ID: 975678615

View in Genome Browser
Species Human (GRCh38)
Location 4:76852601-76852623
Sequence TGGTTTTCCCTTATAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975678609_975678615 19 Left 975678609 4:76852559-76852581 CCCAGCAGAGTTACACTTGAACC No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678613_975678615 -5 Left 975678613 4:76852583-76852605 CCAAATTCTGCTTCCTGCTGGTT No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678604_975678615 27 Left 975678604 4:76852551-76852573 CCCCCAGCCCCAGCAGAGTTACA No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678608_975678615 20 Left 975678608 4:76852558-76852580 CCCCAGCAGAGTTACACTTGAAC No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678610_975678615 18 Left 975678610 4:76852560-76852582 CCAGCAGAGTTACACTTGAACCA No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678607_975678615 24 Left 975678607 4:76852554-76852576 CCAGCCCCAGCAGAGTTACACTT No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678606_975678615 25 Left 975678606 4:76852553-76852575 CCCAGCCCCAGCAGAGTTACACT No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678611_975678615 -2 Left 975678611 4:76852580-76852602 CCACCAAATTCTGCTTCCTGCTG No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data
975678605_975678615 26 Left 975678605 4:76852552-76852574 CCCCAGCCCCAGCAGAGTTACAC No data
Right 975678615 4:76852601-76852623 TGGTTTTCCCTTATAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975678615 Original CRISPR TGGTTTTCCCTTATAAAAAT AGG Intergenic
No off target data available for this crispr