ID: 975683491

View in Genome Browser
Species Human (GRCh38)
Location 4:76897910-76897932
Sequence CGCCCGGCCAGGGTTTCCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975683491_975683503 28 Left 975683491 4:76897910-76897932 CCAGAGGAAACCCTGGCCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 975683503 4:76897961-76897983 GCCGCCCCCATCAGCCGCGGAGG 0: 1
1: 0
2: 0
3: 8
4: 132
975683491_975683497 -3 Left 975683491 4:76897910-76897932 CCAGAGGAAACCCTGGCCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 975683497 4:76897930-76897952 GCGAGTGTCACCTGCGCCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 163
975683491_975683498 0 Left 975683491 4:76897910-76897932 CCAGAGGAAACCCTGGCCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 975683498 4:76897933-76897955 AGTGTCACCTGCGCCCGGGGCGG 0: 1
1: 0
2: 6
3: 90
4: 1071
975683491_975683496 -4 Left 975683491 4:76897910-76897932 CCAGAGGAAACCCTGGCCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 975683496 4:76897929-76897951 GGCGAGTGTCACCTGCGCCCGGG 0: 1
1: 0
2: 1
3: 7
4: 280
975683491_975683502 25 Left 975683491 4:76897910-76897932 CCAGAGGAAACCCTGGCCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 975683502 4:76897958-76897980 CTAGCCGCCCCCATCAGCCGCGG 0: 1
1: 0
2: 0
3: 5
4: 70
975683491_975683495 -5 Left 975683491 4:76897910-76897932 CCAGAGGAAACCCTGGCCGGGCG 0: 1
1: 0
2: 0
3: 5
4: 87
Right 975683495 4:76897928-76897950 GGGCGAGTGTCACCTGCGCCCGG 0: 1
1: 0
2: 0
3: 8
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975683491 Original CRISPR CGCCCGGCCAGGGTTTCCTC TGG (reversed) Exonic
902869265 1:19303824-19303846 TGCCCTCCCAGGGTCTCCTCGGG - Intergenic
905630447 1:39515364-39515386 CGCTCGGCCAGGGTGCCCTGGGG - Intronic
905667314 1:39770825-39770847 CGCTCGGCCAGGGTGCCCTGGGG + Exonic
907974559 1:59418922-59418944 CTACAGGCCAGGGTTTCCTAGGG + Intronic
908401303 1:63774654-63774676 CGCCAGGCCAGGGTTTGCCCCGG + Intronic
908401315 1:63774682-63774704 CGCCAGGCCAGGGTTTGCCCCGG + Intronic
909481127 1:76129821-76129843 CACCCGGCCATGGATTCTTCTGG - Intronic
911618186 1:100037973-100037995 CGCGCGGCCAGGGTAACCGCGGG - Intergenic
912408846 1:109466351-109466373 CGCCTGGCTAGGGTTTCCGACGG + Intergenic
912927019 1:113922124-113922146 CGCCCAGCCAGGGTATCTTTTGG + Intergenic
915458175 1:156053962-156053984 AGCCCGGCCAGGGTCTCGCCAGG + Intergenic
922847320 1:228697368-228697390 CTCCAGGCCAAGCTTTCCTCTGG - Intergenic
924888632 1:248248584-248248606 GTCCCTGCCTGGGTTTCCTCGGG - Intergenic
1069738543 10:70672962-70672984 CACCCGGGCAGGGTTCCCGCGGG + Intronic
1073432327 10:103494422-103494444 CGCGCGGCTCGGGTTTCCTCGGG - Exonic
1074826425 10:117218207-117218229 CGCATTGCCAGGGTTTCTTCCGG - Intergenic
1076445283 10:130509972-130509994 CGTGGGGCCAGTGTTTCCTCTGG + Intergenic
1076785144 10:132745845-132745867 GGCCCGGCCATGGTGGCCTCGGG + Intronic
1076797371 10:132804878-132804900 GGCCCGGCCTGGGTACCCTCGGG - Intergenic
1077494251 11:2878543-2878565 CACCCAGCCAGGATTTCTTCAGG + Intergenic
1077956038 11:7020648-7020670 CGACCTGACAGCGTTTCCTCGGG - Exonic
1084112687 11:67023919-67023941 CACACGGCCAGGGCCTCCTCGGG - Intronic
1084129292 11:67120268-67120290 CTTCGGGCCAGGGCTTCCTCCGG + Intronic
1084642495 11:70434206-70434228 CGCCCGCCCCGTGTTCCCTCAGG + Intronic
1084909121 11:72373340-72373362 CGCCCAGCCGGGGTTGCCGCTGG - Intronic
1095510447 12:42945997-42946019 TGGCTGGCCAGGGTTCCCTCTGG + Intergenic
1121007672 14:90500696-90500718 GGACCTGCCAGGGTTTGCTCAGG - Intergenic
1122267923 14:100555262-100555284 CACCCAGCCCGGGTTTCCACAGG - Intronic
1132316769 15:100895816-100895838 AGCCCGGCCCGGGTTCCCTGTGG + Intronic
1132633040 16:928984-929006 CGCCAGGGCAGGGCTTCCTCTGG - Intronic
1132847067 16:2005575-2005597 CCCCTGGCACGGGTTTCCTCTGG - Intronic
1133286776 16:4694320-4694342 AGCCCGGCCAGGGGACCCTCAGG - Intronic
1137752810 16:50879467-50879489 GGCGGGGCCAGGGTTTCATCAGG + Intergenic
1145969650 17:28949668-28949690 TGCCCGGCCGGGATCTCCTCGGG - Intronic
1146912985 17:36659954-36659976 GGCCCAGCCAAGGTTTCTTCAGG - Intergenic
1147988170 17:44318347-44318369 CACCCAGCCAGGGTTCTCTCGGG + Exonic
1148105715 17:45117885-45117907 CTCTGGGCAAGGGTTTCCTCTGG + Intronic
1152228399 17:79103038-79103060 AGCCTGGCCAGGGTTCCCTGGGG - Intronic
1152610767 17:81314115-81314137 CCCCGGGCCTGGGTTCCCTCTGG - Intronic
1158718354 18:59900253-59900275 CGCCCGGCCTGGGTCTTCGCTGG - Intronic
1160909969 19:1469821-1469843 GGCCCGGCCGGGGCGTCCTCGGG - Exonic
1161232010 19:3179133-3179155 CGCCCGCCCAGTGGTTCCTACGG + Exonic
1161550995 19:4911994-4912016 CGCCCGGCCAGGGGTTTTTGGGG + Intronic
1163433501 19:17282152-17282174 CGCGCGGCCTGCGTTGCCTCGGG + Exonic
1164051129 19:21586553-21586575 CGCCCGGTCAGGGGGTGCTCGGG - Intergenic
1165313332 19:35041176-35041198 CGCCCGGCCGCGGTGACCTCTGG - Intronic
1166410537 19:42553351-42553373 CCCCAGGCCAGTGTCTCCTCAGG + Intronic
1167262567 19:48467403-48467425 AGCCCAGCCTGGGTTTCCACTGG + Intronic
935375207 2:102388524-102388546 CACCTGGCCAGGCTTTCCTGGGG + Intronic
937479692 2:122245204-122245226 CCCATGGCCAGGATTTCCTCTGG + Intergenic
938140499 2:128791151-128791173 CTCCCGGAAAGGGCTTCCTCAGG + Intergenic
942870388 2:180727513-180727535 GGCCTGACCAGGGCTTCCTCTGG + Intergenic
1169883912 20:10376713-10376735 CACCTGGCCTGGGTTTCATCAGG - Intergenic
1174592537 20:51657795-51657817 CATCCGGCCAAGGTTTCCTCTGG - Intronic
1175575580 20:60058246-60058268 CCCCCTCCCAGGGTTTGCTCTGG - Intronic
1180697368 22:17760668-17760690 CGCCGGGCCAGGGCTTCGTGAGG - Intronic
1180801399 22:18633809-18633831 AGCCCTGCCAGGGTTCCCTGCGG + Intergenic
1182070784 22:27462306-27462328 CTCCTGGCCAGGCTGTCCTCTGG - Intergenic
1182283744 22:29232268-29232290 AGCCCGGCCAGGGCTCCCTGGGG - Exonic
1183246791 22:36700052-36700074 GGCCCTGCCAGGCTCTCCTCAGG - Intronic
1183667788 22:39255215-39255237 CGCTGGGACAGGGTTGCCTCAGG - Intergenic
1184340347 22:43882363-43882385 TGTCCGGCCAGGGCTTTCTCAGG - Intronic
949898051 3:8785002-8785024 CTCCCTGCCAGGGCTTCCACAGG + Intronic
951329542 3:21349663-21349685 CGCCCGGCCAGCTTTACATCTGG - Intergenic
954420895 3:50418541-50418563 GGGCCGGTCAGGGTGTCCTCAGG + Intronic
961785839 3:129346154-129346176 CGCTGGGCCAGGGTTTTTTCTGG - Intergenic
968476849 4:814679-814701 CCCCAGGCCAGGTTTTCCCCAGG + Intronic
968703303 4:2066780-2066802 GGCCCGGCCTGGCTTTCCCCGGG - Exonic
970171862 4:13298645-13298667 CGCCCAGCCTGGGATTCTTCCGG - Intergenic
973551248 4:52038140-52038162 CCCCCGGCCAGGGCTCCCGCGGG + Intronic
975683491 4:76897910-76897932 CGCCCGGCCAGGGTTTCCTCTGG - Exonic
983792263 4:171813136-171813158 CGCCAGGCCAGAGATTCCTGGGG - Intronic
987132405 5:14871833-14871855 CGCCCGCCCCTGATTTCCTCCGG - Intergenic
999176994 5:149638779-149638801 CGCCAGTCCTGGGTTTCCCCCGG - Intergenic
1004227608 6:13801071-13801093 AGCCAGGACAGCGTTTCCTCTGG + Intronic
1006025898 6:31146520-31146542 GGCCGGGCTGGGGTTTCCTCAGG + Intronic
1006339311 6:33437950-33437972 CGCCCAGCCAGGGTGGCCACTGG - Exonic
1007235951 6:40391746-40391768 CACCCGGCCGGGGTGTGCTCAGG - Exonic
1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG + Intronic
1011790594 6:90894489-90894511 CACACTGCCAGGGTTTCCTGTGG + Intergenic
1015310862 6:131765791-131765813 CCCCTGGCAGGGGTTTCCTCTGG + Intergenic
1021106734 7:16646348-16646370 CGCCCCGCCGGGGTTTCCATCGG + Intronic
1024597036 7:50947039-50947061 CGCCAGGGCACTGTTTCCTCTGG - Intergenic
1026152818 7:67802620-67802642 AGCCCCGCCAGGGTACCCTCTGG - Intergenic
1032010503 7:128343928-128343950 CTCCCGACCATGTTTTCCTCCGG - Intergenic
1035297930 7:157877397-157877419 TGCAGCGCCAGGGTTTCCTCAGG + Intronic
1035297952 7:157877474-157877496 TGCAGCGCCAGGGTTTCCTCGGG + Intronic
1036793279 8:11737582-11737604 AGCCAGGCCAGGGTTCCCTGGGG + Intronic
1049460735 8:142726599-142726621 CGCCCGGCCGTGATTTGCTCCGG + Intergenic
1061986127 9:134131326-134131348 CTCCAGGCCAGGGTGTCCCCGGG - Intergenic
1062447863 9:136603239-136603261 CGCCAGGCCTCAGTTTCCTCTGG - Intergenic
1189792691 X:44618949-44618971 GGCACTGCCAGGGTTTCCTGGGG - Intergenic
1190106830 X:47567033-47567055 AGCCCAGCCAGCGTGTCCTCGGG + Exonic