ID: 975684058

View in Genome Browser
Species Human (GRCh38)
Location 4:76902341-76902363
Sequence ACTTAGAAGGAGCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975684050_975684058 19 Left 975684050 4:76902299-76902321 CCACATTTACCAAAGAGAGAGGA No data
Right 975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG No data
975684051_975684058 10 Left 975684051 4:76902308-76902330 CCAAAGAGAGAGGAAAAGAAACC No data
Right 975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975684058 Original CRISPR ACTTAGAAGGAGCAGCTGGA GGG Intergenic
No off target data available for this crispr