + Intergenic
1114492721 14:23113486-23113508 TTCCATAAGCAGGCCTGGCCTGG - Intergenic
1115637760 14:35306854-35306876 AGTCATATGTTGGCCTGGCATGG + Intronic
1118163636 14:63315208-63315230 TGTCAAAGGCAAGGCTGGCCGGG - Intronic
1118909705 14:70050977-70050999 TGTCTCAGGCTGGCCTTGCTGGG - Intronic
1119479977 14:74953096-74953118 TGTCAGAGTATGGCCAGGCCCGG + Intronic
1120900492 14:89571216-89571238 GGTGATAGACTGGCCTGGCATGG + Intronic
1121022391 14:90588223-90588245 TGGCCTGGCCTGGCCTGGCCTGG - Intronic
1121038151 14:90723673-90723695 TTAGATAGGGTGGCCTGGCCAGG - Intronic
1121248696 14:92483626-92483648 TTTCATCGGCTGGGCTGGGCTGG + Intronic
1122101828 14:99418563-99418585 TGCCACAGGCTGTCCTGCCCAGG - Intronic
1122229290 14:100297562-100297584 TGTCCTGGGCTGCTCTGGCCTGG + Intronic
1122918427 14:104869415-104869437 CGTCAGAGCCTGGCATGGCCCGG - Intronic
1122995737 14:105262854-105262876 TGTCATAGTCTGGCAGTGCCAGG + Intronic
1123037174 14:105476203-105476225 AGCCCCAGGCTGGCCTGGCCCGG - Intronic
1123059998 14:105590287-105590309 TGGCCTGGGCTGGGCTGGCCTGG - Intergenic
1123060002 14:105590297-105590319 TGGCCTGGGCTGGCCTGGGCTGG - Intergenic
1123063172 14:105603537-105603559 TGGGCTGGGCTGGCCTGGCCTGG - Intergenic
1123063173 14:105603542-105603564 TCACATGGGCTGGGCTGGCCTGG - Intergenic
1123084129 14:105709633-105709655 TGTACTAAGCTGGCCTGGGCTGG - Intergenic
1125500885 15:40239781-40239803 TGGCTTAGGCTGGCCTGGGCAGG + Exonic
1126497329 15:49306635-49306657 TGCCTAGGGCTGGCCTGGCCTGG - Intronic
1127560051 15:60127296-60127318 TGGGCTGGGCTGGCCTGGCCAGG - Intergenic
1128777114 15:70329020-70329042 TGCCATGAGGTGGCCTGGCCAGG - Intergenic
1129060824 15:72859186-72859208 TGTCAGCTGCAGGCCTGGCCTGG + Intergenic
1129304617 15:74650332-74650354 GGTCATTAGCTGGCTTGGCCAGG - Intronic
1130542885 15:84834763-84834785 CGCCATGGGCTGTCCTGGCCAGG + Intronic
1132065597 15:98728285-98728307 TGTGAAAGGCTGGCCGGGCTGGG + Intronic
1132147752 15:99438440-99438462 GGTCTTGGGCTGCCCTGGCCGGG - Intergenic
1132300092 15:100769816-100769838 TGTGCCAGGCTGGGCTGGCCAGG - Intergenic
1135905905 16:26511564-26511586 TGTCAGAGGCTTGTGTGGCCAGG + Intergenic
1136294766 16:29295270-29295292 TGTCATAGGCCCGGCTGCCCGGG - Intergenic
1138137303 16:54534389-54534411 GGCCATAGGCTGCCCTGGTCAGG + Intergenic
1139149122 16:64359499-64359521 TGTCTTAGGCTGGCCGGGCGTGG + Intergenic
1139300413 16:65940959-65940981 TGTTATACCCTGGCCTTGCCTGG - Intergenic
1139512507 16:67435614-67435636 AGTCACAGCCTGGCCAGGCCAGG - Exonic
1141099788 16:81188908-81188930 TGTCATTGTCTGGCCAGCCCAGG + Intergenic
1141193522 16:81842350-81842372 TATCATATGCCGGCCTGGACAGG + Intronic
1141556544 16:84840186-84840208 TGCCACAGGCTGAGCTGGCCTGG + Intronic
1142137900 16:88459989-88460011 TGTCAGGGGCTGCCCTGACCTGG - Intronic
1142182757 16:88679213-88679235 TGCGGGAGGCTGGCCTGGCCAGG - Intronic
1143467756 17:7149341-7149363 TGTAATAGGGAGGCCTGGCATGG - Intergenic
1144143784 17:12377261-12377283 TGGCCTGGCCTGGCCTGGCCTGG - Intergenic
1144485791 17:15663203-15663225 TGTCCCAGTCTGGCCTGGCCTGG + Intronic
1145273412 17:21416560-21416582 TGTCAAAGTCATGCCTGGCCTGG - Exonic
1145311601 17:21704004-21704026 TGTCAAAGTCATGCCTGGCCTGG - Exonic
1145862392 17:28221740-28221762 TGACTTAGGGTGGCCTTGCCCGG + Intergenic
1146261989 17:31427890-31427912 TGTCAGAGGCTGGCATGGCTGGG + Intronic
1148552060 17:48556307-48556329 AGTCAAAGGCAGGCCTGGCCCGG + Intronic
1150455234 17:65301962-65301984 AGTCAAAGGCTGGGCTGGGCTGG - Intergenic
1157009378 18:43628074-43628096 GGTCATTTGCTGGCCTGGCAGGG - Intergenic
1157110952 18:44820023-44820045 TGTACTAGGCTTGCCTGTCCTGG + Intronic
1158401349 18:57124049-57124071 TCCCATAGGCTGGGCTGTCCAGG + Intergenic
1158661048 18:59387792-59387814 TTTCAAAGCCTGGGCTGGCCAGG + Intergenic
1159015501 18:63098988-63099010 TGTCTCAGGCTGTCCAGGCCTGG + Intergenic
1159486250 18:69062031-69062053 TGTCTTGGCTTGGCCTGGCCTGG + Intergenic
1159955152 18:74513746-74513768 TGTCACAGCGTGGCCTGGGCAGG - Intronic
1160328612 18:77972098-77972120 TGCCCTAGCCTGGCCTGGGCTGG - Intergenic
1160708282 19:539944-539966 TGCCAGAGGCTGGGATGGCCAGG + Intronic
1162498112 19:11034747-11034769 TTTCAGTGGCTGACCTGGCCTGG - Intronic
1164620720 19:29694698-29694720 TGTCTGGGCCTGGCCTGGCCTGG + Intergenic
1164917861 19:32066248-32066270 GGTCAGAGGCTGGCATGGGCTGG + Intergenic
1165051859 19:33146945-33146967 AGTCATAGGCAGGCCAGGCGTGG + Intronic
1165444477 19:35849325-35849347 TGTCATCGAGTGGCCAGGCCTGG - Exonic
1165844711 19:38810770-38810792 TTAAATAGGGTGGCCTGGCCGGG - Intronic
1167299461 19:48670649-48670671 TGGCACAGGCCCGCCTGGCCTGG - Exonic
1167538494 19:50070725-50070747 TGCCCTGGACTGGCCTGGCCTGG + Intergenic
1167608934 19:50496862-50496884 TGGCACCGCCTGGCCTGGCCTGG + Intergenic
1168094523 19:54107052-54107074 AGTCAGAGGCTGGGCTGGCCAGG + Exonic
1168244340 19:55103625-55103647 GGTCATACACTGGGCTGGCCAGG + Intronic
925090993 2:1155982-1156004 TGTCCTGGCCTGGCCTGGCCTGG - Intronic
925198968 2:1950915-1950937 GGTCATAGGTTGGCCTGGGAAGG + Intronic
925520994 2:4745875-4745897 AGTCACAGGCTGTCCTTGCCAGG - Intergenic
925844162 2:8020568-8020590 TGTCAGAGCCGGGCCTGGGCTGG - Intergenic
927878595 2:26674982-26675004 TGTCAGAGGCCCACCTGGCCCGG - Intergenic
929580668 2:43080001-43080023 TGATAAAGGCTGGTCTGGCCGGG + Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
931126401 2:59282939-59282961 TGTCCTACACTGGCCTGCCCTGG - Intergenic
932090391 2:68800552-68800574 TGGCATGGGCTGGCATGGTCTGG + Intronic
932603269 2:73144959-73144981 TGTAATAGGCTGGCCAGGCACGG - Intronic
934793428 2:97081987-97082009 TGTCACAGGCTGGCCGGACCCGG - Intergenic
934954723 2:98608248-98608270 TGTCCCAGGCAGGCCTGGCTCGG - Intronic
935550223 2:104444985-104445007 TGTCATAGGCAGGCCGGGTGTGG + Intergenic
936950162 2:117969676-117969698 AGTCATAGGGTGGCCTTGTCTGG - Intronic
936953419 2:118001037-118001059 TGTCATGGTCTGGACTAGCCTGG - Intronic
937319146 2:120950520-120950542 TGGCTTGGGCTGGCATGGCCAGG - Intronic
937445339 2:121952731-121952753 TGACTCTGGCTGGCCTGGCCAGG - Intergenic
945875320 2:215272184-215272206 TGCCACAGGAAGGCCTGGCCTGG + Intergenic
945971187 2:216233780-216233802 TGTGACAGGCTGGGCTGGCCAGG + Intergenic
1172913951 20:38430019-38430041 TCTCAAAGACTGGGCTGGCCGGG + Intergenic
1173078269 20:39841652-39841674 TGGGGTAGGCTGGCCTTGCCTGG - Intergenic
1173162742 20:40664386-40664408 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
1173321386 20:41990278-41990300 TGTGCTAGGCTGGCATGGCCTGG - Intergenic
1173324396 20:42019355-42019377 TGTCATAGGACAGCCTGGCCTGG + Intergenic
1174051596 20:47771072-47771094 TCACAGAGGCTGGCCAGGCCTGG + Intronic
1175083020 20:56437169-56437191 TGTCATAAAGTGCCCTGGCCAGG - Exonic
1175510348 20:59519956-59519978 TGACAGAGGCTGGCCTGGAAAGG + Intergenic
1175911353 20:62406881-62406903 CGTCCTGGGCTGACCTGGCCGGG + Intronic
1176661018 21:9634976-9634998 TGTCATGGGGTGTCCAGGCCAGG - Intergenic
1177301028 21:19245620-19245642 TGTCTGAGTCAGGCCTGGCCTGG + Intergenic
1178272080 21:31199818-31199840 TGTTCTAGGCTGGCCAGGCATGG - Intronic
1178424096 21:32465362-32465384 TGTCATGGGCTGGCCTGGGGTGG - Intronic
1179503031 21:41821708-41821730 TGACACAGGCTGGCCTTCCCAGG + Intronic
1179635672 21:42707263-42707285 TGTGCCAGGCTGGCCTGTCCAGG + Intronic
1179885698 21:44313397-44313419 AGTCCTGGGCTGGCCAGGCCTGG + Intronic
1180080236 21:45483324-45483346 TGTCCTTGGCGGCCCTGGCCTGG + Intronic
1181450949 22:23020280-23020302 TGTTATACTCTGGCCTGGCAGGG + Intergenic
1181462445 22:23093811-23093833 TGTCAGAGGCTGGCAGGGCTAGG + Intronic
1181546729 22:23606556-23606578 TCTCAAAGGCTGGTCTGACCAGG + Intergenic
1181595015 22:23908464-23908486 TGCCAGAGGCTGGCCCTGCCAGG - Intergenic
1182254053 22:29025415-29025437 TGCCATAGGCTGGTGTGGTCAGG - Intronic
1182281799 22:29221662-29221684 TGTCATATCCTGGCCGGGCGTGG - Intronic
1183947670 22:41335915-41335937 TGTGAGATGCTGGCCTGGGCTGG + Intronic
1184192691 22:42905501-42905523 TGTGATGGGCTGCCCAGGCCAGG - Intronic
1184974580 22:48051979-48052001 TAACCTGGGCTGGCCTGGCCGGG - Intergenic
1184997336 22:48217939-48217961 TGTCATTGCCAGGCCTGGGCAGG + Intergenic
951187477 3:19730505-19730527 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
951217718 3:20040479-20040501 TGTCCGAGGCTGGCGGGGCCGGG + Exonic
952888815 3:38027986-38028008 TGGCATAGGCTTGGCTGCCCTGG - Intronic
952965294 3:38617353-38617375 GGCCCTTGGCTGGCCTGGCCTGG - Intronic
953405198 3:42656504-42656526 TGTCCCAGGCTGTCCAGGCCTGG - Intronic
953867737 3:46598895-46598917 TGGCATAGGCTGACCAGACCAGG - Intronic
954068311 3:48124632-48124654 TGGCCTGGCCTGGCCTGGCCTGG + Intergenic
954674263 3:52307051-52307073 TATCCTAGCCTGGCCTGGCCTGG + Intergenic
956865585 3:73365834-73365856 GTGCATAGCCTGGCCTGGCCTGG + Intergenic
959484684 3:106913380-106913402 TCTCCTGGACTGGCCTGGCCCGG - Intergenic
961210504 3:125121422-125121444 TGTGATGGGCTGCCCTGGTCAGG + Intronic
961321749 3:126081999-126082021 TGCCAGAGGAAGGCCTGGCCAGG + Intronic
961328948 3:126127721-126127743 TGCCAGAGGAGGGCCTGGCCAGG - Intronic
961662924 3:128479910-128479932 TGGCATTTGCTGGCCTGGCAGGG - Exonic
961954539 3:130787969-130787991 TTTCATAGCCTGGCCTGGCCTGG - Intergenic
962745561 3:138395325-138395347 TGGCATAGTCTGGCCAGGCGCGG - Intronic
963654415 3:148026467-148026489 TTCCATAGGCTGGTGTGGCCTGG + Intergenic
966812159 3:183856360-183856382 TGTCAGTGTCTGGACTGGCCAGG - Intronic
967278057 3:187795751-187795773 TGGCTTGGTCTGGCCTGGCCAGG - Intergenic
968217052 3:196901333-196901355 TGTAAAAAGCTGGCCTGGCATGG - Intronic
968283688 3:197495783-197495805 TTTCCTAGGCTGGCCGGGCTCGG + Intergenic
968618481 4:1592942-1592964 TGCCATAGGCTAGCCGGGCAGGG - Intergenic
968811317 4:2800790-2800812 TGTCTTGGGGTGACCTGGCCGGG + Intronic
969505315 4:7583100-7583122 TGTCCCAGGCTGACCTGGGCAGG - Intronic
970421243 4:15907235-15907257 GGGACTAGGCTGGCCTGGCCTGG - Intergenic
973339097 4:48986181-48986203 TGCCAGAGCCTGGCCAGGCCGGG - Intergenic
974028850 4:56757672-56757694 AGACACAGGCTGGCCTGGACAGG + Intergenic
975661872 4:76696579-76696601 TGTCATAGGCTGGCCTGGCCTGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
978556440 4:109985651-109985673 TGTAATAGGCAGCCCTAGCCCGG - Intronic
978770342 4:112449943-112449965 TGTGCTGGCCTGGCCTGGCCTGG - Intergenic
981403304 4:144339350-144339372 GGTCTTAGGCTGGGATGGCCTGG - Intergenic
981932403 4:150205190-150205212 TGTCAGAGGCTGGGCTTGGCAGG - Intronic
983846530 4:172526874-172526896 TTTCATAAGCTGGCCTGACAAGG + Intronic
985414380 4:189721560-189721582 TGTCATGGGGTGTCCAGGCCAGG + Intergenic
986726476 5:10601847-10601869 TGTCATAGGCTGGGGTGGAGTGG - Intronic
987231352 5:15896841-15896863 CGTAATAGGATGGCCTGGCATGG + Intronic
988693418 5:33595354-33595376 TGTCATAGCCTGGACTGGGAGGG + Intronic
989043713 5:37253877-37253899 TGTCATAGTCTGACCGGGCGTGG + Intergenic
991932257 5:71765479-71765501 TGTCTTAGGCTGGCTTTCCCAGG + Intergenic
992828733 5:80573493-80573515 TGGCATGGACTGGCCTGCCCAGG - Intergenic
997053264 5:130408422-130408444 TGTGATAGGAAGTCCTGGCCAGG - Intergenic
998399910 5:141843265-141843287 TGCCCCAGGCTGGGCTGGCCAGG - Intergenic
999196109 5:149782757-149782779 TGTGATTGGCTGGCAAGGCCAGG - Intronic
1000291258 5:159873604-159873626 TGTCATAGGCTGTCATAGTCAGG - Intergenic
1001820249 5:174704658-174704680 TGCCATCAGCTGGCCAGGCCAGG - Intergenic
1002506248 5:179681090-179681112 TGTCCTGGGGTGGCCTGGCCTGG - Intronic
1004173158 6:13314962-13314984 TGTCATAGCCTGGCTTGGGAAGG - Intronic
1005782411 6:29206257-29206279 TGACATGGGCTGTCCTTGCCAGG + Intergenic
1005998257 6:30945339-30945361 TGGCCTGGCCTGGCCTGGCCTGG - Intronic
1006858494 6:37153178-37153200 TGTCATAGGCTGGGCTTGGATGG + Intergenic
1007538791 6:42621749-42621771 TGGCCAAGGCTGGCCTGGCGCGG - Intronic
1008721073 6:54353355-54353377 TGTTACAGGATTGCCTGGCCTGG + Intronic
1010935813 6:81860051-81860073 TCTCAAATGCTGGCGTGGCCTGG - Intergenic
1013300104 6:108797068-108797090 TGAGATATGCAGGCCTGGCCTGG + Intergenic
1014508622 6:122292191-122292213 AGCTATAGCCTGGCCTGGCCAGG + Intergenic
1015485394 6:133764295-133764317 TGCCACAGGCTGGCCTGAGCTGG - Intergenic
1017023640 6:150162343-150162365 TGGCAGAGGTTGGCCTGGCACGG - Intronic
1017461299 6:154653473-154653495 TGTGTTGTGCTGGCCTGGCCAGG - Intergenic
1019057063 6:169231617-169231639 TGTCTCAGGCAGGTCTGGCCAGG - Intronic
1019493293 7:1324930-1324952 TGTGTTAGGCAGCCCTGGCCTGG - Intergenic
1019516599 7:1442876-1442898 TGTCAGAGGCTGGGCCGGCCTGG + Intronic
1019795267 7:3043888-3043910 TGTCATAGGCTGGGAGGGGCGGG + Exonic
1022334000 7:29405862-29405884 TGTGATCTGCTGGCCTGTCCCGG + Intronic
1024920509 7:54549249-54549271 AGTCATAGGGTGGCATGGCTTGG - Intronic
1026266896 7:68803132-68803154 TGTCATCGTCTGCCCTGGCCTGG - Intergenic
1026849026 7:73713407-73713429 TGTCTTGGGCTGGCCAGGGCGGG + Intronic
1026878784 7:73895016-73895038 GGCCCTAGGCTGGGCTGGCCCGG - Intergenic
1028843376 7:95452735-95452757 TTTCTTAGGATGGCCTGGCAGGG - Intergenic
1029331086 7:99856209-99856231 TGTCATAGCCTGGACTGGGCAGG + Intronic
1032172203 7:129594269-129594291 TGTCATATGGTGTCCTGGACGGG - Intergenic
1033683737 7:143620768-143620790 TCTCGTAGGCTGGCCGGTCCTGG - Intergenic
1033700875 7:143836870-143836892 TCTCGTAGGCTGGCCGGTCCTGG + Intergenic
1034630156 7:152524396-152524418 TGTCCTAGGCTGGCAGGGCCAGG - Intergenic
1037693968 8:21207793-21207815 CTTCAGGGGCTGGCCTGGCCTGG - Intergenic
1039659110 8:39444387-39444409 TGTCCTTGGCTCACCTGGCCTGG + Intergenic
1044992051 8:97804794-97804816 TGGCCTGGCCTGGCCTGGCCTGG + Intronic
1044992053 8:97804799-97804821 TGGCCTGGCCTGGCCTGGCCTGG + Intronic
1047812460 8:128425408-128425430 TGTCAAAGCCCTGCCTGGCCTGG + Intergenic
1047838900 8:128725991-128726013 AGTCACAGGCAGGCTTGGCCGGG + Intergenic
1048321537 8:133404132-133404154 TCCCAGAGTCTGGCCTGGCCTGG - Intergenic
1049523139 8:143105114-143105136 TGACATAAGCTGCCCAGGCCAGG + Intergenic
1052030140 9:23619269-23619291 TGTCATAGGATGAAATGGCCAGG - Intergenic
1053415558 9:37944936-37944958 AGACACAGGCTGGCCTGGCCAGG + Intronic
1054930226 9:70628179-70628201 TCTCAGAGACTGGACTGGCCTGG + Intronic
1055501543 9:76906572-76906594 TCTGGTCGGCTGGCCTGGCCGGG + Intergenic
1058596984 9:106625541-106625563 AGTCTCTGGCTGGCCTGGCCTGG + Intergenic
1060267759 9:122122160-122122182 TGTCCTCGGCTGCCCTGGGCTGG + Intergenic
1060730327 9:126033129-126033151 TGTCCAAGGTTGGCCTGGCACGG - Intergenic
1061264854 9:129499021-129499043 TTTCCTAGTCTGGCCTGGCTGGG - Intergenic
1061824038 9:133246882-133246904 TGTGAAGGGCAGGCCTGGCCCGG - Intergenic
1062165567 9:135105722-135105744 GGTCACAGGCGGGCTTGGCCGGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062707385 9:137953078-137953100 TGTGGTAGGCGGGCATGGCCAGG + Intronic
1203638586 Un_KI270750v1:136820-136842 TGTCATGGGGTGTCCAGGCCAGG - Intergenic
1185468082 X:367551-367573 TGTCAATGGCTGGCCGGGCACGG - Intronic
1185999043 X:4988305-4988327 TTGCATTGGCTGGCCTGGCGCGG + Intergenic
1189069159 X:37846424-37846446 TATCCTAGGCTGGCCTAGACAGG + Intronic
1196323818 X:114377444-114377466 TGAAATAGGCTGGCCGGGCACGG + Intergenic
1196445666 X:115844871-115844893 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196446337 X:115847852-115847874 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196447008 X:115850833-115850855 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196447677 X:115853816-115853838 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196448347 X:115856795-115856817 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196449016 X:115859786-115859808 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196449687 X:115862777-115862799 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196450356 X:115865760-115865782 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196451026 X:115868745-115868767 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196451697 X:115871724-115871746 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196452368 X:115874711-115874733 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196453038 X:115877680-115877702 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196453708 X:115880673-115880695 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1196454377 X:115883682-115883704 CGTCTAAGGGTGGCCTGGCCGGG - Intergenic
1200146959 X:153931305-153931327 TGGCCTAGGCTGGCCCTGCCAGG + Intronic
1200160707 X:154007076-154007098 CGTCATCTGATGGCCTGGCCTGG - Intergenic
1200418137 Y:2934998-2935020 TGGCAGGGGGTGGCCTGGCCCGG + Intergenic
1200938112 Y:8756096-8756118 TGGCACAGGCAGGGCTGGCCAGG + Intergenic