ID: 975681105

View in Genome Browser
Species Human (GRCh38)
Location 4:76877134-76877156
Sequence CCACCTGCATCGTCCTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975681105_975681112 23 Left 975681105 4:76877134-76877156 CCCTGCAAGGACGATGCAGGTGG No data
Right 975681112 4:76877180-76877202 AACATCACATAACCCCAGCAAGG No data
975681105_975681110 0 Left 975681105 4:76877134-76877156 CCCTGCAAGGACGATGCAGGTGG No data
Right 975681110 4:76877157-76877179 GAACTCCAGGCATAGCATTTTGG No data
975681105_975681113 29 Left 975681105 4:76877134-76877156 CCCTGCAAGGACGATGCAGGTGG No data
Right 975681113 4:76877186-76877208 ACATAACCCCAGCAAGGAGTCGG No data
975681105_975681114 30 Left 975681105 4:76877134-76877156 CCCTGCAAGGACGATGCAGGTGG No data
Right 975681114 4:76877187-76877209 CATAACCCCAGCAAGGAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975681105 Original CRISPR CCACCTGCATCGTCCTTGCA GGG (reversed) Intergenic
No off target data available for this crispr