ID: 975683265

View in Genome Browser
Species Human (GRCh38)
Location 4:76896986-76897008
Sequence CAGCTCCGGCCGGTCTCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975683265 Original CRISPR CAGCTCCGGCCGGTCTCCGC GGG Exonic
902780753 1:18703275-18703297 CAGCAACGGCCTGTCTCCTCAGG + Exonic
904356713 1:29944970-29944992 CAGCTCCAGCCAGTCTCCACCGG - Intergenic
906042405 1:42798245-42798267 CAGCTCCTGCCGGCCTCTGTGGG + Intergenic
906074096 1:43039274-43039296 CAGCTCGGGCCGGTCCCTGCGGG + Intergenic
906211888 1:44016729-44016751 CACCTCCGGCCCGTCTCCCCGGG + Intronic
919744633 1:201000684-201000706 GAGCTCCGGCAGGTGTGCGCGGG - Intronic
919820540 1:201469251-201469273 CAGCTCCGGCAGGGCCCCGGGGG + Intergenic
1065483852 10:26217868-26217890 TGGCTCCCGCCGCTCTCCGCCGG - Exonic
1070481991 10:76891651-76891673 CAGCTCCGGCGTGGCTCCTCCGG + Exonic
1070767964 10:79067338-79067360 CAGCCCCGGCCGGGCTGCGGGGG - Intergenic
1071966557 10:90857942-90857964 GAGCTCGGGCTGGGCTCCGCTGG + Intergenic
1072700919 10:97640868-97640890 CGGCTCGGGCCCCTCTCCGCCGG + Exonic
1075144608 10:119872602-119872624 CGCCTCCGCCCGGTCTTCGCCGG - Exonic
1076684621 10:132192452-132192474 CAGCTCAGGACGGTCACTGCAGG - Intronic
1078631692 11:13009532-13009554 CAGGTCCGGCCGGGGTCTGCTGG - Intergenic
1083888491 11:65584258-65584280 CAGCTCCAGCCAGTCCCTGCTGG + Exonic
1085796050 11:79540929-79540951 CAGCACCAGCTGGTCTCCCCAGG - Intergenic
1089273183 11:117315623-117315645 CCCCTCCGGCCGGGCTCCTCGGG + Exonic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1101726022 12:107388697-107388719 CAGCACCAGCAGGTCTCCGTTGG + Intronic
1104874416 12:132023899-132023921 CAGCTCCGGCAGCTCACAGCGGG + Exonic
1104889453 12:132133198-132133220 CAGCTGGGCCCGGTCTCCGCAGG - Intergenic
1108312791 13:49212256-49212278 CGGGTCCGGCCGGGCTCCACTGG + Intergenic
1112652533 13:101415775-101415797 TGGCTCCAGCAGGTCTCCGCGGG - Intronic
1114145596 14:19973412-19973434 CAGCACCGGAGGGTCTCCGTAGG + Intergenic
1115752460 14:36505982-36506004 CCCCTCTGGCCGGGCTCCGCAGG - Intronic
1115770274 14:36659602-36659624 CAGCTCTGGCGGCTCCCCGCAGG - Intronic
1122337762 14:101005163-101005185 CAGCTCTGGCCGGTGGCCACAGG - Intergenic
1122689630 14:103525993-103526015 CGGCTCCGGCCTGGCGCCGCTGG + Intergenic
1127661038 15:61100404-61100426 CCGCTCAGGCCGGGCACCGCTGG - Intronic
1130339377 15:82986326-82986348 CAGCTCAGGCCGAACCCCGCCGG - Exonic
1132542869 16:519450-519472 CACCTCCAGCCGGGCTCCTCTGG - Intronic
1132862479 16:2078400-2078422 CACCTCAGGCCGGCCTCTGCTGG + Intronic
1132883556 16:2172681-2172703 CAGCTCCGGCCTACCTCCCCGGG - Intronic
1149997456 17:61412453-61412475 CAGCTCCCGCAGCTCCCCGCCGG + Exonic
1150802223 17:68291393-68291415 CGGCTGCAGCCGGTCTCCGCCGG + Intronic
1152414107 17:80147677-80147699 GGGCTCCGGCGGGTCTGCGCTGG + Intergenic
1152726164 17:81947431-81947453 CTGCTCCAGCGAGTCTCCGCAGG - Intergenic
1154251899 18:12751686-12751708 CAGTTCCGGGCTGTCTCCACTGG + Intergenic
1155319225 18:24602509-24602531 CAGCTCCATCCAGTCTCTGCGGG + Intergenic
1160853717 19:1206559-1206581 AAGCCCCGGCCGGCCTCCCCAGG + Exonic
1160928059 19:1556343-1556365 CGGCCACGGCCGGCCTCCGCGGG - Exonic
1161019054 19:1999284-1999306 TAGCACCGGCCTGTTTCCGCCGG - Intronic
1161123070 19:2540737-2540759 TTGCTCCGGCAGGTCTCCCCGGG - Intronic
1161393626 19:4033594-4033616 CGGCTCCGGCCGCCCTCCCCGGG - Intronic
1163437768 19:17305541-17305563 CAGCTGCGCCCGGCCACCGCGGG + Intronic
1163638015 19:18446325-18446347 CAGCTCCGGCAGCTCTCCCAGGG - Exonic
1164157984 19:22608006-22608028 CAGCCGCGGCCGCTCTCCCCAGG - Intergenic
927141761 2:20135785-20135807 CAGCTGCGGCCGGTTCCAGCAGG + Intergenic
928093429 2:28390459-28390481 CAGCCCCGGCCAGGCGCCGCCGG - Intergenic
939613048 2:144332637-144332659 CTGCGCCGCCCGGACTCCGCTGG + Intergenic
948066970 2:235088059-235088081 CTCCTCCTGCCGGTCCCCGCCGG + Intergenic
948207663 2:236171130-236171152 CAGCTCGGCCCAGTCTACGCGGG + Intergenic
1171427386 20:25057537-25057559 CAGCTCGGGCCGGCGCCCGCGGG - Intronic
1172273429 20:33667235-33667257 CAGCACCGGCCGGTCCCAGCTGG - Exonic
1176248759 20:64110045-64110067 CACCTCCAGCCGGCCTCCCCGGG - Intergenic
1178913753 21:36695892-36695914 GAACTCCGGCCGTTCCCCGCGGG - Intergenic
1180304001 22:11058382-11058404 CAGCCCCGGGCAGTCGCCGCTGG + Intergenic
1180707993 22:17821471-17821493 CAGCCCCATCCGGTCTCCCCAGG - Exonic
1183433431 22:37779784-37779806 CAGCTCCAGCCTGTCCCCGCAGG - Intergenic
1184050333 22:41999189-41999211 CAGCTCCGGCCTCTCTTCGAAGG - Intronic
952784725 3:37141899-37141921 CAGCTCCAGCCAGTTTCCTCTGG + Intronic
955325988 3:58009473-58009495 CAGCTCTGGCCGCGCGCCGCAGG + Intronic
962356041 3:134695103-134695125 CAGCTCAGGCAGGTCCCGGCCGG - Intronic
969325641 4:6442312-6442334 CAGCTCTGCCCGCTCTCAGCAGG + Intronic
969719912 4:8887952-8887974 CAGCTCCGTCCTGGCTCCACAGG + Intergenic
975683265 4:76896986-76897008 CAGCTCCGGCCGGTCTCCGCGGG + Exonic
981007178 4:139888110-139888132 GAGCTCAGGCCTGTCTCTGCAGG + Intronic
988481798 5:31638047-31638069 CAGCGCTGTCCGGTCTGCGCAGG + Intergenic
992690437 5:79236272-79236294 CAGCGCCGGCCTGACCCCGCGGG + Exonic
996378962 5:122845259-122845281 AAGCTCCAGCCGGAGTCCGCAGG + Intronic
1002530156 5:179839669-179839691 CAGCCAAGGTCGGTCTCCGCTGG - Intronic
1018722788 6:166586557-166586579 CAGCTCAGGCCGAACCCCGCCGG + Intronic
1022028175 7:26467792-26467814 CAGCCCTGGGCGGTCTCCTCTGG + Intergenic
1022275798 7:28854311-28854333 CCGCACCTGCCGGTCTCCTCTGG + Intergenic
1022667929 7:32428711-32428733 CAGCTCCGCTAGTTCTCCGCGGG + Intergenic
1025177868 7:56811056-56811078 CACCTCGGGACGGCCTCCGCAGG - Intergenic
1026471291 7:70695270-70695292 CAGCTCCGGCCGAGCCCGGCCGG - Intronic
1035276679 7:157752162-157752184 CAGCTCTGGCCTGGCTCGGCTGG + Intronic
1037561002 8:20074227-20074249 CAGCACAGGCCGGTCACCACAGG + Intergenic
1040523060 8:48194135-48194157 CAGCTCCAGCCAGCCTCCACTGG + Intergenic
1049808507 8:144552350-144552372 CAGCTCCGTCCAGGCTCTGCAGG - Intronic
1056896832 9:90559126-90559148 CAGCTCCAGCCAGTCTCCTGTGG - Intergenic
1060823133 9:126672810-126672832 AAGCTCCTGCCAGGCTCCGCTGG - Intronic