ID: 975664640

View in Genome Browser
Species Human (GRCh38)
Location 4:76722861-76722883
Sequence GCGCACTAAACAATAATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975664640 Original CRISPR GCGCACTAAACAATAATGGA TGG Intronic
906512931 1:46421613-46421635 GCTCTCTGAACAACAATGGAGGG + Intergenic
906539328 1:46572964-46572986 GCCAACAAAACAATAATGAATGG - Intronic
907835712 1:58106784-58106806 GGGCCCTAAACAGTGATGGAAGG - Intronic
909592926 1:77371785-77371807 GCAGACTAAAGAATAATGGAGGG + Intronic
915077057 1:153317106-153317128 GTGCACTAAAAAATAATAAAGGG - Intergenic
919287067 1:195577616-195577638 GTACACAAAACAATAATGAATGG - Intergenic
924828724 1:247570055-247570077 ACACACTAAAAAATAATAGAGGG - Intronic
1063832670 10:9972982-9973004 GTGGACTAATCAATAATGGTGGG + Intergenic
1064303898 10:14148084-14148106 GCACAATACACATTAATGGAGGG - Intronic
1068185237 10:53576721-53576743 GCACACCAAACAATAAAGCACGG + Intergenic
1075685705 10:124363956-124363978 GCGGACGAGAGAATAATGGAAGG - Intergenic
1076841252 10:133046902-133046924 GGGCACTGAACAATAATGCATGG - Intergenic
1101639254 12:106575078-106575100 GGGCACTAAATAATAATGAAAGG + Intronic
1101756267 12:107622876-107622898 GAGCACAAACCAATAATGGTGGG - Intronic
1102698331 12:114817426-114817448 GCAAACTAAACAACAAAGGAAGG - Intergenic
1108167171 13:47705761-47705783 GCACACTAACCACTAAGGGAGGG + Intergenic
1114603889 14:23980094-23980116 GTGCAATAAAAAATGATGGAGGG + Intronic
1114608899 14:24022872-24022894 GTGCAATAAAAAATGATGGAGGG + Intergenic
1114732436 14:25007673-25007695 GCTCAGTAAACATTAGTGGAAGG + Intronic
1116127330 14:40804667-40804689 GTTCACTGAACAATATTGGAGGG - Intergenic
1117921449 14:60728947-60728969 CATCACTAAATAATAATGGATGG - Intergenic
1119499504 14:75112005-75112027 GTGCACAAAACATAAATGGAAGG + Intronic
1120493895 14:85210078-85210100 GAACACTAAAGAATATTGGATGG + Intergenic
1120553208 14:85897087-85897109 GAGCAATAAACAATCATGTATGG + Intergenic
1125305370 15:38306357-38306379 GCTCAGAAAACAATAATGGCAGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126932881 15:53674539-53674561 GCTAACTAGAAAATAATGGAAGG + Intronic
1154125207 18:11686737-11686759 GATCACTGAACAACAATGGATGG - Intergenic
1155455847 18:26012334-26012356 CCACCCAAAACAATAATGGAGGG + Intergenic
1155951109 18:31914258-31914280 ACGCACTAAAAAATTATGGCTGG + Intronic
929274562 2:40011449-40011471 ACGCAATAAACAATGATGAAGGG - Intergenic
929275960 2:40025109-40025131 ACGCAATAAACAATGATGAAGGG + Intergenic
939141850 2:138363432-138363454 GCCAAATAAACAATAATGAAAGG + Intergenic
939480937 2:142746353-142746375 GTGAATTAAACAATAATAGATGG - Intergenic
941382426 2:164811259-164811281 GAGAACTAAGCAATAATGCATGG + Intronic
945041900 2:205749430-205749452 GGCCACGAGACAATAATGGAGGG - Intronic
945394351 2:209301715-209301737 GCGCCCTAGACCATCATGGACGG + Intergenic
1173273952 20:41562268-41562290 GTCAACTAACCAATAATGGAAGG + Intronic
1178056127 21:28800267-28800289 TCGCACTACACAATCTTGGATGG + Intergenic
957866905 3:86037453-86037475 AAGCACTAAACTATAATGAAAGG + Intronic
964060716 3:152518833-152518855 GTGCACTAGACAACAATGGATGG - Intergenic
971924471 4:32989628-32989650 CTACACTAAACAATAATGGTGGG + Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
980578283 4:134713934-134713956 GCGCAATAAAAAATAATAAAGGG + Intergenic
981668455 4:147257767-147257789 GCGCAATAAAAAATAATAAAGGG + Intergenic
981874104 4:149520084-149520106 GCCCACTAAATAATAATGGTAGG + Intergenic
983956110 4:173700560-173700582 GCAAACAAAACAATAATGAAAGG + Intergenic
990259120 5:54002279-54002301 GTCCTCTAAACATTAATGGAGGG + Intronic
995191308 5:109321749-109321771 ACAAACTAAACAATAATGAAAGG - Intergenic
997461159 5:134053435-134053457 GAGCCCTAGACAATGATGGAGGG - Intergenic
1001108278 5:168874406-168874428 GCTCAATAAACAATAAGCGAAGG - Intronic
1005420726 6:25646886-25646908 GGTCACTAAACAATAATAAAAGG + Intergenic
1009582177 6:65550055-65550077 GCTCAGTGAAAAATAATGGATGG - Intronic
1009993682 6:70876007-70876029 GCCCACTAAAAAATAATTCATGG - Intronic
1015831522 6:137375099-137375121 TCTTACTAAACAATAATTGAAGG - Intergenic
1023656775 7:42431025-42431047 GAGCACTTAAAAAGAATGGATGG + Intergenic
1025482834 7:61005661-61005683 GGTCACTAAACAATAATAAAAGG + Intergenic
1025936621 7:66043101-66043123 GCTCATGAAACAATAATGTATGG - Intergenic
1038897930 8:31807474-31807496 GCTCACTAAATATTTATGGAAGG + Intronic
1041495683 8:58482967-58482989 GCCCACTGAGCAATAATGGCAGG - Intergenic
1041668564 8:60469414-60469436 GAGCACTGCATAATAATGGAAGG + Intergenic
1042096773 8:65224783-65224805 GAGCACTAAATAATAAGGAAAGG + Intergenic
1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG + Intergenic
1051283369 9:15466895-15466917 GCTTACAAAACAATAATTGAAGG + Intronic
1054763103 9:69020998-69021020 GCTCAACAAACAATGATGGATGG + Intergenic
1061294544 9:129669813-129669835 TCGCAATAAAAAATAATTGAAGG - Intronic
1196380403 X:115083292-115083314 GCGCAATAAAAAATAATGAAGGG - Intergenic
1197710952 X:129666844-129666866 GCGCTATAAACAAAAAAGGAGGG - Intergenic
1199515517 X:148670768-148670790 GCACACTGAAAAAGAATGGATGG - Intronic
1201394887 Y:13537541-13537563 GGGCACTAAATAATAATAAAGGG + Intergenic
1202043248 Y:20709695-20709717 TCGCAATAAACAATGATGAAAGG + Intergenic