ID: 975663268

View in Genome Browser
Species Human (GRCh38)
Location 4:76708320-76708342
Sequence CCCAGGAAGGAGAAGTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 825
Summary {0: 1, 1: 0, 2: 4, 3: 67, 4: 753}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975663262_975663268 2 Left 975663262 4:76708295-76708317 CCTAGACCTCTGTCTCTAGGCAT 0: 1
1: 0
2: 1
3: 22
4: 272
Right 975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG 0: 1
1: 0
2: 4
3: 67
4: 753
975663259_975663268 25 Left 975663259 4:76708272-76708294 CCTTCACTGTGACAGTCACCACT 0: 1
1: 0
2: 2
3: 25
4: 288
Right 975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG 0: 1
1: 0
2: 4
3: 67
4: 753
975663258_975663268 26 Left 975663258 4:76708271-76708293 CCCTTCACTGTGACAGTCACCAC 0: 1
1: 0
2: 0
3: 21
4: 229
Right 975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG 0: 1
1: 0
2: 4
3: 67
4: 753
975663263_975663268 -4 Left 975663263 4:76708301-76708323 CCTCTGTCTCTAGGCATCTCCCA 0: 1
1: 1
2: 0
3: 26
4: 264
Right 975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG 0: 1
1: 0
2: 4
3: 67
4: 753
975663260_975663268 7 Left 975663260 4:76708290-76708312 CCACTCCTAGACCTCTGTCTCTA 0: 1
1: 0
2: 1
3: 36
4: 368
Right 975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG 0: 1
1: 0
2: 4
3: 67
4: 753
975663257_975663268 30 Left 975663257 4:76708267-76708289 CCAGCCCTTCACTGTGACAGTCA 0: 1
1: 0
2: 1
3: 22
4: 171
Right 975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG 0: 1
1: 0
2: 4
3: 67
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975663268 Original CRISPR CCCAGGAAGGAGAAGTGGAA AGG Intronic
900083784 1:877022-877044 CCCAGGAAGGAGCAGAGGCTGGG + Intergenic
900093997 1:933015-933037 CGCAGGAAGGAGAGGGGGAGGGG - Intronic
900619511 1:3580414-3580436 CCCAGGGAGGGGAGGAGGAAAGG + Intronic
900992771 1:6105615-6105637 CCCAGGAAGCAGCAGTGGGCAGG + Intronic
901086076 1:6613322-6613344 CCCAAGTAGGAGACGAGGAAGGG + Intronic
901104721 1:6746277-6746299 CCCAAGGAGCAGAAGTGGTAGGG - Intergenic
901395909 1:8981415-8981437 GGAAGGAAGGAGAAGGGGAAGGG - Intergenic
902535843 1:17118977-17118999 CCCCGGGAGGAGAACTGGAGAGG + Intronic
902543996 1:17174893-17174915 GACAGGAAGGAGAAGTGAAGGGG - Intergenic
902797279 1:18807885-18807907 ACCGGGAAGGAGAACTGGGAAGG - Intergenic
903057306 1:20645152-20645174 TCCTGGAAGGGGAAGAGGAACGG + Intronic
903321444 1:22545837-22545859 CCCAGGAAGGGTGAGAGGAAAGG - Intergenic
903957399 1:27034774-27034796 GTCAGGAAGGAGAAGAAGAAGGG - Intergenic
904026969 1:27510097-27510119 CCCAGAGGGGAGAAGGGGAAAGG - Intergenic
904502677 1:30924930-30924952 CCCAGGCTGGAGTAGTGCAATGG + Intergenic
904696446 1:32334437-32334459 CACAGGAGGGAGAGGAGGAAAGG + Exonic
904941941 1:34169925-34169947 ACCAGGAGGGAGAAGTGAGAAGG + Intronic
905257381 1:36693534-36693556 CCCGTGAAGGGGAAGTGGAGAGG + Intergenic
906226524 1:44127002-44127024 CTCAGGAGGCTGAAGTGGAAAGG - Intronic
906348515 1:45036904-45036926 CTCAGGAAGCTGAAGTGGGAGGG - Intronic
906482099 1:46205827-46205849 CCCAGGAAGGACAAGGGGTGGGG + Intronic
906570168 1:46831111-46831133 CCCAGGAAGCAGAAGGGGTCGGG - Intergenic
906779185 1:48557263-48557285 CCTAGGAAGAAGAAAAGGAATGG - Intronic
907279935 1:53340708-53340730 CACAGGTAGGACAAGTGGCAAGG - Intergenic
907600049 1:55760269-55760291 CCCAGGAAGAAGAAGGGGTCAGG + Intergenic
907661950 1:56401402-56401424 CCCAGGAAGGAGATGCTGGAGGG - Intergenic
907857709 1:58320212-58320234 CACAGGAAGGACATATGGAAGGG + Intronic
908189239 1:61684378-61684400 CACAGTGAGGAGAAGTGGGAAGG - Intronic
908245977 1:62228037-62228059 TCCAGCTAGGAGAAGTGGGATGG - Intergenic
908505184 1:64790292-64790314 CCAAGGCAGGAGAAGCAGAATGG - Intronic
908535518 1:65073073-65073095 TCCAGGAGGGAGAATGGGAAGGG - Intergenic
908763740 1:67535918-67535940 CCCAGGAAGCGGAAGTTGCAGGG - Intergenic
908905188 1:69000347-69000369 GGCAGGAAGGAGAAGTGCAGAGG + Intergenic
909047469 1:70727856-70727878 CCCAGGAAGGAGGGATGGATTGG + Intergenic
909375804 1:74940654-74940676 TCCAGGAGGGAGAGGAGGAAGGG - Intergenic
909430587 1:75583217-75583239 CCCAGGATTCAGAAATGGAAAGG - Intronic
909481459 1:76132032-76132054 CCCACAAGGGAGGAGTGGAATGG - Intronic
910091828 1:83473559-83473581 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
910396653 1:86800482-86800504 CCCAGGAATGAGCTGTGGGATGG + Intergenic
910573326 1:88730315-88730337 CCCAGAAACAAGAAGTAGAAAGG + Intronic
910672774 1:89789779-89789801 CTCAGGAAGCTGAGGTGGAAGGG - Intronic
910778345 1:90899125-90899147 TCTAGGAAGGATAAGTGCAAAGG - Intergenic
910958770 1:92738008-92738030 CCCAAGAAAGAAAAGTTGAATGG + Intronic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
911387405 1:97194342-97194364 GGTAGGAAGGAGAAGTGCAAAGG - Intronic
911870719 1:103094540-103094562 CAGAGGCAGAAGAAGTGGAAGGG - Intronic
913334511 1:117696601-117696623 ACCAGGATGGAGAAGTGGATGGG - Intergenic
913463182 1:119111556-119111578 TCCAGCAGGGAGAAGGGGAAAGG - Intronic
914327573 1:146635266-146635288 AACAGGAAGAGGAAGTGGAAAGG - Intergenic
914331129 1:146671579-146671601 AGCAGGAAGGAGAACTGGATGGG + Intergenic
914797000 1:150928435-150928457 CACAGGAGGAAGAAGGGGAAAGG - Intronic
914812106 1:151036586-151036608 CCAAGGAGGGAGGTGTGGAAGGG - Exonic
915251479 1:154592275-154592297 CTTAGGAAGGAGAGGGGGAAGGG - Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
916742691 1:167660346-167660368 CCCAGGAAGGAGAAGTGATGGGG - Intronic
917304086 1:173608955-173608977 GAGAGGAAGGAGAAGGGGAAGGG + Intergenic
918001597 1:180502424-180502446 CCCAGGGAGTAGAAGTGGGCAGG - Exonic
918495964 1:185136331-185136353 CCCAGGAAGCAGAGGTTGAGTGG + Intronic
918929941 1:190842209-190842231 GCCAGAAAGGAGAAGAGCAAAGG + Intergenic
919012416 1:191982882-191982904 CCTAGGCAGCAGAAGTGGCATGG + Intergenic
919233431 1:194806287-194806309 TGCAGGAACAAGAAGTGGAATGG - Intergenic
919631187 1:199961395-199961417 CTCAGGAGGCTGAAGTGGAAAGG + Intergenic
919795658 1:201320081-201320103 GGAAGGAAGGAGAAGAGGAAAGG - Intronic
919857249 1:201714329-201714351 ACAAGGAAGGAGAAGGAGAAGGG - Intronic
920300154 1:204983599-204983621 CCAGGGCAGGAGAAGAGGAAGGG - Intronic
920386602 1:205574335-205574357 CTCAGGAGGCAGAAGTGGGAGGG + Intronic
920439002 1:205966183-205966205 TCCAGGAGGGAGAAGTGGACTGG + Intergenic
920885726 1:209926033-209926055 CCAAGTAAGGAGGAGGGGAAAGG + Intergenic
921160338 1:212467985-212468007 CCCAGCAAGGAGGAGAGGGATGG - Intergenic
921905409 1:220490466-220490488 ACTAGGAAGTAGAAGAGGAAAGG + Intergenic
922248968 1:223829224-223829246 CCCAGGAAGCTGAGGTGGGAGGG + Intronic
922466040 1:225846038-225846060 CCCAGGAGGGAGAAGAGGGATGG + Exonic
922539339 1:226407527-226407549 CCCAGAAAGGAGAAGAGAAGAGG + Intronic
922816111 1:228450595-228450617 CCCAGGATGGAGGGGTGGAGAGG - Intergenic
922932829 1:229403593-229403615 CAGAGGAGGGACAAGTGGAAGGG + Intergenic
924262898 1:242250386-242250408 CCCTGGAAGGTGAAGGGGAATGG + Intronic
924911774 1:248521145-248521167 CCCAGGAAGCAGAGGTTGAAGGG + Intergenic
924952109 1:248894758-248894780 GGAAGGAAGGAGAAGAGGAAGGG - Intergenic
1062988205 10:1789826-1789848 CCCTGGAGGGAGAAGTGGAGGGG - Intergenic
1063828463 10:9925289-9925311 CTCAGGAAGCTGAAGTGGGAGGG - Intergenic
1064181076 10:13116262-13116284 CACAGGAAGGAGAAGCAGAAGGG + Exonic
1064219824 10:13431153-13431175 CCCAAGAAGGAGCTGGGGAAGGG + Intergenic
1064253978 10:13728644-13728666 CCCAGGAGGCAGAAGTTGCAGGG - Intronic
1064505716 10:16027741-16027763 CCCAGGAAGCAGTACTGGGAGGG + Intergenic
1064656343 10:17559888-17559910 GCCAGGAAGGAGTAGGGAAAGGG - Intergenic
1064796950 10:19022807-19022829 CCCAGGCAGGAGATGGGGAGAGG - Intergenic
1064827256 10:19419094-19419116 CAAAGGATGGAGATGTGGAAAGG - Intronic
1064913897 10:20435079-20435101 CCAAGGAAGGAGAAATGGCATGG + Intergenic
1065788883 10:29241921-29241943 GGAAGGAAGGAGAAGTGGAGGGG + Intergenic
1065789424 10:29246442-29246464 CTCAGGAAGCTGAAATGGAAGGG + Intergenic
1065818126 10:29500381-29500403 CCAAGGAAGGAAGAGTGCAAAGG + Intronic
1065939503 10:30551376-30551398 CTCAGGAAGCTGAGGTGGAAGGG - Intergenic
1065954794 10:30684124-30684146 CCAAGGAAGGAAGAGTGCAAAGG - Intergenic
1066721888 10:38348068-38348090 CCCTGGAAGGTGAAGGGGAATGG - Intergenic
1067231823 10:44417497-44417519 AGGAGGAAAGAGAAGTGGAATGG + Intergenic
1067246260 10:44548986-44549008 CCCTGGAAGGAGAGGAGAAAGGG - Intergenic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1069340528 10:67403470-67403492 CCCAGCAAGGAGGAATGGATTGG - Intronic
1069530056 10:69211058-69211080 CAAAGGAAGGAGACGTGAAAGGG - Intergenic
1069541289 10:69295998-69296020 CCCTGGGAGGGGAAATGGAAGGG + Intronic
1069629680 10:69889961-69889983 CCCAGGAAGGGAGAGGGGAAGGG - Intronic
1069678324 10:70265606-70265628 GCCAGTGGGGAGAAGTGGAAGGG - Intronic
1070112893 10:73501651-73501673 CACAGTAAGGAGGAGTGGATGGG - Intronic
1070387066 10:75935195-75935217 CCCAAGAAAGAGAAGGGCAAGGG + Intronic
1070689127 10:78511696-78511718 ACCAGGAAGGAGAAGAAGGAGGG + Intergenic
1070739682 10:78894546-78894568 CCCAGGCAGAGGATGTGGAAGGG + Intergenic
1071008544 10:80911423-80911445 CCCAGGCTGGAGTAGTGCAATGG + Intergenic
1072608055 10:97000127-97000149 GCCAGTAGGGAGCAGTGGAAGGG - Exonic
1072641993 10:97218570-97218592 CCCAGGAGGCTGAGGTGGAAGGG - Intronic
1073142200 10:101255525-101255547 CACAGGAAGGAGAAGAGGTTAGG - Intergenic
1073174691 10:101547378-101547400 CCCAGGCTGGAGTAGTGCAATGG + Intronic
1073196374 10:101694978-101695000 CGAAGGAAGGGGAAGGGGAAGGG - Exonic
1073759732 10:106616522-106616544 CCCAGAAAGGAGATGGAGAAGGG + Intronic
1073798932 10:107020030-107020052 CCTAGGAAGAAGGAGTGGGATGG - Intronic
1073966828 10:109000115-109000137 CCCAGGAAGGGGACCTGGAGAGG - Intergenic
1074258016 10:111822934-111822956 CCCAGGAAGAATAAATGAAATGG + Intergenic
1074406234 10:113182352-113182374 CAAAGGAAGAAGAAATGGAATGG - Intergenic
1074707694 10:116150094-116150116 CCCAGAAAGGCTAAGTGGTAGGG + Intronic
1074908639 10:117887145-117887167 CCCAGGAGGGAGAAGGGGAGAGG - Intergenic
1075010719 10:118867551-118867573 CCTGGGAAGGCGAAGGGGAAGGG + Intergenic
1075141424 10:119840220-119840242 CTCAAGAAGCAGAAGTGGACTGG - Intronic
1075775512 10:124983360-124983382 GTCAGGAAGGAGCAGTGGACAGG + Intronic
1075855766 10:125628584-125628606 CACAGGAAGGAAGTGTGGAATGG + Intronic
1076257803 10:129042316-129042338 GCCAGGAAGGAGAGAGGGAAGGG - Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1077094165 11:792354-792376 GCCAGGAAGGACACGTAGAAAGG + Exonic
1077482647 11:2823592-2823614 CCCAGGCAGGAGCAGAGGACAGG + Intronic
1077654578 11:4006488-4006510 CCCAGGAAACAGAAGTTGCAGGG - Intronic
1077662459 11:4082058-4082080 CCCAGGAAGGAGAAAAGGTAAGG - Intronic
1078119038 11:8487511-8487533 TCCAGGAAGGATATGTAGAATGG + Intronic
1078921172 11:15832072-15832094 CCCAGTAAGGGGAGGTGGGAAGG + Intergenic
1079577793 11:22025165-22025187 CCCAGGAAGCACAAGGGGTAGGG + Intergenic
1080462359 11:32466387-32466409 CCCAGGAATCAGAAGTGGGTAGG + Intergenic
1080527834 11:33144898-33144920 CCCGGGAGGGAGAAGTTGCAGGG + Intronic
1081464603 11:43304774-43304796 CCCAGAAAAGAGAATTGGATTGG - Intergenic
1081546349 11:44074691-44074713 AACAGGAAGGAGCAGTGGAGGGG - Intronic
1081632996 11:44701991-44702013 GTCAGGAAGGTGAAGAGGAAAGG - Intergenic
1082102517 11:48184708-48184730 CCCAGGCAGTGGAAGAGGAAGGG + Intergenic
1082160050 11:48880615-48880637 CCCAGGAGGCAGAGGTGGCAGGG + Intergenic
1082162316 11:48899791-48899813 CCCAGGAGGCAGAGGTGGCAGGG - Intergenic
1082167903 11:48968243-48968265 CCCAGGAGGCAGAGGTGGCAGGG - Intergenic
1082196795 11:49316245-49316267 GGAAGGAAGGAGAAGGGGAAGGG + Intergenic
1082235642 11:49818377-49818399 CCCAGGAGGCAGAGGTGGCAGGG + Intergenic
1082239109 11:49852961-49852983 CCCAGGAGGCAGAGGTGGCAGGG + Intergenic
1082243043 11:49891385-49891407 CCCAGGAGGCAGAGGTGGCAGGG - Intergenic
1082657543 11:55872210-55872232 CCCAGGAGGCAGAGGTGGCAGGG - Intergenic
1082772854 11:57222004-57222026 CCCAGTAAGGAGGAGGGCAAGGG - Intergenic
1082823853 11:57563389-57563411 CTCAGGCAGGAGAATTGGAGAGG + Intronic
1082968187 11:58989876-58989898 CCCAGGAAGCAGAAGGGGTTGGG - Intronic
1083696629 11:64447805-64447827 GCCAGGAAGGGGAGGGGGAAAGG - Intergenic
1083886982 11:65577685-65577707 CCCAGAAAGGGGAAGCGGACAGG - Intronic
1084165212 11:67372356-67372378 CCCAGCACGGAGTTGTGGAAAGG + Intronic
1085027054 11:73242530-73242552 CCCCGGAAGTGGAAGTGGAATGG + Intergenic
1085141757 11:74150963-74150985 CCCAGGCTGGAGTAGTGCAATGG + Intronic
1085230839 11:74968597-74968619 CCCAGGAAGCAGAGGTTGCAGGG - Intronic
1085535565 11:77215256-77215278 CTCAGGGAGGGGAAGTGGAAGGG + Intergenic
1086259625 11:84923465-84923487 CTCAGGAAGGAGGGGGGGAAAGG + Intronic
1086345479 11:85891484-85891506 CCCAGGAATGAGAAGGTGAGGGG + Intronic
1086595899 11:88570035-88570057 CAAAGGAAAGAGAAGGGGAAGGG + Intronic
1086659030 11:89391940-89391962 GGAAGGAAGGAGAAGGGGAAGGG - Intronic
1086907394 11:92433493-92433515 CCCAGGAAGTAGAAGGGGTCAGG - Intronic
1087582692 11:100079015-100079037 GGCAGGAAGGAGAAGTGCCAAGG + Intronic
1087804662 11:102542967-102542989 CTCAGGAAGGAGAGTAGGAAAGG - Intergenic
1087807532 11:102570746-102570768 CCCAGCTAGGAGAAGTGTGAAGG - Intergenic
1088263064 11:107963138-107963160 CCCAGGAAGCAGAGGTTGCAGGG - Exonic
1089322608 11:117636562-117636584 TCCACGAAGGAGAGGGGGAAGGG + Intronic
1090106168 11:123855168-123855190 CCCAGTAAGGAGAAGTGGGTCGG - Intergenic
1090138621 11:124228203-124228225 CTCAGGAAGTTGAGGTGGAAGGG + Intergenic
1090376477 11:126293065-126293087 TACAGGAGGGAGAAGGGGAACGG + Exonic
1090771316 11:129921922-129921944 CCCAGGAAGGAGAGCTGGTGTGG - Intronic
1090802364 11:130180938-130180960 CCCGGGAAGGGGAAGTGGAGAGG - Intronic
1091995369 12:4988854-4988876 CCGAGGCTGGAGAAATGGAATGG - Intergenic
1092092145 12:5812174-5812196 AGCAGGAAAGAGAAGGGGAAGGG + Intronic
1092112501 12:5973705-5973727 CTCAGGAAGAAGAAGAGGGAGGG - Intronic
1092334289 12:7614985-7615007 GGAAGGAAGGAGAAGGGGAAGGG + Intergenic
1093086245 12:14869163-14869185 CCCTGCAAGGAGGAGTGGATTGG + Intronic
1094527831 12:31244329-31244351 ACTAGGAAGGAGAATGGGAAGGG + Intergenic
1095152527 12:38812447-38812469 ATCAGGAAGGAGAAGTGCCAAGG + Intronic
1095275921 12:40282178-40282200 GGAAGGAAGGAGAAGGGGAAGGG - Intronic
1095359608 12:41320200-41320222 CCAAGGAATGTGAAGTGGGATGG - Intronic
1095909071 12:47407509-47407531 GACAGGAAGCAAAAGTGGAATGG - Intergenic
1095987808 12:48011049-48011071 CCGAGGAATGAGAGGGGGAATGG - Intergenic
1096192715 12:49630859-49630881 TAGAGGTAGGAGAAGTGGAAGGG + Intronic
1096230099 12:49892022-49892044 CCGAGGAAGGAGATGGGGAAAGG - Intronic
1096572494 12:52531692-52531714 TCCAGGAAGGGGAGGTGGAAGGG - Intergenic
1096623292 12:52877941-52877963 CCCAGGAGGGAGCTGTGCAAGGG + Intergenic
1096655834 12:53091583-53091605 CAGAGGAAGGAGAGCTGGAAAGG - Intergenic
1096765258 12:53882676-53882698 CCCAGTAAGGAGACATGGAAAGG - Intergenic
1096865751 12:54561644-54561666 GCCAGGGATGAGAAGAGGAAGGG + Intronic
1097246521 12:57610492-57610514 GACAGGTAGGAGAAGGGGAAGGG + Intronic
1097287861 12:57891426-57891448 CCCAGGAAGCAGAAGTTGCAGGG + Intergenic
1097835507 12:64269026-64269048 CTCAGGAGGCTGAAGTGGAAGGG + Intronic
1097915212 12:65013984-65014006 CCAAAGAAGGAGAAGGAGAAGGG - Intergenic
1097948875 12:65403865-65403887 CCCAGGAAGCAGAAGGGGTCAGG - Intronic
1097962599 12:65547001-65547023 ACCAAGAAGGAGATATGGAAGGG + Intergenic
1098534847 12:71582972-71582994 GGAAGGAAGGAGAAGGGGAAGGG + Intronic
1098802413 12:74978381-74978403 GGAAGGAAGGAGAAGGGGAAGGG + Intergenic
1099243323 12:80164241-80164263 ACCTTGAAGGAGAAGAGGAAAGG - Intergenic
1099255804 12:80309840-80309862 TTCAGGAAGGAGATGTGGGATGG + Intronic
1099681831 12:85838666-85838688 CTCAGATAGTAGAAGTGGAAAGG + Intergenic
1100270950 12:93024004-93024026 TCCAGGGATGAGAAGGGGAAGGG - Intergenic
1100391417 12:94148810-94148832 CCCAGGAAGGAGAGCGGGGAGGG - Exonic
1100584163 12:95963951-95963973 CCCAGGAGGGAGAGGTTGCAGGG + Intronic
1101214007 12:102562939-102562961 CCCAGGAAGAAGGAATGAAATGG - Intergenic
1101345797 12:103885151-103885173 CACAGGAAGGAGACCTGGATTGG - Intergenic
1102048145 12:109842602-109842624 CCCAGGCTGGAGAAGTGCAATGG - Intergenic
1102391224 12:112550316-112550338 CCCAAGGAGGAGAAGGGAAAGGG - Intergenic
1103468749 12:121162922-121162944 GCGAGGAAAGAGAAGGGGAAGGG + Intronic
1103534484 12:121625474-121625496 CCCAGGCTGGAGGAGTGCAATGG - Intergenic
1103793823 12:123490043-123490065 TCCAGGCAGGAGAAGGAGAAAGG - Intronic
1103876289 12:124130056-124130078 CCCAGGCAGGAGTAGTGCAGTGG + Intronic
1104087313 12:125487713-125487735 CCCAGGAAGCAGAAATGGCGAGG + Intronic
1104265865 12:127231972-127231994 CTCAGGAAGGAGAGCTGGAAAGG - Intergenic
1104356826 12:128094327-128094349 CCCAGGAAGGGGAGGTTGCAGGG - Intergenic
1104661820 12:130616827-130616849 CACAGGAAGGAGAAGTCAGAGGG + Intronic
1105638528 13:22239607-22239629 TGCAGGAAAGAGAAGTGGCAGGG + Intergenic
1106047282 13:26154952-26154974 CCCAGGAGGCAGAAGTTGCAGGG + Intronic
1106128809 13:26922497-26922519 GCCAGGCTGGAGAAGGGGAAGGG - Intergenic
1106369259 13:29115704-29115726 CTAAGGAAGGAGAGGTGGACTGG + Intronic
1107140045 13:36988707-36988729 AACAGGAAGGAGAAGGGAAATGG - Intronic
1107386091 13:39911142-39911164 CCCAGGAAGGAGAAGGGATGTGG + Intergenic
1107575483 13:41716095-41716117 CTCAGGAAGTACTAGTGGAAAGG + Intronic
1107829069 13:44358221-44358243 GGAAGGAAGGAGAAGAGGAAGGG + Intergenic
1108119762 13:47172000-47172022 CCATGGAAGGAGTAGGGGAATGG + Intergenic
1109710575 13:66153418-66153440 CTTAGGAAGTGGAAGTGGAAAGG + Intergenic
1109816194 13:67588523-67588545 CCCAGGAAGCAGAAGGGGTTGGG + Intergenic
1110620137 13:77585777-77585799 CTCAGCAAGGTGGAGTGGAAGGG - Intronic
1110688746 13:78406173-78406195 GCCAGGAATAAGAAGTGGCAAGG + Intergenic
1110804280 13:79736479-79736501 CCCAGTAAGGAGAAGTGGATTGG + Intergenic
1110865659 13:80392593-80392615 GGAAGGAAGGAGAAGGGGAAGGG - Intergenic
1112336732 13:98522747-98522769 CCCAGGTATGATAAGTGGCATGG + Intronic
1112507388 13:99983058-99983080 CCCGGGAAGGGGCAGGGGAAGGG - Exonic
1114056570 14:18973681-18973703 CTCATGAGGCAGAAGTGGAAAGG + Intronic
1114105979 14:19428046-19428068 CTCATGAGGCAGAAGTGGAAAGG - Intronic
1114620527 14:24093892-24093914 CCCAGGAGGAGGAACTGGAAAGG + Intronic
1116489214 14:45486535-45486557 CCCAGGAAGCAGAAGGGGTCGGG - Intergenic
1116947059 14:50845501-50845523 CCCACAACGGACAAGTGGAATGG + Intergenic
1117476161 14:56097022-56097044 CACAGGAGAGAGAAGTGGAGAGG + Intergenic
1117829249 14:59733668-59733690 CCCTGCAAGGAGGAGTGGATTGG - Intronic
1119189683 14:72672321-72672343 CCCAGGAAACAGCAGTGGTAGGG + Intronic
1119258878 14:73224920-73224942 CCCAGGAAGAAGGTGTGGCATGG - Intergenic
1119416108 14:74470554-74470576 CTCAGGAAGGAAGAGTGGCACGG + Intergenic
1119485940 14:74986534-74986556 CCCAGGAGGCAGAAGTTGCAGGG + Intergenic
1119742531 14:77023543-77023565 CCCAGGAATGAGATGTGGCCAGG + Intergenic
1119840961 14:77792709-77792731 CCCAGGCTGGAGTAGTGCAATGG - Intergenic
1120006423 14:79363038-79363060 CCCAGGCTGGAGTAGTGCAATGG + Intronic
1121155144 14:91676042-91676064 CCCAGTAAGCAGTAATGGAAGGG - Intronic
1121625995 14:95385785-95385807 CCCAGAAAGGAGGCGTGGGAAGG + Intergenic
1121711743 14:96043713-96043735 CCAGGGAGGGAGAAGTGGGAGGG - Intronic
1121728789 14:96172119-96172141 CCCAAGCAGATGAAGTGGAAGGG - Intergenic
1122307071 14:100773030-100773052 CCCAGGGAGGAGAAGGGGAGAGG + Intergenic
1122641696 14:103163794-103163816 AGCAGGAAGGAGAACTGGCAAGG - Intergenic
1123051682 14:105547133-105547155 CCCCGGAAGTGGAAGTGGAAGGG - Intergenic
1123077095 14:105672836-105672858 CCCCGGAAGTGGAAGTGGAAGGG - Intergenic
1123673131 15:22680521-22680543 CCCAGGCTGGAGGAGTGTAATGG - Intergenic
1124325186 15:28753814-28753836 CCCAGGCTGGAGGAGTGCAATGG - Intergenic
1124390049 15:29246658-29246680 CCCAGGCTGGAGGAGTGCAATGG - Intronic
1124956829 15:34365688-34365710 CCCAGGAGGCAGAACTGCAAAGG + Exonic
1125793257 15:42385991-42386013 CCAGGGAAGGAGAATTGGACAGG - Intronic
1126077056 15:44921649-44921671 CCCAGGAGGTAGAAGTTGAGAGG + Intergenic
1126249970 15:46555876-46555898 CCCAGGAAGGGAAAGGAGAAGGG + Intergenic
1126915683 15:53463756-53463778 CTCAGGAAGGTGAATTGGAAGGG - Intergenic
1127485743 15:59416174-59416196 CCCAGAAAGCACAAGTGAAAGGG + Intronic
1127570584 15:60237352-60237374 CCCAGGAAGCACAAGTGGTTGGG + Intergenic
1127597317 15:60498746-60498768 GGCAGGAATGGGAAGTGGAAGGG - Intronic
1127678563 15:61270086-61270108 CACAGGAAGCAGAAATGAAATGG - Intergenic
1128123992 15:65177106-65177128 CCCAGGCTGGAGAAGTGCAGTGG + Intronic
1128537192 15:68500366-68500388 CTCAGGAAGGAGAAGAGGTTTGG - Intergenic
1128539467 15:68516322-68516344 CCCAGGAAGCAGAAATGGTATGG + Intergenic
1128953969 15:71919764-71919786 CCCAGGAGGCAGAGGTTGAAGGG + Intronic
1129250292 15:74304984-74305006 CCCAGGAGGGAGTAGTGCAATGG + Intronic
1129411876 15:75354779-75354801 CCCAAGAAGGGGAGGAGGAAGGG + Exonic
1129688249 15:77698524-77698546 ACCAGGCAGGAGCTGTGGAAAGG + Intronic
1129813725 15:78533135-78533157 CCTATGAAAGAGAAATGGAAGGG + Intronic
1129862909 15:78876690-78876712 CCCAGGAACGAGAACTAAAATGG - Intronic
1130062409 15:80579270-80579292 ATCAGGAAGGAGAATGGGAAAGG + Intronic
1130395174 15:83495011-83495033 CACAGGAAGGACAGGTGGAGAGG + Intronic
1131337565 15:91564051-91564073 ACCAAGATGGAGAAGTGAAAAGG + Intergenic
1131928117 15:97408496-97408518 CGCAGGAAGGGGAAGTGGTCCGG + Intergenic
1132024481 15:98393115-98393137 GGAAGGAAGGAGAACTGGAAAGG + Intergenic
1132147166 15:99435897-99435919 GCCAGGAAGTAGAAGGAGAACGG - Intergenic
1132222183 15:100113169-100113191 CCCAGGAAAGAGACGAGGAATGG - Intronic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132496412 16:265472-265494 CACAGGAGGGAAAAGGGGAATGG - Exonic
1132715049 16:1285977-1285999 GCCAGGCAGGAGAAGAGGGATGG - Intergenic
1133275996 16:4638823-4638845 CCGAGGAAGGGGGAGTGGGAAGG - Intronic
1133597333 16:7305151-7305173 ACCACTAAGGAGAAGTGAAAGGG - Intronic
1133729383 16:8566835-8566857 TCCAGGAAGGACAATTAGAAAGG - Intergenic
1133816316 16:9200016-9200038 GGAAGGAAGGAGAAGGGGAAGGG - Intergenic
1133905732 16:10020927-10020949 CACAGGCTGGAGAAGTGCAAGGG - Intronic
1134037547 16:11042371-11042393 CACAGGAAGGAGGAGCGGAGAGG - Intronic
1134514696 16:14877321-14877343 CCCAGAAAGGACCGGTGGAAGGG - Intronic
1134702372 16:16275974-16275996 CCCAGAAAGGACCGGTGGAAGGG - Intronic
1134765694 16:16755727-16755749 CTCAGGGAGGGGAAGGGGAAGGG - Intergenic
1134830478 16:17318861-17318883 CCCAGGAAGCAGAGGTTGCAGGG - Intronic
1134965171 16:18436141-18436163 CCCAGAAAGGACCGGTGGAAGGG + Intronic
1134969458 16:18518676-18518698 CCCAGAAAGGACCGGTGGAAGGG + Intronic
1135088147 16:19490973-19490995 GGAAGGAAGGAGAAGGGGAAGGG - Intronic
1135593936 16:23727257-23727279 CCCAGACAGGAGTAGTGCAATGG + Intergenic
1136030500 16:27499355-27499377 CCCAGCAGGGAGAGGTGGAGTGG + Intronic
1136074507 16:27807537-27807559 TCCAGGATGGAGAAGAGGGACGG - Exonic
1136468145 16:30459315-30459337 CCCAGGAGGCTGAAGTGGGAGGG - Intergenic
1136592987 16:31228913-31228935 GCCATGAAGGATAAGTGGGAGGG - Intergenic
1136597335 16:31260355-31260377 CCCAGGGAGGAGAAGTGACATGG + Intronic
1138887535 16:61097690-61097712 CACAGGAAGGAGGAAAGGAAGGG - Intergenic
1139004312 16:62551675-62551697 AAAAGGAAGGAGAAGAGGAAGGG - Intergenic
1139478658 16:67216142-67216164 CTGAAGAAGGAGCAGTGGAAAGG - Intronic
1140002425 16:71039325-71039347 AGCAGGAAGGAGAACTGGATGGG - Intronic
1140005986 16:71075674-71075696 AACAGGAAGAGGAAGTGGAAAGG + Intronic
1140422475 16:74831935-74831957 CCCAGGAAGGAGAAAGTGATTGG + Intergenic
1141197108 16:81868295-81868317 GCCAGGGAGGGGAAGTGGGAAGG - Intronic
1141793040 16:86249555-86249577 CTCTGGAAGGTGAACTGGAAAGG + Intergenic
1142036697 16:87866844-87866866 ACCAGGAAGGAGACGTAGGATGG - Intronic
1142519584 17:495468-495490 CTCAGGAGGCAGAAGTGGGAGGG - Intergenic
1142608725 17:1096483-1096505 CTCAGGGAGGAGAGGAGGAAGGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1143996169 17:11008234-11008256 CACAGGATGGACAAGGGGAATGG + Intergenic
1144120837 17:12150887-12150909 CCCAGTAAGGAGAAATGAATTGG - Intergenic
1144368524 17:14568437-14568459 CCCAGAAAGTAGAAGTGGGCAGG - Intergenic
1144577519 17:16438406-16438428 CCAAGGAATGAGGAGAGGAAAGG + Intergenic
1144658518 17:17053201-17053223 CCCAGGCAAGGGAATTGGAATGG + Intronic
1144764631 17:17725728-17725750 CCCAGGAAGAAAAAGGGGAGGGG - Intronic
1145881034 17:28352880-28352902 CTCAAGAAGGGGAGGTGGAATGG - Intronic
1146617716 17:34370117-34370139 GCCAGGAGGGAGAAGATGAAAGG - Intergenic
1147813506 17:43191176-43191198 CCCAGGAATATGAGGTGGAAGGG + Intronic
1147986561 17:44310469-44310491 CCAGAGAAGGAGAAGTTGAAGGG + Intronic
1148047254 17:44751717-44751739 CCCAGGAAGGAAGTGTGGAAGGG - Exonic
1148390104 17:47265954-47265976 CCAAGGAAGGAGAAGGAGACAGG - Intronic
1148687532 17:49509088-49509110 CCCAGGACGGAGACGGGGAAGGG + Intronic
1148696952 17:49566319-49566341 CAGAGGAAGGGAAAGTGGAAAGG + Intergenic
1148777041 17:50101773-50101795 CCCAGGAATGAGAAGGAGGAGGG - Intronic
1149291577 17:55223242-55223264 CTCAGGAGGCTGAAGTGGAAGGG - Intergenic
1149336931 17:55644983-55645005 TCCAGGAAGTAGAAGTCTAAGGG + Intergenic
1150362503 17:64549195-64549217 CCCAGGAAGTAGAGGTTGTAGGG + Intronic
1150761956 17:67970191-67970213 CCCAGGCTGGAGGAGTGCAATGG - Intronic
1151133652 17:71924396-71924418 GGAAGGAAGGAGAAGGGGAAGGG + Intergenic
1151391261 17:73788094-73788116 CCCAGGAAGGAGCTGTGGCCTGG - Intergenic
1151436321 17:74099948-74099970 TCCAGGAGGGAGAAGAGCAAAGG - Intergenic
1151793302 17:76324065-76324087 CCCAGGAGGCAGAAGTTGCAGGG + Intronic
1151957086 17:77385836-77385858 CCCAGGAGGGTGAAGTGGGCTGG + Intronic
1152135636 17:78501639-78501661 CCCAGGAAGAGGAAGTGGCAGGG + Intronic
1152303270 17:79507503-79507525 CCCAGGGTGGAGACGGGGAAGGG + Intronic
1152641412 17:81450799-81450821 CCCAGGAAGCTGAGGTGGGAGGG + Intronic
1152886473 17:82853948-82853970 ACAAGGAAGAAGATGTGGAATGG - Intronic
1153059452 18:980354-980376 CCCAGGAAGCACAAGTGGTCAGG - Intergenic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153928530 18:9857583-9857605 ACCAGTAATTAGAAGTGGAAGGG - Intronic
1154456901 18:14537308-14537330 CTCATGAGGCAGAAGTGGAAAGG - Intronic
1155022022 18:21905351-21905373 CTCATGAATGAGAAGTGAAATGG + Intergenic
1155171397 18:23269322-23269344 GGCAGGAAGGAGAAGTGCAGAGG - Intronic
1156477833 18:37417384-37417406 GGTAGGCAGGAGAAGTGGAAAGG - Intronic
1157532846 18:48436570-48436592 GCCAGGATGGAGAAAGGGAAGGG + Intergenic
1157860854 18:51138905-51138927 CCCAGTAGGAAGAAATGGAAAGG + Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158711821 18:59844575-59844597 CCCAGGAAGCAGAAGTTACAGGG - Intergenic
1159556471 18:69951072-69951094 CCCAGGAGGCTGAAGTGGGAGGG - Intronic
1159705973 18:71688192-71688214 CACAGCAAAGAGAAGGGGAAAGG + Intergenic
1160046433 18:75391265-75391287 CCGAGGAAGGAGGAGTGGCTGGG - Intergenic
1160070513 18:75623844-75623866 CCCAGGAATGAGGATGGGAAAGG + Intergenic
1160625948 18:80205106-80205128 CCCTGGAAGGGGCAGAGGAAAGG + Intronic
1160831607 19:1107126-1107148 GCCAGGAAGCAGAAGTGCAGAGG + Intergenic
1160835647 19:1123339-1123361 CGCAGAGGGGAGAAGTGGAAAGG - Intronic
1161464791 19:4422908-4422930 CTCACGAAGGAGAAATGGGAAGG - Intronic
1161797751 19:6396959-6396981 CCCAGGCTGGAGTAGTGTAATGG - Intergenic
1162028694 19:7908303-7908325 ACCAGGCAGGAGCAGGGGAAGGG - Intronic
1162411579 19:10509371-10509393 CCCAGGAAGTAGAGGTTGCAGGG - Intergenic
1162908882 19:13839199-13839221 CCCAGGGACGAGAACGGGAAGGG + Intergenic
1163794599 19:19330053-19330075 CCCAGGAGGCAGAAGTGGCAGGG - Intronic
1164055420 19:21618081-21618103 CTCTGGAAGGAGAAGACGAAGGG - Intergenic
1164738972 19:30562820-30562842 CTCAGGATGGAAAAGTGGGATGG - Intronic
1165584151 19:36898124-36898146 CCCAGGCTGGAGGAGTGCAATGG - Intronic
1165775812 19:38403701-38403723 CCCGGGATGCAGAAGTGGCAAGG + Intronic
1166140363 19:40802152-40802174 CCAAGGCAGGAGAAGCAGAAGGG + Intronic
1166176843 19:41079512-41079534 CCCAGGCTGGAGTAGTGCAATGG + Intergenic
1166321511 19:42022025-42022047 TCCAGGAAGGAGAAGTAGCCAGG + Exonic
1166814995 19:45539026-45539048 AGCAGGAGGGAGAAGTGAAAGGG + Intronic
1166946732 19:46401850-46401872 CCCAGGACTCAGATGTGGAATGG - Intergenic
1167000321 19:46741906-46741928 CCCAGGAAGCTGAAGTGGGCAGG + Intronic
1167080060 19:47272123-47272145 CCCAGGAAGCTGAAGAGGAAGGG + Intergenic
1167508488 19:49883477-49883499 GCCAGGAAGGTGAAGTGTAAGGG + Intronic
1167786838 19:51644247-51644269 CACATTAAGGAGAAGTGGATGGG + Intronic
1168355053 19:55695455-55695477 CCCAGGAAGGGGAAGGGCACTGG - Intronic
925417062 2:3677740-3677762 CCCAGGCAGGAGCAGAGGAAGGG - Intronic
925655191 2:6139335-6139357 CACAGGAAGTAGAAGAAGAATGG - Intergenic
925923726 2:8655663-8655685 CCCAGAAAAGCGAAGTGGCAAGG - Intergenic
927287477 2:21371601-21371623 GGAAGGAAGGAGAAGGGGAAGGG + Intergenic
927407819 2:22791975-22791997 CATAGGAAGGAAATGTGGAAGGG - Intergenic
927830666 2:26346821-26346843 CACAGGAAGGAGCTGTGGAGTGG + Intronic
929094905 2:38254284-38254306 CCCAGGCAGGCCAAGTGGGAGGG - Intergenic
929521359 2:42654720-42654742 CTCAGGAAGCTGAGGTGGAAAGG - Intronic
929557762 2:42936245-42936267 GCCAGGAAGGAGAAACGGACTGG - Intergenic
929612200 2:43279237-43279259 CCCAGGAGGGAGGAGGGGAGTGG - Intronic
930001298 2:46863460-46863482 CACAGGTAAGAGAAGTGGAACGG + Intergenic
930032880 2:47069170-47069192 CCCAGGAAGGGGAGGAGAAAAGG + Intronic
930790017 2:55315301-55315323 CCAGGGAAGGAGAAGAGGAATGG + Intronic
931262703 2:60634038-60634060 TCCAGGAAGGACAACAGGAAAGG + Intergenic
931367888 2:61635379-61635401 CCCAGGAGGCAGAAGTTGCAGGG - Intergenic
931826269 2:66004100-66004122 GGAAGGAAGGAGAAGGGGAAGGG - Intergenic
931826304 2:66004202-66004224 GCAAGGAAGGAGAAGGAGAAGGG - Intergenic
931827789 2:66019258-66019280 CCCAGGAGGCAGAGGTGGCAGGG + Intergenic
931965703 2:67531846-67531868 CCCAGGAAGGAGAGGTGTAGGGG + Intergenic
932320501 2:70819030-70819052 CCCAGGGATGAGGAGAGGAAGGG + Intronic
932467133 2:71931166-71931188 CCCAGGCTGGAGGAGTGCAATGG + Intergenic
932817880 2:74876264-74876286 CCCAGGACTGAGATGTGGAAGGG - Intronic
933969630 2:87459730-87459752 CTCAGGAAGGAGGAGTGGGCAGG + Intergenic
934943089 2:98516463-98516485 CCCTGCAGGGAGAGGTGGAAAGG + Intronic
935023663 2:99255939-99255961 CCCAGGAACAGGAAATGGAAGGG + Intronic
935139010 2:100334545-100334567 CCCAGGGAGGGGGAGTGGACAGG - Intergenic
935579702 2:104746026-104746048 CCCAGGCCGGAGAAGGAGAAAGG + Intergenic
935954633 2:108363388-108363410 CCCATGAAGTAAAACTGGAATGG + Intergenic
936169896 2:110161056-110161078 CTCAGGAAGCTGAAGTGGGAGGG + Intronic
936324156 2:111490767-111490789 CTCAGGAAGGAGGAGTGGGCAGG - Intergenic
936483085 2:112903794-112903816 CCCAGGCTGGAGTAGTGCAATGG - Intergenic
936493485 2:112996436-112996458 CCCAGGCTGGAGGAGTGCAATGG + Intergenic
936988269 2:118332788-118332810 ACCAGGAAAAAGAATTGGAATGG + Intergenic
937466850 2:122140357-122140379 GCCAGGAAGAAAAAGTGAAAGGG + Intergenic
937836064 2:126471374-126471396 CAGAGGAATGAGGAGTGGAAAGG + Intergenic
938071992 2:128313610-128313632 CCCAGGAGGGAGGAGGAGAAGGG - Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
938474691 2:131597696-131597718 CTCATGAGGCAGAAGTGGAAAGG + Intergenic
938604213 2:132875476-132875498 GCCTGGCAGGAGAAGTGCAAGGG - Intronic
938760029 2:134416509-134416531 CCCAGGCTGGAGGAGTGCAATGG + Intronic
940239975 2:151552026-151552048 CCCAGGCACAAGAAGAGGAAGGG + Intronic
940437283 2:153669726-153669748 CCCAGGAAGCACAAGGGGACAGG + Intergenic
940891656 2:159041721-159041743 CCCAGGAAGTACAAGGGGTAGGG - Intronic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941817118 2:169807362-169807384 CCCAGGAAGCAGAGGTTGCAGGG - Intronic
942321622 2:174741366-174741388 CCGAGGGAGGAGGAGTGGGAGGG - Intergenic
942722150 2:178965505-178965527 CCCAGGAAGCACAAGTGGTAGGG + Intronic
943089582 2:183357979-183358001 CACAGGAATGAGAACTGCAACGG + Intergenic
943239691 2:185366623-185366645 CACAGGTGGAAGAAGTGGAAGGG - Intergenic
944116150 2:196188481-196188503 ACCAGAAAGGAGAATTAGAATGG + Intergenic
945001489 2:205355838-205355860 GGCAGGAAGGAGAAGTGCCAAGG + Intronic
945012372 2:205479262-205479284 GCAATGAAGGAGAAGTGGGAAGG - Intronic
945758534 2:213881618-213881640 GGCAGGAAGGAGAAGTGCCAAGG + Intronic
946249663 2:218404750-218404772 CCCAGGAAGCAGAACCGGAAGGG - Exonic
947369328 2:229428396-229428418 AGAAGGAAGGAGAGGTGGAAGGG + Intronic
947690084 2:232127303-232127325 CACAGGAAAGACAAGAGGAAGGG - Intronic
947705028 2:232267756-232267778 CCCAAGAAGCAGAAGTGCCAGGG - Intronic
947705607 2:232273159-232273181 CCTAGGAAGGAGGGGTGGATGGG - Intronic
947804133 2:232953224-232953246 CCCAGGAGGCAGAAGTTGCAAGG + Intronic
948051364 2:234981938-234981960 CCCAGGAAGGAGGCGGGGACGGG - Intronic
948112392 2:235466698-235466720 CCCAGGAGGCAGAAGTTGTAGGG - Intergenic
948579302 2:238973200-238973222 GGCAGGGAGGAGCAGTGGAAGGG + Intergenic
1168983865 20:2030918-2030940 CCCAGGAGGCAGAAGTTGCAGGG - Intergenic
1169129105 20:3154573-3154595 CTCAGGAGGTAGAAGTGGGAAGG + Intronic
1169482912 20:6001432-6001454 TACAGGAAGGAGGAATGGAATGG + Intergenic
1169682998 20:8238150-8238172 TCCTGGAAGGAGAAGTGGCTTGG + Intronic
1171150675 20:22824160-22824182 ACCAGGAAGGAGAAGAACAAAGG - Intergenic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172661276 20:36570793-36570815 GAGAGGAAGGAGAGGTGGAAAGG - Intergenic
1172878327 20:38180155-38180177 CACAGGAAGAAGGAGTCGAACGG + Intergenic
1172971007 20:38873039-38873061 CCCTGGCAGGAGAGGTGGGACGG - Intronic
1173573173 20:44091361-44091383 CCCAGGCAGGTGGAGTGGGAAGG - Intergenic
1174089509 20:48035816-48035838 CCCAGGAAGGAGATGATGAGGGG + Intergenic
1174449303 20:50609781-50609803 CCCAGAGAGGAGAAGTCGACAGG - Intronic
1174507238 20:51024287-51024309 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174507241 20:51024319-51024341 GACAGAAAGGAGAAGAGGAACGG - Intergenic
1174524433 20:51159968-51159990 CCCAGAAAGGAGACTGGGAAAGG - Intergenic
1175299198 20:57930761-57930783 GGCAGGAAGGAAAAGTGGCAGGG + Intergenic
1175349944 20:58310210-58310232 TCCAGGGAGGGGAAGGGGAAGGG - Intronic
1175608395 20:60330142-60330164 CCCAGGAACGAGCCATGGAAGGG + Intergenic
1175634491 20:60569239-60569261 CCCAGTAAGCAGGAGGGGAAAGG + Intergenic
1175674945 20:60938323-60938345 CCCAGGGAGGGGAGGTGCAAAGG + Intergenic
1175915570 20:62424222-62424244 CCCTGGAAGGAGTGGGGGAAGGG + Intronic
1176817259 21:13616043-13616065 CTCATGAGGCAGAAGTGGAAAGG + Intronic
1177457175 21:21355384-21355406 CCCAGGAAGCAGAGGTTGCAGGG + Intronic
1177637415 21:23805673-23805695 CACAGGAAGCAGAAGTGAATGGG - Intergenic
1177770743 21:25512842-25512864 CCCAAGAAAGAGAAGTGAAAAGG + Intergenic
1178752745 21:35319908-35319930 CCGAGGCAGGAGAAGTGGGGAGG - Intronic
1179370674 21:40803744-40803766 GACAGGAAGGAAAAGAGGAAGGG + Intronic
1179383998 21:40924815-40924837 CCCAGGCAGGGGCAGGGGAAAGG + Intergenic
1179433247 21:41340077-41340099 TCAAGGTAGGAGAAGTAGAAGGG + Intronic
1180122389 21:45762566-45762588 CCCAGGAGGCAGAAGTTGCAAGG - Intronic
1180136100 21:45863014-45863036 CCCAGGTAGGTGGGGTGGAAAGG - Intronic
1180475056 22:15696294-15696316 CTCATGAGGCAGAAGTGGAAAGG + Intronic
1181237314 22:21455578-21455600 CCCAGCCTGGAGCAGTGGAAAGG - Intergenic
1181491402 22:23262778-23262800 CGAAGGAAGGGGAAGAGGAAGGG + Intronic
1181897136 22:26120349-26120371 TGCAGGTAGGAGAAGAGGAAGGG + Intergenic
1182101481 22:27660647-27660669 GCTAGGAGTGAGAAGTGGAAGGG - Intergenic
1182258031 22:29051929-29051951 CCCAGGAGGCTGAAGTGCAAGGG - Intronic
1182408350 22:30158572-30158594 GGAAGGAAGGAGAAGGGGAAGGG - Intronic
1182446631 22:30393452-30393474 CACAGGAAGGAGCACTGGACCGG - Intronic
1182519277 22:30876296-30876318 CCCAGGAAGGATAACTGGGTGGG - Intronic
1183062819 22:35346261-35346283 CCCAGGGAGCAGAAGGGGCAGGG + Intronic
1183352042 22:37339923-37339945 CCCCCGAAGTAGTAGTGGAAGGG + Intergenic
1183467569 22:37987317-37987339 CCCAGAGAGGAGGAGAGGAAAGG + Intronic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1185029502 22:48434287-48434309 ACCAGGAAGCAGAACTGGAGAGG + Intergenic
1185032445 22:48451529-48451551 CGCAGGAAGCAGATGTGGGAGGG + Intergenic
949481357 3:4496556-4496578 TTTAGGAATGAGAAGTGGAATGG + Intronic
950114361 3:10441085-10441107 CCCAGGAAAGGGAGGTGCAAAGG - Intronic
950357627 3:12425202-12425224 CCCCCGAAGGAGACGGGGAATGG + Intronic
950410728 3:12834854-12834876 CCCAGGAGGCAGAAGTTGCAGGG + Exonic
950521475 3:13500369-13500391 TCCAGGAAGGAGTGGTGGTATGG - Intronic
950622060 3:14213755-14213777 CCCAGGAAGGAGAGGGGTATAGG - Intergenic
950855775 3:16103530-16103552 CCCATGAAGCAGAAGTGGCAGGG - Intergenic
950914204 3:16627140-16627162 TCCAAGAAGGAAAAGAGGAAGGG - Intronic
952007735 3:28861412-28861434 CCCAGGGAGGTGAAGTGGGCTGG + Intergenic
953878814 3:46681200-46681222 CCCAGGACGGAGGGGTGGACCGG - Intronic
953916770 3:46925419-46925441 GCCAGGAAGCAGAGGTGGAGAGG + Intronic
954127901 3:48542976-48542998 CCCAGGAGAGAGAAGGGCAATGG + Intronic
954189212 3:48944543-48944565 CCCTGTAAAGAAAAGTGGAATGG + Intronic
954477637 3:50763355-50763377 CCCGGGAAGCAGAAGTTGCAGGG - Intronic
956132467 3:66067364-66067386 GTCAGGATGGAGAATTGGAAGGG + Intergenic
956157915 3:66317838-66317860 CCCAGTGAGGAGGAGTGGATCGG + Intronic
956411217 3:68981980-68982002 CCCAGGAGGTAGAAGTTGAAGGG - Intronic
956755312 3:72380357-72380379 CCCAGGATGGAGAAAGGGACTGG + Intronic
957019426 3:75108404-75108426 CCAAGGAGAGAGAAGGGGAAGGG + Intergenic
958023956 3:88028441-88028463 AGCAGGATGGAGAACTGGAAAGG - Intergenic
958162195 3:89831912-89831934 CCCAGGAAGGACAAGGGGTCAGG + Intergenic
958797728 3:98723937-98723959 CCCAAGACTGAGAAGTAGAATGG + Intergenic
959631605 3:108513392-108513414 TCCTGGAAGGAGAATAGGAAAGG + Intronic
959695361 3:109244084-109244106 CTCAGAAGGGAGAGGTGGAAGGG - Intergenic
960044010 3:113178962-113178984 CACAGGAGGGAGCAGAGGAAGGG + Intergenic
960306519 3:116068348-116068370 CCAAGGAAGAAGAATAGGAATGG - Intronic
960440307 3:117678772-117678794 CCAAGGATGGAGGATTGGAATGG - Intergenic
960836091 3:121908319-121908341 CCCAGGAAGGACAAGCGGTTGGG - Intronic
961034856 3:123635124-123635146 CCCAGAAAGGAGAACAGGAGGGG + Intronic
962135272 3:132725214-132725236 CCCAGGAGGCAGAAGTTGCAGGG - Intergenic
962291425 3:134140058-134140080 CCCAGGAAGCACAAGGGGTAGGG + Intronic
962299940 3:134230651-134230673 CCCTGGAAAGGGGAGTGGAAGGG + Intronic
962405002 3:135093001-135093023 CGCAGGAATCAGAAGTGTAAGGG - Intronic
963387978 3:144620553-144620575 CCCAGGAAGCACAAGTGGTCAGG - Intergenic
963567938 3:146953881-146953903 CCTAGGCAGGAGACATGGAAAGG + Intergenic
965301185 3:167006984-167007006 CCCAGGAAGCAGAGGTTGCAGGG - Intergenic
965881456 3:173393388-173393410 CCCAGGCTGGAGGAGTGCAATGG - Intergenic
966573805 3:181477127-181477149 CCCAGTAAGGAGGAATGGATTGG + Intergenic
966742310 3:183245255-183245277 AACAGAAAGGAGAAGGGGAATGG + Intronic
967228158 3:187312758-187312780 CCCAGGAGAGAGAGGTGGCATGG - Intergenic
967389463 3:188941271-188941293 CCCAGAAAGGGGAAATGAAAGGG + Intergenic
967397587 3:189024491-189024513 CCCAGTGAGGAGGAGTGGACTGG + Intronic
967440039 3:189496556-189496578 TCCACAAAGCAGAAGTGGAAAGG + Intergenic
967751882 3:193124491-193124513 CCCAAGAAGGAGAAATGGAAAGG + Intergenic
968082284 3:195854791-195854813 CCCAGGAAGGAGAAGGCCGACGG - Intergenic
968135626 3:196217633-196217655 GGAAGGAAGGAGAAGGGGAAGGG + Intronic
968271347 3:197405878-197405900 CCCAGGCTGGAGTAGTGCAATGG - Intergenic
968390420 4:187974-187996 CCCAGCAAGGAAAAATGGATTGG + Intergenic
968517397 4:1020893-1020915 CCCAGGCAGGGGAAGGGGCAGGG + Intronic
968807796 4:2786832-2786854 CCAAGGATGGAGAAGTGGAAGGG + Intergenic
969103802 4:4789957-4789979 AGCAGGAAGGAGAACAGGAAAGG + Intergenic
969128077 4:4968902-4968924 CCCATGAAGGAGAGAGGGAAGGG - Intergenic
969411771 4:7033312-7033334 ACCAGGAAGGAGCAGTGGGTAGG - Intergenic
969707394 4:8819233-8819255 CCCAAGAGGGAGAAGGGGCAGGG + Intergenic
970192145 4:13527562-13527584 CCCAGGGAGGAGATGTGGAGAGG - Intergenic
971088950 4:23316935-23316957 TAAAGGAAGGAGAAGTAGAATGG - Intergenic
971141946 4:23934001-23934023 CCCTGGAAAGAAAAATGGAAAGG + Intergenic
971434573 4:26606475-26606497 CCCAGGATGGAGTGGTGGAGGGG + Intronic
971563154 4:28107416-28107438 CCCAGGAGGCAGAGGTTGAAGGG - Intergenic
972017518 4:34264564-34264586 GGCAGGAAGGAGAAGTGTCAAGG + Intergenic
972171130 4:36346744-36346766 CACAGGGAGGAAAAGGGGAATGG - Intergenic
972205002 4:36760890-36760912 ATCAGGCAGGAGGAGTGGAAAGG + Intergenic
972526546 4:39918138-39918160 CCCATGCAGGAGGAGTGCAATGG - Intronic
973031491 4:45347300-45347322 CTCAGGCAGCAGCAGTGGAAGGG - Intergenic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
974162563 4:58158487-58158509 TCCTGGAAGTAGAAGAGGAAAGG - Intergenic
974214956 4:58832997-58833019 GGAAGGAAGGAGAAGGGGAAGGG - Intergenic
974340055 4:60603568-60603590 CCCAGTGAGGAGGAATGGAACGG + Intergenic
974614430 4:64264113-64264135 CCCAGGAATTAAAAGTGGATAGG - Intergenic
974693718 4:65337370-65337392 GCCAGGAAGAGGAAGGGGAAGGG - Intronic
975203237 4:71615970-71615992 CCCAGGAAGCACAAGGGGATGGG + Intergenic
975663268 4:76708320-76708342 CCCAGGAAGGAGAAGTGGAAAGG + Intronic
975799386 4:78043940-78043962 GCAGGGAAGGAGAAGGGGAAAGG - Intergenic
976204351 4:82610289-82610311 TGCAGGAAGAAGAAGTGGAATGG - Intergenic
976398549 4:84583059-84583081 CCCAGGTAGGAGGAGGAGAAGGG - Exonic
976673352 4:87678100-87678122 CCCGGGAAGGAGATGAGGGAGGG - Intergenic
976705201 4:88012761-88012783 CACAGAAAGGGGAAGTAGAATGG - Intronic
977484528 4:97625383-97625405 CCCAGGAAGCAGAGGTTGCATGG - Intronic
977633372 4:99268500-99268522 CCCAGGAAGCAGAGGTTGCACGG - Intergenic
977892028 4:102323192-102323214 AGAATGAAGGAGAAGTGGAATGG - Intronic
978065130 4:104388725-104388747 ACCAGAAAGGAGGAGGGGAAAGG - Intergenic
978118448 4:105050008-105050030 CCCAGTGAGGAGAAATGGATTGG - Intergenic
978927611 4:114268091-114268113 CCCAGGGAGAAGAAGAGGAGAGG - Intergenic
980159722 4:129145941-129145963 CCCAGGCAGGAGTAGTGCAGTGG + Intergenic
980167628 4:129248354-129248376 CCCAGGCAGGAAAAGAGGAAGGG + Intergenic
980333600 4:131440740-131440762 CCCTGTGAGGAGGAGTGGAATGG + Intergenic
981031649 4:140131510-140131532 GCCAGGAAGGAAAAGTAGAATGG + Intronic
981739554 4:147987798-147987820 CTCAGGAGGGAGAAGAGGAGTGG + Intronic
981940758 4:150279309-150279331 ACCAGGCAGGAGGAGAGGAAGGG - Intronic
982487579 4:155985662-155985684 ACCAGGAAGGAGAAGAGGAATGG + Intergenic
982966076 4:161909864-161909886 GCCAGGAGGGAGAGGTGGATGGG - Intronic
982966329 4:161913302-161913324 CCCAGGAAGAAAAAGTGGTTTGG + Intronic
983165212 4:164467766-164467788 TCCAGGCAGGTGAAGTAGAATGG + Intergenic
983556794 4:169066242-169066264 CCTAGGCAGGAGAAGTGCAGTGG - Intergenic
984261736 4:177451213-177451235 CTCAGGAGGGTGAGGTGGAAGGG - Intergenic
984699500 4:182809565-182809587 CCCAGGAGGGAGAACTGGTGAGG - Intergenic
984998558 4:185462020-185462042 CCCAGGAGGCAGAAGTCGCAGGG + Intronic
985472486 5:54334-54356 CCCAGGAGGAGGAAGAGGAAGGG + Intergenic
985915904 5:2919104-2919126 GCCAGGAAATAGAAATGGAAGGG - Intergenic
985916726 5:2925797-2925819 CAGAGGAAGAAGAAGAGGAAAGG - Intergenic
985968757 5:3358242-3358264 CCCAGGAAGTAGCAATGGATGGG - Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
988231358 5:28483830-28483852 AGCAGGAAGGAGAGCTGGAAAGG + Intergenic
989105696 5:37861299-37861321 CCAAGGATGCACAAGTGGAATGG + Intergenic
990285676 5:54298569-54298591 ACCAGGAAAGAGAAGAGAAAGGG - Intronic
990332158 5:54738790-54738812 CACAGGAAGGAGCCGTGGGAAGG - Intergenic
990599639 5:57344811-57344833 CTCAAGCAGGAGAAGAGGAAAGG - Intergenic
990625466 5:57605506-57605528 CCCAGGACAGAGAAAGGGAAAGG - Intergenic
991105421 5:62837272-62837294 CCCAGGAAGCACAAGGGGTAGGG + Intergenic
991329957 5:65483203-65483225 ACCAGAAAGGAGAACTGGACCGG + Intergenic
991646658 5:68807937-68807959 GAAAGGAAGGAGAAGGGGAAGGG + Intergenic
992958593 5:81936310-81936332 AACAGGAAGGAGAGGTTGAAAGG - Intergenic
992992898 5:82303097-82303119 CCCAGGAGGCAGAGGTGGCAGGG + Intronic
993561805 5:89418793-89418815 AACAGGAAGGAGAAGTGAAGGGG - Intergenic
993607185 5:90006205-90006227 CTCAGGAAGGAGTGGTGGGAAGG + Intergenic
994100379 5:95884688-95884710 CCCAGGATGGAGAAGTGGTTAGG + Intergenic
994658273 5:102621393-102621415 GGCAGGAAGGAGAAGTGCAGAGG + Intergenic
995051512 5:107711381-107711403 CCCAGGAGGCAGAAGTTGTAGGG - Intergenic
995229540 5:109743582-109743604 CACAGGAAAGGGAGGTGGAAAGG - Intronic
995512644 5:112923729-112923751 CCCAGGAGGAAGAAGGGGAGAGG - Intergenic
995692623 5:114844610-114844632 CCCAGGAAGCAGAAGGGGTCAGG + Intergenic
995958646 5:117812028-117812050 AACAGGAAGGGGAAGTAGAAAGG + Intergenic
996406707 5:123112302-123112324 GGCTGGCAGGAGAAGTGGAAAGG - Intronic
996571365 5:124935647-124935669 CCCAGGAAGCAGAGGTTGCAGGG + Intergenic
996625711 5:125568168-125568190 CCCAGGAAGCACAAGTGGTCAGG + Intergenic
996741753 5:126806028-126806050 CCCAGGAGGCAGAGGTTGAAAGG - Intronic
996906860 5:128610707-128610729 CCCATGAAGGATAAAGGGAAGGG + Intronic
997195198 5:131974588-131974610 CCCAGGAGGGACAAGTGGGGTGG + Intronic
997239991 5:132299467-132299489 CCCAGGGTGGAGGAGTGCAATGG + Intronic
997323901 5:133003784-133003806 CCCAGGAGGCAGAAGTTGCAGGG - Intronic
997596310 5:135109414-135109436 CCCAGGAAGGAAAGATGGACTGG + Intronic
997874357 5:137535314-137535336 CCCAGGAAGCACAAGTGGTCAGG + Intronic
997895376 5:137711476-137711498 CCCAACAGGGAGAAGTGGACAGG + Intronic
998978142 5:147671077-147671099 TCCAGGAAGAACAAGTGCAAAGG + Intronic
999666249 5:153916618-153916640 CCCAGCAAGGAGGAATGGAATGG + Intergenic
1000056228 5:157608914-157608936 TCCCCGAAGGAGAAGGGGAAGGG - Intergenic
1000207739 5:159078313-159078335 ACCAGGAAGGAAAAGCTGAAAGG + Intronic
1000233460 5:159336264-159336286 CACAGGAAGGGGAGGTGGAAAGG - Intergenic
1000330592 5:160202219-160202241 GCCATGAAGGAGAAGTGGCATGG + Intronic
1000684270 5:164227904-164227926 CCCAGGAAGGAAAACAGGGAAGG - Intergenic
1002080957 5:176737135-176737157 CCCAGGAAGGGGTAGGGGGAGGG + Intergenic
1002197492 5:177509322-177509344 CCCAGGTATGGGGAGTGGAATGG - Intronic
1002904700 6:1438871-1438893 CCCAGGGAGGAGCAGGAGAAGGG - Intergenic
1002981433 6:2142473-2142495 CACAGGATGATGAAGTGGAATGG + Intronic
1003015542 6:2464594-2464616 CCAAGGACAGAGAAGTGGATGGG - Intergenic
1003554387 6:7126892-7126914 ACCAGCAAGGACAAGTGGAGGGG + Intronic
1003733724 6:8854329-8854351 TGGAGGAAGGAGAGGTGGAAAGG + Intergenic
1003920041 6:10824528-10824550 ACAAGGCAGGAGCAGTGGAACGG - Intronic
1004324252 6:14659507-14659529 CCAGGCAAGGAGAACTGGAATGG + Intergenic
1004751343 6:18565636-18565658 GGAAGGAAGGAGAAGGGGAAGGG - Intergenic
1004850511 6:19693772-19693794 CCCAGGATGGAGAAAATGAAGGG + Intergenic
1005108768 6:22254330-22254352 CCCAGGAATGAGCAGGGGAAAGG + Intergenic
1005509357 6:26498310-26498332 GCAGGGAAGGAGAAGGGGAATGG + Intergenic
1006096972 6:31662183-31662205 CCCAGGAAGGGGAAGTCAAAGGG + Exonic
1006282466 6:33065659-33065681 CCCTGGAATGAGAATTGGAAGGG + Intronic
1006532322 6:34666519-34666541 CCCAGGCTGGAGGAGTGCAATGG - Intronic
1006567769 6:34974217-34974239 AACGGGAAGGAGAAGGGGAAGGG - Intronic
1006605592 6:35254615-35254637 CCCAGGAAGGGGAGGTTGCAGGG + Intergenic
1006680446 6:35793347-35793369 CCCAGGAGGCAGAAGTTGCAGGG + Intronic
1006736830 6:36279576-36279598 CCCAGGAAGGAGGAGGGCTAGGG + Intronic
1006844000 6:37050304-37050326 CCGAGGAAGGGGAAGTGGCGGGG - Intergenic
1007150974 6:39690572-39690594 GACAGGAGGGAGAAGGGGAAGGG + Intronic
1007192882 6:40034806-40034828 CCCAGGAACTAGAAGTTAAAGGG - Intergenic
1007362337 6:41367919-41367941 CTCAGGCAGGAGAAGGGGAGGGG + Intergenic
1007662290 6:43494365-43494387 CCCATGAAGGTGAAGTGAGAAGG - Intronic
1008111248 6:47497362-47497384 ACAGGGAAGGAGAAGGGGAAGGG - Intronic
1009057768 6:58358695-58358717 GACAGGAAGGGCAAGTGGAAAGG - Intergenic
1009233058 6:61088394-61088416 GACAGGAAGGGCAAGTGGAAAGG + Intergenic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1009873747 6:69480403-69480425 CCCAGGAAGCACAAGTGGTCAGG + Intergenic
1010095095 6:72033519-72033541 CCCAGGCTGGAGTAGTGCAAAGG + Intronic
1010461454 6:76118695-76118717 CCCAGGAAGCAGAAGGGGTCAGG - Intergenic
1010975441 6:82307328-82307350 CCCAGCAAGGACAGGTGGCAGGG - Intergenic
1011299002 6:85854163-85854185 CCCAGGAAGCACAAGTGGTTGGG - Intergenic
1011698579 6:89934791-89934813 CGCAGGCAGGAGAAGAGGACGGG + Intronic
1012282256 6:97342194-97342216 CCCAGGAGGCTGAGGTGGAAGGG + Intergenic
1012429972 6:99153918-99153940 CCCAGGAAGGAGAAGTTTCCAGG + Intergenic
1013203652 6:107926832-107926854 CCAAGGAATGAGAAGAGGAAAGG + Intronic
1013421078 6:109967532-109967554 CCTGGGAAGGAAAAGTGGAGGGG + Intergenic
1014110563 6:117616093-117616115 CCAAGGAAGGAGAAGCCGCAGGG + Intergenic
1014206099 6:118657004-118657026 CACAGGAAGCAGGACTGGAAAGG - Intronic
1015997888 6:139013627-139013649 AGAAGGAAGGAGAAGGGGAAGGG - Intergenic
1018355018 6:163004462-163004484 AGCAGGAAGGAGAAGTGCCAAGG + Intronic
1018696615 6:166396250-166396272 CTCAGGAGGCAGAAGTGGATAGG + Intergenic
1018696636 6:166396334-166396356 CTCAGGAGGCAGAAGTGGATAGG + Intergenic
1018696646 6:166396376-166396398 CTCAGGAGGCAGAAGTGGATAGG + Intergenic
1020832660 7:13111067-13111089 CCCAGGCAGGAGGAGTGCAGTGG + Intergenic
1021917010 7:25444069-25444091 CCCAGTGAGGAGAAATGGATTGG + Intergenic
1022042465 7:26593461-26593483 CCAAGGAAGGAGCTGGGGAAAGG - Intergenic
1022368364 7:29747256-29747278 CCCAGGAGGCAGAAGTTGCAGGG + Intergenic
1022408915 7:30121108-30121130 ACCAGGAAGCAGCAGTGGCAGGG + Intronic
1023332452 7:39132758-39132780 GCGAGGAAGGGGAAGGGGAAAGG + Intronic
1023533515 7:41183443-41183465 GGAAGGAAGGAGAAGGGGAAAGG - Intergenic
1023974144 7:45015444-45015466 TCCAGGAAGGGGAAGGGGAAGGG - Intronic
1024232760 7:47375217-47375239 CCCTGGACTGAGATGTGGAAAGG - Intronic
1024334941 7:48197367-48197389 CCCAGGGAGCAGACCTGGAATGG - Intronic
1024669445 7:51579400-51579422 CCCAGGAAGCAGAGGTTGCAGGG - Intergenic
1025020956 7:55478924-55478946 GCCAGGAAGGAGAGTTGGAGGGG + Intronic
1025209046 7:57010227-57010249 CCCAGGATAGAGAAGTGTTAGGG + Intergenic
1025662903 7:63566629-63566651 CCCAGGATAGAGAAGTGTTAGGG - Intergenic
1025737116 7:64160721-64160743 CCCAGGAAGCACAAGGGGACGGG + Intronic
1026241724 7:68581423-68581445 GGAAGGAAGGAGAAGGGGAAGGG + Intergenic
1026665081 7:72335196-72335218 GCCAAGAAGGAGAGCTGGAATGG + Intronic
1027053205 7:75032512-75032534 CTCAGAGAGGAGAAGGGGAAGGG - Intronic
1027308685 7:76930047-76930069 CTCAGGATGGTGAAGTGGAGTGG - Intergenic
1027665488 7:81039344-81039366 AGCAGCAAGGAGAAGTGCAAGGG + Intergenic
1027802114 7:82767360-82767382 AACAGGGAGGAGAAGAGGAAGGG + Intronic
1028952579 7:96653529-96653551 CCCAGCAATGGGAAGAGGAATGG + Intronic
1029416781 7:100448112-100448134 CCCGGGAAGCAGAAGTTGCAGGG + Intergenic
1029579673 7:101427303-101427325 CTCAGGAGGCTGAAGTGGAATGG - Intronic
1030107695 7:106000382-106000404 CAGAGGAAGGAGAAATGGCAGGG - Intronic
1030268545 7:107646091-107646113 CCCAGGCAGCAGTGGTGGAAAGG + Intergenic
1031007564 7:116491091-116491113 ACCAGGGAGGAGAAGTGAAATGG + Intronic
1031124281 7:117756039-117756061 CTGAGGAAGGAGAAGTGGCAGGG - Intronic
1031601514 7:123716253-123716275 CCCAGGGTGGAGGAGTGCAATGG + Intronic
1032059832 7:128715275-128715297 TGCAGGAAGGGGAAGTGCAAAGG - Intronic
1032078729 7:128848320-128848342 CCCAGGAAGGTGCTGTGGGAGGG - Intronic
1032631693 7:133660059-133660081 CCCAGGATGGGGAAAGGGAAAGG - Intronic
1032769795 7:135039657-135039679 CCCAGGAAGCAGAGGTTGCAGGG + Intronic
1032779097 7:135148144-135148166 TCCAGAAAGGAGGAGTGGAAGGG - Exonic
1033033096 7:137846319-137846341 CCCCGGGAGGAGAGGGGGAAAGG + Intronic
1033038686 7:137898994-137899016 GAAAGGAAGGAGAAGGGGAAAGG + Intronic
1034331010 7:150282183-150282205 CCCGGGGAGGAGGGGTGGAATGG + Intronic
1034667033 7:152827670-152827692 CCCGGGGAGGAGGGGTGGAATGG - Intronic
1034821192 7:154217822-154217844 CCCAGGAGGGAGAGAGGGAAGGG + Intronic
1034903135 7:154920234-154920256 CCCAGGAAGGGGGACTGGAAGGG + Intergenic
1034928564 7:155142649-155142671 CCCAGGCAGCAGGTGTGGAAAGG - Intergenic
1035072151 7:156153617-156153639 CTCTGGAGGGAGAAGCGGAAGGG - Intergenic
1035482635 7:159199553-159199575 TCCAGGAAGGAGAGCTGGAGAGG - Intergenic
1035701004 8:1639266-1639288 CTCCAGAAGGAGCAGTGGAAAGG + Intronic
1035925850 8:3726740-3726762 CTCAGGAATGAGAACTGGACTGG - Intronic
1036288349 8:7464085-7464107 GTGAGGAAGGAGAAGTGGAGGGG - Intergenic
1036333126 8:7847443-7847465 GTGAGGAAGGAGAAGTGGAGGGG + Intergenic
1036544826 8:9757551-9757573 AGCAGGAAGGAGATGAGGAAAGG - Intronic
1036635064 8:10543573-10543595 ACCAGGAAGGATAAGGGAAAGGG - Intronic
1037127276 8:15366394-15366416 CCCAGGAGGCAGAAGTTGCAGGG + Intergenic
1037164988 8:15816513-15816535 GCCAGCAATGAGTAGTGGAAAGG + Intergenic
1038497778 8:28016603-28016625 CCCAGGAAAGAGGGGTGGACTGG - Intergenic
1040284677 8:46093729-46093751 GCCAGACAGGAGAAGTGGCAAGG + Intergenic
1040852400 8:51914577-51914599 AACAGGAAGGGGAAGGGGAAGGG - Intergenic
1040951294 8:52940817-52940839 TCCAGGAAGGCGTAGAGGAAGGG - Exonic
1041224160 8:55682300-55682322 CCAAGTATGGAGAAATGGAAAGG + Intergenic
1041581782 8:59469167-59469189 CTGAGGAAATAGAAGTGGAAGGG - Intergenic
1041694965 8:60726327-60726349 TCCAGAATGGGGAAGTGGAAAGG - Intronic
1041975475 8:63794474-63794496 TTCAGGAAGGAGAATTGGAAAGG + Intergenic
1042431036 8:68706647-68706669 TTAAGGAAGGTGAAGTGGAAGGG + Intronic
1042533086 8:69834237-69834259 CCCAGGCTGGAGGAGTGGAGTGG - Intronic
1042666287 8:71210128-71210150 CACAGGAAGGGTAAGTGGCAGGG + Intronic
1043004961 8:74807993-74808015 CCCAGGAATGATTAGGGGAAAGG - Intronic
1043219694 8:77645022-77645044 CTATGGAAGGAGAAGGGGAAGGG - Intergenic
1043405464 8:79927952-79927974 ACCAGGGAGCAGAAGGGGAAAGG + Intronic
1043418043 8:80071595-80071617 ACCAGGAGGGAGGAGAGGAATGG - Intronic
1044848739 8:96407336-96407358 CAAAGGAAGGAAAAGTGGAATGG + Intergenic
1046365530 8:113226001-113226023 AGCAGGAAGGAGAAGTGCAGTGG - Intronic
1047679608 8:127240951-127240973 CCCAGGAGACAGAAGTGTAAAGG + Intergenic
1048346740 8:133581483-133581505 CCCAGTAGGGATAAGCGGAAGGG - Intergenic
1048359204 8:133681358-133681380 TCTTGGAAGGAGAAGTGCAAGGG + Intergenic
1048588922 8:135802953-135802975 GGAAGGAAGGAGAAGGGGAACGG - Intergenic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049266725 8:141671563-141671585 CACAGGCAGGAGGACTGGAAAGG - Intergenic
1049269495 8:141686740-141686762 CCCCGGAAGGAGAAGGGACAGGG - Intergenic
1050394229 9:5178194-5178216 CCCAGGGAGGAGGAATGGATTGG - Intronic
1050855429 9:10348181-10348203 GCCAGGAAGGATAACTGGGAAGG - Intronic
1050936122 9:11397663-11397685 TCAAGGAAGGAGCAGAGGAAAGG + Intergenic
1051623816 9:19079269-19079291 CCCAGGCTGGAGGAGTGCAATGG + Intronic
1051886569 9:21899390-21899412 GGAAGGAAGGAGAAGGGGAAGGG + Intronic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1054870490 9:70044070-70044092 CCAAGGAGGGAGAAGTCGAGAGG - Exonic
1055746917 9:79458324-79458346 CCCAGGCCGGAGTAGTGCAATGG + Intergenic
1056150910 9:83787274-83787296 CCCAGGCAGGAGGAGTGCAGTGG + Intronic
1056455994 9:86760713-86760735 CTCTGGAGGCAGAAGTGGAAGGG + Intergenic
1058507514 9:105681219-105681241 GCCATTCAGGAGAAGTGGAATGG - Intergenic
1058802870 9:108561857-108561879 CCAAGGCAGGAGAATTGGACAGG - Intergenic
1058835595 9:108856241-108856263 ACCAAGAAGCAGAAGAGGAAAGG - Exonic
1058843912 9:108936670-108936692 CCCAGGATGGAGGAGGGGGAAGG + Intronic
1059076322 9:111197313-111197335 CCCAGTGAGGATAAATGGAAAGG - Intergenic
1059222191 9:112634302-112634324 CCCAGGAAGTAGAGGTTGCAGGG - Intronic
1059525743 9:114989536-114989558 CCCAAGAAGGAGCAGGGGAACGG - Intergenic
1059549743 9:115217015-115217037 CACAGAAAGGAGAAGTTGAGAGG + Intronic
1059969480 9:119650624-119650646 TCCAGGAGAGAGAACTGGAATGG + Intergenic
1059973334 9:119690127-119690149 CTCAGGGAGGAGAAGGAGAATGG - Intergenic
1060202684 9:121660961-121660983 CCCACGAAGGAGAAGTCCAGGGG + Intronic
1060206544 9:121685801-121685823 TCCAGGCAGGTGAAGGGGAAAGG + Intronic
1060324859 9:122604326-122604348 CCCAAGAAGGGGAATAGGAATGG + Intergenic
1060667017 9:125437988-125438010 CGCTGTAAGGAGAAGAGGAATGG + Exonic
1060930421 9:127486311-127486333 CCCTGGAAGGATAAGTGAAGGGG + Intronic
1061056165 9:128224125-128224147 CCCAGAGAGGGGTAGTGGAAGGG + Intronic
1061240518 9:129368579-129368601 GCCTGGAAGGAGGAATGGAAAGG - Intergenic
1061316308 9:129798292-129798314 CTCACGAGGCAGAAGTGGAAGGG + Intergenic
1061416881 9:130451854-130451876 CGCAGGCAGGAGATGTGGGAGGG - Exonic
1061835216 9:133324115-133324137 CCCAGGAAGAACAGGTGGACAGG + Intergenic
1061840107 9:133353749-133353771 CCCAGGTCGGTGCAGTGGAAGGG + Exonic
1061952507 9:133944241-133944263 GCCAGTAAGGGGCAGTGGAAGGG - Intronic
1062005735 9:134237612-134237634 CCCAGGAGGGAGAAAGGGACTGG + Intergenic
1062253220 9:135608636-135608658 CCCAGGTAGGAGAAGATGCAGGG + Intergenic
1062299388 9:135856500-135856522 CACAGGCAGAAGGAGTGGAATGG - Intronic
1062722259 9:138050607-138050629 CCCAGTCAGGAGGAGGGGAAGGG + Intronic
1203530104 Un_GL000213v1:133448-133470 CTCATGAGGCAGAAGTGGAAAGG - Intergenic
1185816067 X:3157191-3157213 CCGATGAATGACAAGTGGAAAGG + Intergenic
1186286072 X:8045367-8045389 CCCAGCTGGGAGAAGTGGTAAGG + Intergenic
1187658071 X:21503686-21503708 CCAAGGTAGGAGAAGAAGAAAGG + Intronic
1188185722 X:27112221-27112243 CCCAGGCTGGAGGAGTGCAATGG + Intergenic
1188225844 X:27595951-27595973 CCCAGGAAGCAGAGGTTGCAGGG + Intronic
1189110544 X:38285930-38285952 AAGAGGAAGGGGAAGTGGAAGGG - Exonic
1189110593 X:38286077-38286099 AAGAGGAAGGAGAAGGGGAAGGG - Exonic
1189110629 X:38286176-38286198 AGGAGGAAGGAGAAGGGGAAGGG - Exonic
1189361580 X:40357510-40357532 CCCGGGAGGCAGAAGTGGCAGGG + Intergenic
1189650837 X:43187932-43187954 CTTAGGAAGAAGAAGTAGAAGGG + Intergenic
1189928830 X:45986138-45986160 CCCAGAAAGGAGAGGTGGGGAGG - Intergenic
1190809702 X:53871265-53871287 CCCAGGAGGCAGAAGTTGCAGGG + Intergenic
1191896637 X:65999880-65999902 CCCAGGAAGAAGATATGGATGGG + Intergenic
1191909989 X:66140007-66140029 CACTGAAAAGAGAAGTGGAATGG - Intergenic
1192174561 X:68877814-68877836 AGCAGAAAGGAGAAGTGGCAAGG - Intergenic
1192448950 X:71230879-71230901 GGAAGGAAGGAGAAGGGGAAGGG + Intergenic
1192595693 X:72406044-72406066 ACCAGGAAGGAGAAGTCAACAGG - Intronic
1192938077 X:75881910-75881932 CCCAGGAAGCACAAGTGGTCAGG - Intergenic
1193367317 X:80650775-80650797 CCCAGGAAGCACAAGTGGTCAGG + Intergenic
1194015917 X:88620900-88620922 GCTAGGAAGGGGAAGTGGAGGGG + Intergenic
1194980231 X:100432923-100432945 TCTAGGAAGGAAGAGTGGAATGG - Intergenic
1195704048 X:107725845-107725867 CCCAGCATAGAGAAGGGGAAGGG + Intronic
1195759235 X:108228014-108228036 TTCAGGATGGAGAAGTTGAAGGG + Intronic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1196810513 X:119625487-119625509 AGCAGGAAGGGGAAGTGGGAAGG + Intronic
1196820041 X:119694270-119694292 CCAAGGCCGGAGAAGTGGAGAGG - Intergenic
1196829316 X:119763719-119763741 GCAAGGCTGGAGAAGTGGAAGGG + Intergenic
1197453337 X:126645132-126645154 ACTAGGGAGGAGAAATGGAAAGG + Intergenic
1197511155 X:127371062-127371084 CCCAGGAGGGAAAAGTGGTTTGG - Intergenic
1197757940 X:130009412-130009434 CCCAGGCTGGAGGAGTGCAATGG - Intronic
1198104617 X:133450520-133450542 CCCAGGAAGCAGAGGTTGCAGGG - Intergenic
1198615642 X:138456042-138456064 CCCAGGAAGCAGAAGGGGTCAGG + Intergenic
1198720234 X:139609716-139609738 CTCAGGAGGCTGAAGTGGAAGGG + Intronic
1199404304 X:147438383-147438405 CCGAGGAAACAGAAGTGGAGAGG + Intergenic
1200209047 X:154337736-154337758 CCCTGGAAGGACAAGTGCAGAGG + Intergenic
1200221829 X:154394393-154394415 CCCTGGAAGGACAAGTGCAGAGG - Intronic
1201474550 Y:14366373-14366395 CCCATGAAGCAGAGGTGGGAGGG + Intergenic