ID: 975663927

View in Genome Browser
Species Human (GRCh38)
Location 4:76715273-76715295
Sequence CTCATTTCCCAGGTATATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975663924_975663927 26 Left 975663924 4:76715224-76715246 CCAGGAAGGATCTTCTCACTTAT 0: 1
1: 0
2: 2
3: 13
4: 161
Right 975663927 4:76715273-76715295 CTCATTTCCCAGGTATATATAGG 0: 1
1: 0
2: 2
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975663927 Original CRISPR CTCATTTCCCAGGTATATAT AGG Intronic
901953405 1:12766877-12766899 GTCATTTCCCAGTTGTATACGGG + Intergenic
902703425 1:18188748-18188770 CTCAATTTCCATGTGTATATGGG - Intronic
904346754 1:29877482-29877504 CACCTTTCCCAGGTCTATTTAGG - Intergenic
905696681 1:39979782-39979804 CTATTTTGCCAGGCATATATGGG - Intergenic
906417160 1:45629404-45629426 CTTATTTCCCAGGCAGATTTAGG + Intronic
906533690 1:46539406-46539428 CTGATTTCCCAGGGAAATAACGG - Intergenic
909093065 1:71251568-71251590 GGCATTTCCCATGTATATATTGG + Intergenic
909756122 1:79228040-79228062 CTTATTTCCCACGTAATTATTGG - Intergenic
911336464 1:96586516-96586538 CTCATTTACCAGGCATGTTTGGG + Intergenic
912552182 1:110491523-110491545 CTCATTCCCCAGGAACAAATGGG - Intergenic
914319973 1:146549712-146549734 CACATTTCTCAGGTTTATACGGG + Intergenic
914589093 1:149090421-149090443 CTCATTTCCTATGTACATAAAGG + Intronic
915242985 1:154537097-154537119 CTCTTCTCCCAGGTGTCTATAGG + Intronic
915947986 1:160168042-160168064 TTCATTTCCCAGGAACATTTTGG + Intronic
918263880 1:182822117-182822139 CTTTTTTCCCAGGTAGTTATAGG - Exonic
921541832 1:216425447-216425469 CTTATTTCCCAGGCACTTATAGG - Intergenic
921715353 1:218411979-218412001 CACATTTCCCATTGATATATGGG - Intronic
924287896 1:242507046-242507068 ACCATTTCCCAGTTATATAAGGG + Intronic
924565672 1:245196172-245196194 CTCATTTACCAGGAAAATAGTGG - Intronic
1062903870 10:1166561-1166583 CTCATCTCACAGGTATTTATTGG + Intergenic
1065140057 10:22712038-22712060 CTCATTCAACAGATATATATTGG - Intronic
1065608425 10:27445501-27445523 CTCATTTCAGAGGAATATATTGG + Intergenic
1068248980 10:54411203-54411225 CTTATATTCCAGTTATATATAGG + Intronic
1070146846 10:73780628-73780650 CTCATTTAACAAGTATTTATTGG + Intergenic
1070412880 10:76160123-76160145 CCCATTTCCCAGGGGTATATGGG + Intronic
1071118647 10:82252405-82252427 CTGTTTTCCCATGTATAAATGGG - Intronic
1071198881 10:83194486-83194508 CTCATTTCTCAGGTTTCTTTGGG - Intergenic
1073451646 10:103613175-103613197 CTCTTTGCCCAGGTATCTGTGGG + Exonic
1073755349 10:106575254-106575276 CCCATTTCCCAGATTCATATGGG + Exonic
1073947578 10:108768607-108768629 CTCATTTCCCAAGTATTCTTTGG + Intergenic
1078636675 11:13057216-13057238 CTCATTACATAGGTATACATAGG - Intergenic
1085666816 11:78421167-78421189 CTCATCTCTCAGGCATATAAAGG + Intergenic
1086351994 11:85951724-85951746 GACAATTCCCAGGTATATCTAGG + Intergenic
1086641517 11:89163526-89163548 TTCATTTCCTTCGTATATATAGG - Intergenic
1086970087 11:93072200-93072222 GGCATCTCCCATGTATATATGGG - Intergenic
1088168626 11:106968690-106968712 TTCATTTCCCAGGTAGAAAAGGG - Intronic
1088523779 11:110729177-110729199 CTCACTTCACAAGTATATATAGG + Intergenic
1091470609 12:723327-723349 CTCCATTTCCAGGTATATTTGGG - Intergenic
1094249948 12:28348228-28348250 CTCATTTGCCAGCTATGTTTAGG + Intronic
1094368080 12:29705463-29705485 CTCCTTTTCCTGGTATAGATGGG - Intronic
1095614861 12:44176327-44176349 TTCATTCCACAGGTATTTATTGG - Intronic
1097108052 12:56636639-56636661 TTCAGTTCCCAGGTCTGTATCGG + Intronic
1097552031 12:61084946-61084968 GTCATTTCCCATGTGTATGTTGG - Intergenic
1098771251 12:74556313-74556335 CTCATTTACCTGGCATGTATAGG + Intergenic
1098834068 12:75399612-75399634 CTCATTTCCCAAATAAATAATGG - Intronic
1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG + Intergenic
1100627344 12:96348782-96348804 CTCACTTCTTAGGTATATTTTGG - Intronic
1100668924 12:96788377-96788399 TTCATTTCACAGATATGTATTGG - Intronic
1102813152 12:115841450-115841472 CTCATGTCCCAGTGATATGTGGG - Intergenic
1104802297 12:131562335-131562357 CTAAGTTCTCAGGAATATATCGG - Intergenic
1105233971 13:18528285-18528307 CTTATTGCCCATATATATATAGG - Intergenic
1105796814 13:23862849-23862871 ATCATTTTACAGGTATATATAGG - Intronic
1108092587 13:46864697-46864719 CCCAATTACCAGGTATATTTAGG + Intronic
1109995784 13:70124170-70124192 ATCATTTCCCAAGCAAATATTGG + Intergenic
1115247736 14:31313836-31313858 CAGACTTCCCAGATATATATTGG + Intronic
1115256287 14:31406180-31406202 AGCATTTCTCAGGTATATGTAGG - Intronic
1116035773 14:39625604-39625626 GTCATCTCCCATGTATACATGGG - Intergenic
1116460526 14:45167638-45167660 CTCAATTACCAGGTAAATATGGG - Intronic
1117990406 14:61427380-61427402 CACTTTTCCTAGGTCTATATAGG - Intronic
1119560348 14:75584603-75584625 CAGATTCCCCAGGTATAGATAGG - Intronic
1121997835 14:98617641-98617663 CTCATTACCCAGGTAGAGAGGGG - Intergenic
1123879463 15:24662796-24662818 CTCATTTCCCAGAGAGAAATGGG + Intergenic
1124112756 15:26807382-26807404 CTCATTTCACTGGTACAAATTGG + Intronic
1124228775 15:27922282-27922304 CTCAATTCCCATGTATTTCTTGG - Intronic
1127290918 15:57570451-57570473 CACATTTCCCAGGGATAAGTGGG - Intergenic
1129680292 15:77655072-77655094 GCCATTTCCCAGTTATAAATGGG - Intronic
1132138229 15:99366004-99366026 CTCTTTTCCCAAGCATGTATGGG + Intronic
1132322421 15:100935762-100935784 ATCATTTCCCAGGTTTCTGTGGG + Intronic
1133108410 16:3530313-3530335 CTCACTTCTCAGGTCTGTATTGG + Intronic
1135582155 16:23637791-23637813 TTCATTTCCCAGGTATATTTTGG - Intronic
1137481997 16:48859499-48859521 CTCATTTCCCAGGCAGACATGGG - Intergenic
1140013553 16:71160365-71160387 CACATTTCTCAGGTTTATACGGG - Intronic
1140268428 16:73441057-73441079 TTCATTTTCCAGGTTTATATAGG + Intergenic
1140964098 16:79947427-79947449 CTCCTTTCCCAGCTACACATGGG - Intergenic
1141333916 16:83137345-83137367 CTCATTTTCCAGGTAGAACTGGG - Intronic
1141494155 16:84395341-84395363 CTCATTCCCCAGGGACATGTGGG + Intronic
1152132827 17:78487291-78487313 CTCATTTCCAAGGACTACATGGG + Intronic
1153398843 18:4658906-4658928 CTCATTTCCCAGTTCTTTGTGGG - Intergenic
1154515568 18:15161591-15161613 CTTATTGCCCATATATATATAGG + Intergenic
1155739920 18:29276534-29276556 CCCAATTCCTAGGTATATAATGG - Intergenic
1156262441 18:35458281-35458303 CTCAGTTTCCAGGCATATGTGGG + Intronic
1157086757 18:44588338-44588360 CCCTTTCCCCAGGTATACATAGG - Intergenic
1157401984 18:47396377-47396399 GTCATGTGCCAGGCATATATGGG - Intergenic
1157401994 18:47396423-47396445 GTCATGTGCCAGGCATATATGGG - Intergenic
1157871858 18:51237142-51237164 CTGATTTCTCAAGTTTATATAGG - Intergenic
1162261171 19:9535369-9535391 CTGATTTTGCAGGAATATATGGG - Intronic
928052601 2:28015268-28015290 CTCCTTCCCCAGGTAAATAAAGG + Intronic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
930167627 2:48219070-48219092 CTCTTCTTCCAGGTATATAGGGG + Intergenic
930377862 2:50590456-50590478 CTCATTGCTTAGGTATATAAAGG - Intronic
930849829 2:55948243-55948265 CTCATTTTTCAGGGATATTTTGG - Intergenic
932653070 2:73581094-73581116 CTAGTTTCCCTGGTATACATGGG + Intronic
933075846 2:77925214-77925236 TTCATTTCCCAGACATATAAAGG + Intergenic
936832809 2:116669613-116669635 CTAATTTCCTAGATATATGTTGG + Intergenic
939545591 2:143548637-143548659 TTAATTTCCCAGGTATTTGTAGG - Intronic
942853990 2:180524433-180524455 CCAATTACCCAGGTAAATATGGG - Intergenic
943603170 2:189944578-189944600 CAGAGTTCCCAGGTATATAAAGG + Intronic
943973784 2:194445436-194445458 CTCTTCTCCCAGGAATAAATAGG + Intergenic
946365646 2:219247429-219247451 CTCATCTCCAAGCAATATATTGG - Exonic
948028978 2:234800992-234801014 CTCATTTAACAAGTATTTATTGG - Intergenic
1169618715 20:7480084-7480106 CTGATTTTCCAGGTCTAGATTGG - Intergenic
1173074947 20:39809082-39809104 CTTATTTTCCAGGCATGTATTGG + Intergenic
1176777958 21:13156561-13156583 CTTATTGCCCATATATATATAGG - Intergenic
1182173078 22:28253578-28253600 TTCATTTAACAAGTATATATTGG - Intronic
951481563 3:23167371-23167393 TTCATTTCACAAGTATTTATTGG - Intergenic
951766692 3:26207404-26207426 CTCATTTCCAAGGTATATACAGG - Intergenic
952983529 3:38757435-38757457 CTCATTTCCCTGGTATGAACTGG - Intronic
955314778 3:57927785-57927807 CTCTCTTCCCATGTATGTATTGG - Exonic
957220089 3:77370907-77370929 CTCATTTCCCTGGACTATCTAGG - Intronic
957278600 3:78121251-78121273 TTCATTTCCCAGCTATCTCTAGG + Intergenic
957713595 3:83895931-83895953 CCCATTTCCCTGCTATATATCGG - Intergenic
959503057 3:107128967-107128989 CTCATTTCCCAGTGAAATGTGGG - Intergenic
960726296 3:120673690-120673712 CTCATTTCCAGGGTATCTCTAGG - Intronic
962235158 3:133701000-133701022 CTCATATCCCAGGTACAGCTTGG - Intergenic
962242053 3:133757887-133757909 CTCATAGCCCAGGTACATCTTGG - Exonic
965036048 3:163439424-163439446 GTAATTTACCAGGGATATATTGG + Intergenic
965965303 3:174481853-174481875 CTCAGTACCCAGGTTTTTATTGG + Intronic
966385326 3:179391083-179391105 CACATTTGAAAGGTATATATGGG - Intronic
966653274 3:182325172-182325194 TTCATTTCTCAGGGAAATATGGG - Intergenic
970087049 4:12361414-12361436 CTCATATCCCAAATATATAAAGG + Intergenic
971144800 4:23964997-23965019 CTCATTTCTCAGGAAAATAAAGG + Intergenic
973261236 4:48166022-48166044 CTCATTTCCAAGGTCTACATGGG + Intronic
975309568 4:72888069-72888091 CTGGTTTCCCAGATGTATATTGG - Intergenic
975663927 4:76715273-76715295 CTCATTTCCCAGGTATATATAGG + Intronic
975668752 4:76759012-76759034 CAGATTTCCCAGGATTATATGGG + Intronic
977213454 4:94248073-94248095 CACATTTCCCACTTATAAATGGG - Intronic
980599087 4:134995822-134995844 CTGTTTTCCCAGGTAGTTATGGG - Intergenic
982067385 4:151666296-151666318 CTCCTTTCCCTGGTATTTAGAGG + Intergenic
984471908 4:180187085-180187107 TTTATTTTCCAAGTATATATGGG + Intergenic
984498508 4:180529903-180529925 TTCATTTCACATGTATTTATAGG - Intergenic
988830000 5:34977967-34977989 CTCATTGGCCAGGGATAAATAGG + Intergenic
989265030 5:39463667-39463689 GTCATTTCCCAGCTCTCTATGGG + Intergenic
990724021 5:58733456-58733478 CTAATTTGCCAGATATCTATTGG + Intronic
991188882 5:63845167-63845189 CACAATTCCCAAATATATATTGG + Intergenic
995395409 5:111681746-111681768 CCAACTTCCCAGGTATTTATGGG + Intronic
998670507 5:144347970-144347992 CTCATACCCTAGGTATACATAGG + Intronic
1000478816 5:161745256-161745278 CTCAATTCTCCTGTATATATGGG + Intergenic
1003726192 6:8767430-8767452 TGCATGTCCCAGGAATATATGGG + Intergenic
1003992812 6:11503652-11503674 CTCATTTACCAGGTAAGTATTGG + Intergenic
1005117522 6:22355241-22355263 ATAATTTGCCAGGAATATATTGG + Intergenic
1008182829 6:48354293-48354315 CTCATAACCCTGGTATATTTAGG - Intergenic
1008275192 6:49535890-49535912 CTCAGTACCAATGTATATATAGG - Intergenic
1009468381 6:64002032-64002054 CTAATGTCTCAGGTTTATATGGG - Intronic
1010128290 6:72461037-72461059 CTCATGTCTAAGGTAAATATAGG + Intergenic
1011154908 6:84320135-84320157 TTAATTTACCAGGTATTTATTGG + Intergenic
1011164856 6:84435048-84435070 CTCCTTTCCCAGGTGGAAATAGG + Intergenic
1013974888 6:116065559-116065581 CTTATTTGCCAGATAAATATGGG + Intergenic
1016479471 6:144466795-144466817 TTCATTTCCCAGTTATACATAGG - Intronic
1018310919 6:162507629-162507651 CACATTTACAAGGTATGTATAGG + Intronic
1019453316 7:1110868-1110890 GTCATTTTCCATGTACATATTGG - Intronic
1020376822 7:7496810-7496832 ATCATTTCCCAGATATGCATGGG + Intronic
1026252914 7:68686273-68686295 TTCATTTCCCAGGTATCAAAAGG + Intergenic
1026492217 7:70872537-70872559 ATCATTTCTGAGGTTTATATTGG - Intergenic
1026669622 7:72377923-72377945 CTAAATTCCCAGGAATATATTGG + Intronic
1027158210 7:75783408-75783430 CTGATTCCCCAGGTATAGCTAGG + Intronic
1027542890 7:79490535-79490557 CTCCTCTCCCAGGTCTATAATGG + Intergenic
1027927661 7:84487434-84487456 CTCATGTTCCAGGGAAATATTGG - Intronic
1028727713 7:94107632-94107654 CTAATTTCCCAAATATGTATGGG - Intergenic
1030207878 7:106968218-106968240 CTCATTTCCCACATATCTTTTGG - Intergenic
1030359886 7:108584116-108584138 CTCATGTCCCAGATTTACATGGG - Intergenic
1031829729 7:126612071-126612093 CACATTTCTCAGTTATATAGTGG + Intronic
1044129842 8:88508376-88508398 TTCATTTTCCAGGTAAATAAAGG - Intergenic
1048953511 8:139515177-139515199 GTCATTTCCCAGCTACTTATTGG + Intergenic
1051128008 9:13826712-13826734 CTAATTTCCCATGTATATTGAGG - Intergenic
1056990426 9:91405613-91405635 CTCATTTCCCGGGTATATCGGGG + Intergenic
1058749482 9:108025226-108025248 GTTATTTCCCAGGTAAATAGAGG - Intergenic
1060183968 9:121552623-121552645 CACATTCCCCAGGTAAAAATGGG - Intergenic
1194578931 X:95647157-95647179 CTCATTTTCCATTTATATTTGGG - Intergenic
1197991496 X:132323000-132323022 ATCATTTCCTAGCTATATATAGG - Intergenic
1198105055 X:133454108-133454130 GTTATTTACCAGGTATATTTTGG + Intergenic
1198320137 X:135512173-135512195 CTCATGTCACAGGAATATGTTGG - Intergenic
1198602913 X:138304031-138304053 TTCATCTCACAGGTATGTATAGG + Intergenic
1198789452 X:140327713-140327735 CTCTTTTCGCAGATGTATATAGG - Intergenic
1199763963 X:150927180-150927202 CTCAATTCCCATGTATAAAATGG + Intergenic
1199871032 X:151899215-151899237 CTTATTTGCCAGGTATACTTTGG + Intergenic