ID: 975689587

View in Genome Browser
Species Human (GRCh38)
Location 4:76950308-76950330
Sequence CCTGAGCGCCCCCTCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975689587_975689595 29 Left 975689587 4:76950308-76950330 CCCGCGCCGAGGGGGCGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 975689595 4:76950360-76950382 TGTGGCACTGCTGTAGAAGCAGG 0: 2
1: 0
2: 2
3: 14
4: 184
975689587_975689594 11 Left 975689587 4:76950308-76950330 CCCGCGCCGAGGGGGCGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 133
Right 975689594 4:76950342-76950364 GCGAGCTGAAGTGCTGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975689587 Original CRISPR CCTGAGCGCCCCCTCGGCGC GGG (reversed) Intronic
901926624 1:12570371-12570393 CCTGAGGGCCCTCTCTGTGCCGG - Intronic
902044272 1:13513552-13513574 CCCGAGCGCCGCGGCGGCGCAGG + Exonic
902894026 1:19466457-19466479 CCTGAGCTTCCTCACGGCGCAGG + Intronic
903060315 1:20664454-20664476 CCTGAGGGCTCCCTCAGCCCTGG - Exonic
903269066 1:22176579-22176601 CCTGAGCACCCCCTCTGCTGAGG - Intergenic
904006670 1:27366590-27366612 CCTGAGCGCCCCCGCATGGCGGG - Exonic
908527554 1:65002565-65002587 ACTGAGCGCTCCCTGGGTGCAGG - Intergenic
912069792 1:105795770-105795792 TCTGGGCGCCCCCTCGGCCTCGG + Intergenic
915288306 1:154866875-154866897 CCTGAGCTCCCCCTCAGGGGTGG + Intronic
918071156 1:181134161-181134183 CCTGAGCGCCTGCTCTGTGCTGG - Intergenic
920191553 1:204197062-204197084 ACTGAGCGCTTCCTCAGCGCAGG + Intergenic
1063535130 10:6876062-6876084 CCTGAGCTCCTCCTCAGGGCAGG - Intergenic
1064028681 10:11869620-11869642 GCTGCGCGCCCCCTCCCCGCCGG + Exonic
1064552955 10:16521074-16521096 CCTGATCGCCGCCGGGGCGCTGG - Exonic
1065188671 10:23192199-23192221 CCTCCGGGCCCCCTCGCCGCCGG + Intergenic
1066065761 10:31759918-31759940 CCCGAGCGCCGCCTCGGGTCCGG + Intergenic
1067187728 10:44044554-44044576 CCTGGGCGCTCCCTGGGCACCGG + Intergenic
1068746908 10:60542801-60542823 GTTGAGAGCCCACTCGGCGCAGG + Intronic
1070327579 10:75398760-75398782 ACTGACCACCGCCTCGGCGCTGG - Exonic
1070942126 10:80357084-80357106 CCTGAACGCCCCCTCCTCTCTGG - Intronic
1072100693 10:92226779-92226801 CCTGAGCCCCCACTCTGCCCAGG - Intronic
1073249708 10:102114287-102114309 CCTGAGCGCCCCGGCGGCTCTGG + Intronic
1074585971 10:114768144-114768166 CCGGAGCGCCCGCCCGGCCCCGG + Intergenic
1076333876 10:129692056-129692078 CCTGAGCACCCACTGGGTGCTGG - Intronic
1078318033 11:10307909-10307931 CCTGAGCGCCCGCGGGCCGCTGG + Intergenic
1078579058 11:12524931-12524953 CCTGACCCCCGCCTGGGCGCAGG - Intronic
1082772626 11:57220146-57220168 CCTCACGGCCCCCTCGGCTCAGG + Intergenic
1082789736 11:57338945-57338967 CCTGAGCCCTCCCTCGGTGGAGG - Intronic
1083902998 11:65652693-65652715 CCTGGCCGCCCCCCCGGAGCCGG + Intergenic
1084711198 11:70844804-70844826 TCTGAGCGCCCCCATGGCCCTGG + Intronic
1089687937 11:120168890-120168912 ACTAAGCGCCCTCTCCGCGCTGG - Intronic
1093164568 12:15789786-15789808 CCCGAGCGCTCCCTCCGCCCGGG - Intronic
1095949442 12:47773770-47773792 CCTCCGCGCGCCCGCGGCGCTGG + Intronic
1096284146 12:50283549-50283571 CGTGCGCGCCCCCGCGGCGGTGG - Intergenic
1096647616 12:53047266-53047288 CCTCCGCGTCCGCTCGGCGCGGG + Intronic
1097017887 12:56000234-56000256 CCTGAGCCCCCCTTCGCCGTGGG - Intronic
1103915105 12:124372153-124372175 CTTGAGCGCCCCCTCGGCCGTGG + Exonic
1104344417 12:127983243-127983265 TCTGAGCACCTCCTCGGCCCTGG + Intergenic
1104746677 12:131215196-131215218 CCTCAGCGCCCCCTCTGCAGCGG - Intergenic
1115906607 14:38209209-38209231 GCTGTGCGCCCCGCCGGCGCCGG + Exonic
1119535879 14:75402062-75402084 CCTGAGGACCCCCTCGCCCCAGG - Intergenic
1120787962 14:88554551-88554573 CCGGAGCGCGCCCGCGGCCCCGG - Intronic
1121369857 14:93347143-93347165 GCAGAGCGCCCCCTCGTGGCTGG + Intronic
1123199642 14:106650419-106650441 CCTGAGAGCCCCCTGGGCTCCGG + Intergenic
1126890263 15:53197497-53197519 CGAGAGCGCCCCCTAGGCGCTGG + Intergenic
1129918246 15:79294052-79294074 CCTGATAGCGCCCTCGGTGCTGG + Exonic
1132549706 16:549291-549313 CCTGAGCGCCCTGGCGGTGCTGG + Exonic
1132663362 16:1071193-1071215 GCTGAGCTCCCACTGGGCGCTGG + Intergenic
1132994741 16:2817195-2817217 CCGGGGCGCCCCCTGGGGGCGGG - Intronic
1136543509 16:30942353-30942375 CCTGACTGCCCCCTCTCCGCAGG + Exonic
1136585153 16:31179846-31179868 CCTGAGTGCCCGCTGGGGGCGGG - Intergenic
1142847942 17:2691125-2691147 CCTCAGCCCCCCCCCGCCGCAGG + Intronic
1142917536 17:3154147-3154169 CCTCAGGGCCCCCTCTGCCCAGG - Intergenic
1147998498 17:44374658-44374680 CCTGAGCTTCCCCTCGGGGCAGG + Exonic
1148759696 17:49993361-49993383 CCCGCGCGCCCCCGCGGCCCTGG + Intronic
1151858270 17:76737955-76737977 CCTGACCGCAGCCGCGGCGCCGG - Exonic
1152355410 17:79804401-79804423 GCTGAGCCACCCCTCGGCCCAGG - Intergenic
1152808877 17:82371895-82371917 CCCTCGCGCCCCCTCTGCGCTGG + Intergenic
1154070531 18:11148702-11148724 CCCGAGCATCGCCTCGGCGCGGG + Intronic
1155519804 18:26656795-26656817 TCTGGGCGCCCCCGCGGCGCTGG + Intronic
1157535353 18:48453430-48453452 CCAGAGAGCCCCCTGGGGGCTGG + Intergenic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160500576 18:79399682-79399704 CCTGCGCGCCCCCGCCCCGCGGG - Intronic
1160578520 18:79870481-79870503 GCTGCGCGCTCCCTCTGCGCTGG + Intronic
1160767598 19:815331-815353 CCTGAGCGCCCCCTCCCTGTTGG - Intronic
1160767608 19:815362-815384 CCTGAGCGCCCCCTCCCTGTGGG - Intronic
1161103276 19:2431854-2431876 CCACAGCCCCCCCTCGACGCTGG - Exonic
1162315581 19:9936403-9936425 CCCTAGCGGCGCCTCGGCGCGGG + Exonic
1162802350 19:13118433-13118455 CCGGAGCGCGGCCACGGCGCAGG + Exonic
1163027046 19:14518478-14518500 CCCGCCCGCCCCCGCGGCGCCGG + Intronic
1167239362 19:48334020-48334042 CTTGAGTGCCCCCTGGCCGCCGG + Exonic
1167357803 19:49014811-49014833 CCTGACCACCCCCAGGGCGCTGG - Intronic
1167964479 19:53132356-53132378 CCTGAGCACCTCCCCAGCGCGGG + Intronic
928904372 2:36355468-36355490 CCGCAGCGCACCCGCGGCGCCGG + Intergenic
930096464 2:47570348-47570370 CCCGAGCGCCGCCCCGGCCCCGG - Exonic
931391864 2:61851447-61851469 CCTCAGCGCCCCCTAGTAGCTGG + Intronic
931614618 2:64143934-64143956 CCTGCGCGCCCCCGCTGCGGCGG - Intronic
931869801 2:66445552-66445574 CCGGAGCGCACCCTCTGCGGAGG - Intronic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
934520614 2:95018028-95018050 GCTGAGCGGCCCCTCCGTGCTGG - Intergenic
935196682 2:100820381-100820403 CCGGAGCGGCCCCGCGGGGCCGG - Exonic
936248789 2:110851698-110851720 CCTGAGAGCCCTCAGGGCGCTGG + Intronic
938236139 2:129708668-129708690 CCTGAGCACCCTCTTGGCGCGGG - Intergenic
940954558 2:159712939-159712961 CCTGAGCCCTCCTTTGGCGCGGG + Intronic
948646751 2:239410115-239410137 CCTGAGCTCCCCATGGGCTCAGG + Intergenic
948761048 2:240191212-240191234 GCTGAGCACCGCCTTGGCGCTGG + Intergenic
1169216535 20:3797471-3797493 CCTGAGGGCCCCCTCTTCTCAGG - Intronic
1170756939 20:19212999-19213021 CCGCAGCGCCCACTCGGGGCAGG - Intronic
1171779668 20:29408067-29408089 CCTGAGCGTCCCGCCGTCGCCGG - Intergenic
1175803929 20:61816856-61816878 CCTGAGCGTCCCCACCGGGCAGG - Intronic
1176016914 20:62938436-62938458 CCTGACTGCCCCCTGGGCACCGG - Intronic
1179411837 21:41168314-41168336 CCTGCGCGCCGCCCCGGAGCTGG + Exonic
1179791751 21:43759879-43759901 TCTGGGAGCCCCCTCGGCCCTGG - Exonic
1180783455 22:18534492-18534514 CCTGGGCGCCACCTGGGGGCAGG + Intergenic
1184152968 22:42649221-42649243 CCAGCCCGCCCCCTCGCCGCCGG + Intronic
1184229606 22:43151583-43151605 CCGGAGCGTGCCCTCGCCGCTGG + Intronic
950111213 3:10419903-10419925 CCTGAGCACCCCATTGTCGCAGG - Intronic
953526073 3:43691073-43691095 CCGGCGCGCACCCTCCGCGCGGG + Intronic
956414724 3:69013736-69013758 CCCGAGCCCGCCCACGGCGCCGG - Exonic
959067893 3:101676571-101676593 CCAGCCCGCCCCCTCGCCGCGGG + Intronic
963116888 3:141738144-141738166 CCTGCCCGCCCCCCTGGCGCTGG + Intergenic
968003249 3:195222030-195222052 CCTGATCGCCCCCTTGGAGCAGG - Intronic
968487046 4:867775-867797 CCTCAGCGCCTCCTTGGCCCAGG + Intronic
968505955 4:971646-971668 CCTGAGCACCCCGCCGGCTCAGG - Intronic
968965239 4:3766211-3766233 CCTGAGCGGCCCCGCGGTCCCGG - Intergenic
975689587 4:76950308-76950330 CCTGAGCGCCCCCTCGGCGCGGG - Intronic
986065585 5:4230773-4230795 CCAAAGTGTCCCCTCGGCGCTGG + Intergenic
991594472 5:68288582-68288604 CCTGCGCGCACTCTCGGCGCCGG + Intronic
997105005 5:131008450-131008472 CCTGAGCCCTCCGTCGCCGCCGG - Intergenic
1000602009 5:163286421-163286443 CCTGAGCTACCCCTTGGGGCTGG - Intergenic
1002140232 5:177133527-177133549 CCTGCGCGCCCGCTCGCGGCCGG - Intronic
1005529610 6:26689745-26689767 CGTGAGCGCCTGCGCGGCGCTGG - Intergenic
1005541186 6:26811902-26811924 CGTGAGCGCCTGCGCGGCGCTGG + Intergenic
1006671417 6:35731878-35731900 CCTGCGCGCCTCCTAGGCGGGGG - Intergenic
1007362476 6:41369010-41369032 CCTGCGCCCCCTGTCGGCGCTGG + Intergenic
1007781620 6:44257659-44257681 CCTGGGCTGCCCCTGGGCGCGGG + Intronic
1016590108 6:145735152-145735174 CCGGAGCTCCCGCTCTGCGCCGG + Intronic
1019740698 7:2671508-2671530 CCTGAGCAGTCCCTGGGCGCTGG - Intergenic
1020106160 7:5423267-5423289 CCGGGGCGCCCCCTCCCCGCCGG + Intronic
1020260150 7:6526520-6526542 CCTGCGCGCGCCCCCGGGGCCGG + Exonic
1021828073 7:24573811-24573833 GCCGAGCGCCCCTTCCGCGCGGG - Intronic
1023939744 7:44761914-44761936 CAGCACCGCCCCCTCGGCGCAGG - Intronic
1024394282 7:48848149-48848171 CCTGAGAGCCCGCGCGGCGCTGG - Intergenic
1024400981 7:48924496-48924518 CCTGAGAGCCCGCGCGGCACTGG + Intergenic
1029447344 7:100621126-100621148 CCTGATCCCCCTCTCTGCGCAGG - Exonic
1029640161 7:101815651-101815673 CTCCAGCGCCCCCTCGGGGCCGG + Intergenic
1031629875 7:124033109-124033131 CCTGCGCGCCCCCCGGGGGCCGG - Intergenic
1034468865 7:151245424-151245446 CCTGCACGCCCCCTCCTCGCCGG + Intronic
1036767931 8:11560703-11560725 CCTGGGTGCCCCCACGGGGCAGG + Intronic
1038752683 8:30311888-30311910 CCTGGGCTCCCCCTCTGCCCAGG - Intergenic
1040471414 8:47738226-47738248 CCGGGGCGCCCCCGCGGTGCCGG - Exonic
1040545858 8:48397274-48397296 CCGGGGCGCCCCCTCTGCACAGG + Intergenic
1045547389 8:103140872-103140894 GCTGGGCGCTCCCGCGGCGCAGG + Exonic
1049212231 8:141392093-141392115 CCTCCGCGCCCGCTCGGGGCGGG + Intronic
1053198484 9:36137211-36137233 CCTGAGCGCCCGCGCCGTGCCGG + Intronic
1053312084 9:37026617-37026639 CCTGGGCAGCCCCTTGGCGCCGG - Intronic
1056992437 9:91424003-91424025 CCTCAGCTCCCCCTCCGCGGCGG + Intergenic
1057619117 9:96619450-96619472 CCCGAGCGCCCGCGCGGGGCTGG - Exonic
1060280621 9:122213552-122213574 CCTCCGCGCCCCCTCCCCGCAGG + Intronic
1061234381 9:129334163-129334185 CCGGAGCTCCCCCTGGGTGCTGG - Intergenic
1061834575 9:133320442-133320464 CCTGAGCGCCTCCTCCTGGCAGG - Intergenic
1062162502 9:135087921-135087943 CCTGAAGGCCGCCTGGGCGCGGG + Exonic
1062200392 9:135299813-135299835 GCTGAGTGCCCCCTCCGTGCAGG - Intergenic
1185642363 X:1595543-1595565 CGGGAGCGGGCCCTCGGCGCTGG + Intronic
1199772560 X:150983926-150983948 CCTGCGGGCCCGCGCGGCGCCGG - Intronic