ID: 975678621

View in Genome Browser
Species Human (GRCh38)
Location 4:76852635-76852657
Sequence CTGCTACTCACTGGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975678614_975678621 16 Left 975678614 4:76852596-76852618 CCTGCTGGTTTTCCCTTATAAAA No data
Right 975678621 4:76852635-76852657 CTGCTACTCACTGGGCATGGTGG No data
975678613_975678621 29 Left 975678613 4:76852583-76852605 CCAAATTCTGCTTCCTGCTGGTT No data
Right 975678621 4:76852635-76852657 CTGCTACTCACTGGGCATGGTGG No data
975678617_975678621 3 Left 975678617 4:76852609-76852631 CCTTATAAAAATAGGACATTAAA No data
Right 975678621 4:76852635-76852657 CTGCTACTCACTGGGCATGGTGG No data
975678616_975678621 4 Left 975678616 4:76852608-76852630 CCCTTATAAAAATAGGACATTAA No data
Right 975678621 4:76852635-76852657 CTGCTACTCACTGGGCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975678621 Original CRISPR CTGCTACTCACTGGGCATGG TGG Intergenic
No off target data available for this crispr