ID: 975689790

View in Genome Browser
Species Human (GRCh38)
Location 4:76951194-76951216
Sequence TGAACTTCTCCCGAGGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975689790_975689801 12 Left 975689790 4:76951194-76951216 CCTACCCCCTCGGGAGAAGTTCA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 975689801 4:76951229-76951251 CGGATTCTAATTCGATTTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 34
975689790_975689802 17 Left 975689790 4:76951194-76951216 CCTACCCCCTCGGGAGAAGTTCA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 975689802 4:76951234-76951256 TCTAATTCGATTTGGTGGTTCGG 0: 1
1: 0
2: 0
3: 13
4: 72
975689790_975689803 27 Left 975689790 4:76951194-76951216 CCTACCCCCTCGGGAGAAGTTCA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 975689803 4:76951244-76951266 TTTGGTGGTTCGGCTGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 62
975689790_975689800 9 Left 975689790 4:76951194-76951216 CCTACCCCCTCGGGAGAAGTTCA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 975689800 4:76951226-76951248 TTGCGGATTCTAATTCGATTTGG 0: 1
1: 0
2: 1
3: 3
4: 27
975689790_975689797 -8 Left 975689790 4:76951194-76951216 CCTACCCCCTCGGGAGAAGTTCA 0: 1
1: 0
2: 0
3: 6
4: 69
Right 975689797 4:76951209-76951231 GAAGTTCATGGGTCCCTTTGCGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975689790 Original CRISPR TGAACTTCTCCCGAGGGGGT AGG (reversed) Intronic
903355813 1:22746777-22746799 TGACCTTCCCACGAGGGTGTAGG + Intronic
912055815 1:105596981-105597003 TGAATTTCTCCCCAGGAAGTGGG - Intergenic
912709694 1:111941550-111941572 TGAACCTCTCCAGAAGGGATGGG - Intronic
916896838 1:169172167-169172189 AGAACTGCTCCAGAAGGGGTAGG - Intronic
924502305 1:244649374-244649396 TGAACATCTCCCGGGGGGGCTGG - Intergenic
1065124781 10:22563917-22563939 CAAACATCTCCCTAGGGGGTAGG - Intronic
1083655122 11:64225837-64225859 TGAACTTCTCTGGAGGAGGGAGG - Exonic
1084656775 11:70524222-70524244 TGCACTGCCCCCCAGGGGGTGGG - Intronic
1089961895 11:122623923-122623945 AGAACTTCTCCTGAGGGAGCAGG - Intergenic
1094243525 12:28258678-28258700 TTAACTTCTCCTTAAGGGGTTGG + Intronic
1094664612 12:32506648-32506670 TGAATGTCTCCTTAGGGGGTGGG - Intronic
1100722680 12:97375283-97375305 TGAACTAATCACGAGGAGGTTGG - Intergenic
1117876023 14:60250025-60250047 AGAACTTTTCCCGAGCGGGGAGG + Intronic
1121123113 14:91388780-91388802 TGAACTTCTCCCTTTGGGGCTGG + Intronic
1121222831 14:92299368-92299390 TGACCTTCCCCTGTGGGGGTGGG + Intergenic
1129900268 15:79142658-79142680 TGAACTTCTGGAGAGTGGGTGGG + Intergenic
1133818056 16:9213215-9213237 TGTACTTCTCCCGTGGCAGTGGG - Intergenic
1136690463 16:32024890-32024912 TGGGCTTCCCCCGAGCGGGTGGG + Intergenic
1139361781 16:66403955-66403977 AGGCCTTCTCCAGAGGGGGTGGG - Exonic
1142764124 17:2056234-2056256 GCAACTTCTCCCGAGGCGGGAGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147864008 17:43541187-43541209 TGGCCTTCTCCCAAAGGGGTAGG + Intronic
1155165488 18:23228804-23228826 TGAACTTCTGCAGAGGCTGTAGG - Intronic
1155960620 18:31991826-31991848 TGCACCTCTCCCGTGGGGATAGG + Intergenic
1156460892 18:37320767-37320789 TGCCCTTCTCCCAAGGAGGTGGG + Intronic
1165388112 19:35523601-35523623 TGTGCTTCTCCCGAGGGGCGGGG - Intronic
1166835319 19:45664150-45664172 TAAACTTCTCCCAAGGTGCTGGG + Intergenic
928115003 2:28540069-28540091 GGAAGCTCTCCCTAGGGGGTGGG - Intronic
938112236 2:128576528-128576550 TGAACCTCTCCCCAGAGGGGTGG + Intergenic
1170026911 20:11898747-11898769 TGAACTTCTCCCTTGCTGGTGGG - Intronic
1171173395 20:23034698-23034720 TGCACTTGTCCAGAGTGGGTTGG + Intergenic
1172117725 20:32582525-32582547 TCGACTTCTCCCTAGGGAGTGGG - Intronic
1176120489 20:63452434-63452456 TGACCCTCTGCCGTGGGGGTGGG - Intronic
1182342256 22:29632826-29632848 TGAACATCTCCCGAGACTGTAGG - Intronic
1184164125 22:42717437-42717459 TGATCTTCCCCAGAGGGAGTTGG - Intronic
1184528967 22:45042428-45042450 TGTACAGCACCCGAGGGGGTGGG - Intergenic
952004490 3:28826867-28826889 TGAACTTCTCCCTGGTGGGTTGG + Intergenic
975689790 4:76951194-76951216 TGAACTTCTCCCGAGGGGGTAGG - Intronic
980671036 4:136008202-136008224 GGAACTGCACCCGAGAGGGTTGG - Intergenic
982565906 4:156986480-156986502 TGAACTCCTCCCCAGGGGTGGGG + Intergenic
987331748 5:16863286-16863308 TGGGCTTCTCCCCAGTGGGTGGG - Intronic
991742569 5:69697030-69697052 TGAATTTCTCCCAAGAGCGTGGG - Intergenic
991755125 5:69858174-69858196 TGAATTTCTCCCAAGAGCGTGGG + Intergenic
991794142 5:70276768-70276790 TGAATTTCTCCCAAGAGCGTGGG - Intergenic
991821959 5:70572343-70572365 TGAATTTCTCCCAAGAGCGTGGG - Intergenic
991834452 5:70733322-70733344 TGAATTTCTCCCAAGAGCGTGGG + Intergenic
991886520 5:71276310-71276332 TGAATTTCTCCCAAGAGCGTGGG - Intergenic
997470870 5:134115986-134116008 TGCCCTGCTCCCGAGGGGGGTGG - Exonic
1002924139 6:1595101-1595123 TGAGCTTGTCACGGGGGGGTGGG + Intergenic
1004841166 6:19586918-19586940 TGAACATCTTTGGAGGGGGTGGG - Intergenic
1005626958 6:27671483-27671505 TAAACTTCTCCCTAGTGAGTGGG - Intergenic
1006738852 6:36293306-36293328 TGAACTTCTCCAGCTGGGGTGGG + Intronic
1007415128 6:41687217-41687239 GGTACTTCTCCCCATGGGGTGGG - Intronic
1012180129 6:96142616-96142638 TGAACTTCTCAGGTGGGGGTGGG - Intronic
1016372690 6:143391353-143391375 GGAACTTCACCCGAGTGGGCAGG - Intergenic
1019914327 7:4122965-4122987 TGAACTTCTCACGTGGAGATAGG - Intronic
1028533615 7:91865914-91865936 TTAACTTCACCCTAGGGGATTGG + Intronic
1033986012 7:147226475-147226497 TGAACTCTTCCCGGGGTGGTAGG + Intronic
1034035484 7:147816141-147816163 TGAACTTCTCCTGTGTGGATGGG - Intronic
1034070961 7:148184487-148184509 TGTGCTTCTCCCTAGGGAGTTGG + Intronic
1034162209 7:149002076-149002098 CCAACTTCTCCCGAGGGTCTTGG + Intergenic
1035602748 8:906378-906400 TGAATCCCTCCTGAGGGGGTGGG + Intergenic
1045465644 8:102467358-102467380 TGCACTTCTCCCGAGCAGGTGGG - Intergenic
1047826881 8:128585974-128585996 TGAACTTCTCTCCAGGGAGTAGG - Intergenic
1051022392 9:12559702-12559724 TTAACTTCTCCCCAGGGGAAAGG - Intergenic
1052502974 9:29316759-29316781 TGAAATTCACCCAAGTGGGTTGG + Intergenic
1052985725 9:34485931-34485953 AGAACTTCTCCAGTGGGGCTGGG - Intronic
1053325519 9:37144858-37144880 TCAACTGCTCCAGAAGGGGTGGG - Intronic
1058607637 9:106740606-106740628 TGAACTTCTCCCCAGGAAGCTGG - Intergenic
1058709549 9:107667486-107667508 TGGACTTATCCCAAGGGGCTCGG + Intergenic
1061850339 9:133411228-133411250 GGCACTTCTCCCAGGGGGGTGGG - Intronic
1062019093 9:134307846-134307868 TGAACTTCACCCGATGTGGGTGG - Intergenic
1062160311 9:135076070-135076092 TGAACTTCTCAGCAGGGAGTCGG - Intronic
1062332899 9:136052398-136052420 TGAACTCCTCCAGCGAGGGTGGG + Intronic
1190287265 X:48969966-48969988 TGAACTTCTACCGAACGGGGCGG - Exonic
1200898279 Y:8400086-8400108 TGGACTTCTCCCGAGGGTAGAGG + Intergenic