ID: 975692864

View in Genome Browser
Species Human (GRCh38)
Location 4:76983085-76983107
Sequence TGCAGAGCGTGTACACCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 129}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975692864_975692871 12 Left 975692864 4:76983085-76983107 CCCCCTGGTGTACACGCTCTGCA 0: 1
1: 0
2: 3
3: 14
4: 129
Right 975692871 4:76983120-76983142 CTTGTGAATATCACTCCCACAGG No data
975692864_975692872 16 Left 975692864 4:76983085-76983107 CCCCCTGGTGTACACGCTCTGCA 0: 1
1: 0
2: 3
3: 14
4: 129
Right 975692872 4:76983124-76983146 TGAATATCACTCCCACAGGTAGG 0: 1
1: 0
2: 1
3: 9
4: 127
975692864_975692873 22 Left 975692864 4:76983085-76983107 CCCCCTGGTGTACACGCTCTGCA 0: 1
1: 0
2: 3
3: 14
4: 129
Right 975692873 4:76983130-76983152 TCACTCCCACAGGTAGGTTATGG 0: 1
1: 0
2: 0
3: 4
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975692864 Original CRISPR TGCAGAGCGTGTACACCAGG GGG (reversed) Intronic
900688428 1:3964517-3964539 TGCATACCACGTACACCAGGTGG - Intergenic
904198571 1:28804292-28804314 TTCAGAGCCTGTGCCCCAGGGGG - Intergenic
905245224 1:36608272-36608294 TACAGGGCATGTACACAAGGGGG - Intergenic
905418173 1:37819084-37819106 TGCAGAGGGTCCACACCAGGAGG + Intronic
916310617 1:163394913-163394935 TGCACAGCATGTATCCCAGGGGG - Intergenic
920077000 1:203344502-203344524 AGCAGGGCGGGTACACCAGTAGG - Intronic
922375662 1:224962169-224962191 TACAAAGCATGTACACCAGAGGG - Intronic
924081150 1:240399790-240399812 GGCAGAGATTCTACACCAGGAGG + Intronic
1062960445 10:1569395-1569417 TGCAGAACGTGAGCAGCAGGAGG + Intronic
1066220773 10:33335189-33335211 TGCAGAGCGAGCACGCGAGGTGG - Intronic
1066270290 10:33815916-33815938 TGCATAGGGTGTACACCAAGTGG - Intergenic
1069821675 10:71232402-71232424 TGCAGAGGGAGTGCACAAGGAGG + Intronic
1073669223 10:105568809-105568831 TGCATGGAGTGTACACCAAGTGG + Intergenic
1075717658 10:124566311-124566333 AGCAGAGTGTGTCCCCCAGGGGG - Intronic
1075971712 10:126660139-126660161 TGTAGGGCGTGTACACCAAGGGG - Intronic
1076992222 11:281435-281457 TTCAGAGCGTGTGAAGCAGGAGG + Exonic
1078023295 11:7672811-7672833 TGAAGAGCATGAACTCCAGGAGG - Exonic
1078859412 11:15233534-15233556 TACAGAGCCTGTACCCCATGTGG - Intronic
1082756345 11:57080299-57080321 CACAGAGCATGCACACCAGGAGG - Intergenic
1082774689 11:57236191-57236213 TGTACAGCGTCTTCACCAGGTGG + Exonic
1083169140 11:60912266-60912288 TACAGAGTGTGTACTCTAGGAGG + Intergenic
1084185058 11:67467238-67467260 GGCAGAGCCTGTACAAAAGGAGG + Intronic
1084461432 11:69298698-69298720 AGCAGGGCGTGGAGACCAGGAGG + Intronic
1095580140 12:43788223-43788245 TACAGAGCATGTACAGCGGGAGG + Intronic
1098925809 12:76348525-76348547 TGCAGGGCTTTTCCACCAGGCGG - Intergenic
1100651561 12:96595338-96595360 TACAGGGCATGTACACCAGGGGG + Intronic
1102165108 12:110799779-110799801 TACAGGGTATGTACACCAGGAGG + Intergenic
1102623167 12:114213146-114213168 TGCAGAGTGTGGTCAGCAGGTGG - Intergenic
1107525073 13:41222422-41222444 TTCACAGTGTGTACACCAGGGGG - Intronic
1109153499 13:58874255-58874277 TCAAGAGCCTGGACACCAGGTGG - Intergenic
1116266225 14:42694056-42694078 TGCAAAGCGTGTAGACCAGGTGG + Intergenic
1119676777 14:76561697-76561719 TGCATGGGGTGTACACCAAGTGG - Intergenic
1120286940 14:82515137-82515159 TGCATGGGGTGTACACCAAGTGG + Intergenic
1125488511 15:40128930-40128952 TGGAGAGGGTGTACACCCGTAGG - Intergenic
1125972981 15:43927227-43927249 TCAAGAGCCTGGACACCAGGTGG + Intronic
1126858593 15:52862227-52862249 TGCAGAGCCTGAAGACCTGGGGG - Intergenic
1132469963 16:97064-97086 TGCACAGCATGGCCACCAGGGGG - Intronic
1134491916 16:14702076-14702098 TGCCAAGATTGTACACCAGGTGG - Intergenic
1134497297 16:14741198-14741220 TGCCAAGATTGTACACCAGGTGG - Intronic
1135156857 16:20059944-20059966 TGCAGAGGGAGGACACAAGGTGG + Intronic
1141317495 16:82976193-82976215 TCCAGAGTGGGTACACCAGGGGG + Intronic
1141464251 16:84196004-84196026 TGTAGAGTGGGGACACCAGGTGG - Exonic
1142043818 16:87912617-87912639 CGCAGAGCGTGGAATCCAGGAGG + Intronic
1143459571 17:7093024-7093046 TGCAGTGAGTGTACAGCTGGTGG - Intergenic
1143923518 17:10349598-10349620 TACAAGGCATGTACACCAGGGGG - Intronic
1147702542 17:42404926-42404948 TGGAGCGCGCGTACACCACGTGG + Exonic
1152046807 17:77942090-77942112 TGCAGGGCTTTTACACCACGGGG - Intergenic
1153435842 18:5067097-5067119 TCCAGAGTGTATACACCAGAGGG - Intergenic
1153528246 18:6017632-6017654 TGCAGAGAGTGCACACCAGTGGG + Intronic
1153690697 18:7590395-7590417 TCCAGAGTGTGCACACCTGGAGG + Intronic
1157843331 18:50979634-50979656 TGTAGGACGTGAACACCAGGAGG + Intronic
1158876645 18:61740327-61740349 TGCTGAGCTTGCAAACCAGGTGG - Intergenic
1161138397 19:2634116-2634138 GGCAGACGGTGTAAACCAGGAGG - Intronic
1163532050 19:17855752-17855774 TGCCGCGAGTGTCCACCAGGTGG - Intergenic
1164025664 19:21349821-21349843 TGAATAGCTTGTACTCCAGGTGG - Intergenic
1164457702 19:28422124-28422146 TGCATGGGGTGTACACCAAGTGG - Intergenic
1166752276 19:45170047-45170069 TGCAGAGCCTGCCCTCCAGGAGG + Intronic
925304678 2:2839834-2839856 TGCAGAGCGTGCTTAACAGGGGG - Intergenic
926214949 2:10900385-10900407 TACAGAAGGTGGACACCAGGGGG - Intergenic
927148465 2:20181943-20181965 TTCAGAGGGTGTAGACCAGATGG + Intergenic
932281244 2:70493852-70493874 TGTAGAGCGTATACACGAGTTGG - Intronic
932775843 2:74527936-74527958 TGCACTCCGTGTACAACAGGTGG - Exonic
935453365 2:103236562-103236584 TATAGAGTGTGCACACCAGGTGG + Intergenic
938725644 2:134106695-134106717 CGCAGAGCTTGTAAATCAGGGGG + Intergenic
943482379 2:188436122-188436144 TACAGGGTGTGTACACCAGGTGG + Intronic
943784479 2:191861921-191861943 TGGAAAGAGTGTAGACCAGGAGG - Intergenic
947829046 2:233125898-233125920 TGCAAAGCATGGACACCAGTGGG + Exonic
1178527875 21:33347761-33347783 TACAGGATGTGTACACCAGGGGG + Intronic
1178665652 21:34544164-34544186 TGCAAAGCTTGTCCACCAGGGGG - Intronic
1180049087 21:45323227-45323249 GCCAGAGCGGGTACTCCAGGCGG + Intergenic
1181481815 22:23204764-23204786 TGCAGAGCGTGGGCAGCGGGAGG + Intronic
1181773045 22:25140603-25140625 CACAGGGCGTGAACACCAGGAGG + Intronic
1184693283 22:46127122-46127144 TGCAGAGGGTGGGCAGCAGGAGG - Intergenic
1185075569 22:48680363-48680385 TGCATGGCGGGTACAGCAGGAGG - Intronic
949552375 3:5122170-5122192 TGCGGAGCATGCCCACCAGGTGG + Intergenic
949836718 3:8278125-8278147 TGCAGAGCCTGAACCCCAAGAGG + Intergenic
950234389 3:11306140-11306162 TGTAGAGTGTGTAAACCTGGTGG + Intronic
953384065 3:42495527-42495549 TACAGGGTGTGCACACCAGGAGG - Intronic
953662750 3:44902869-44902891 TGCAGAGGGAGTAGACGAGGTGG + Intronic
954131910 3:48565184-48565206 TGCAGAGCGGGTACCCCCTGAGG - Exonic
954446609 3:50550285-50550307 TTCTGAGTGTGAACACCAGGTGG - Intergenic
961077683 3:123997094-123997116 TACAGGGCATGTACACCAGGGGG + Intergenic
968917254 4:3501959-3501981 TGCAGAGCGGGGGCGCCAGGAGG - Intergenic
970869332 4:20797450-20797472 TGCAGGGCATACACACCAGGAGG - Intronic
971918767 4:32909875-32909897 TGCAGATGGTCCACACCAGGAGG + Intergenic
975692864 4:76983085-76983107 TGCAGAGCGTGTACACCAGGGGG - Intronic
975917188 4:79339639-79339661 TACAGGGTGTGTACACCAGAGGG + Intergenic
977658965 4:99561300-99561322 TACAGGTCATGTACACCAGGGGG + Intronic
979585062 4:122405571-122405593 TGGAGAGCAGGTAGACCAGGAGG - Intronic
982116812 4:152104996-152105018 TGCTGAGAGTGTATGCCAGGAGG - Intergenic
983164099 4:164452783-164452805 GGCAGAGGGTGTCTACCAGGTGG - Intergenic
984345719 4:178522183-178522205 TACAGAGCATATACACCAGAGGG - Intergenic
984717367 4:182938273-182938295 TGCTCAGCGTGGACTCCAGGGGG + Intergenic
986708811 5:10472689-10472711 TACAGGGCGTGTTCACCAGGAGG + Intergenic
986808993 5:11336048-11336070 TGCATTGGGTGTACACCAAGTGG + Intronic
986898590 5:12402890-12402912 TGCATAGTGGGAACACCAGGAGG - Intergenic
987191957 5:15487684-15487706 TGCAGAGGGTCTCCACCAGCAGG - Intergenic
987532227 5:19135895-19135917 TACAAAGCATGTACTCCAGGGGG + Intergenic
989172101 5:38482053-38482075 TGCAGAGCCTGAAAACCATGTGG - Exonic
989350733 5:40483312-40483334 GGCAAAACATGTACACCAGGTGG - Intergenic
991178418 5:63719117-63719139 TACAGGATGTGTACACCAGGGGG - Intergenic
995886559 5:116901147-116901169 TGCAGAGTGTGTAACCAAGGTGG + Intergenic
997686622 5:135793025-135793047 CACAGTGGGTGTACACCAGGTGG + Intergenic
1006610697 6:35292627-35292649 TGCAGTGTGTGTGCACCACGTGG - Exonic
1007734949 6:43976076-43976098 TATAGGGCATGTACACCAGGAGG - Intergenic
1009985846 6:70780143-70780165 TACAGAGTGTATATACCAGGGGG + Intronic
1010345604 6:74806549-74806571 AGCAGAGTGTGAACACCCGGAGG - Intergenic
1010559535 6:77333056-77333078 TGCGGAGCGTGCAGCCCAGGCGG - Intergenic
1012915743 6:105168588-105168610 TACAGGGCATGTATACCAGGAGG - Intronic
1014906466 6:127035317-127035339 TGTAGTGCATGTACACCAAGTGG + Intergenic
1018421514 6:163644245-163644267 TGCAGGGTGTGTACACCAGTGGG + Intergenic
1018918784 6:168156254-168156276 AACACAGCGTGTGCACCAGGGGG - Intergenic
1020260181 7:6526609-6526631 TGGCGCGCGTGGACACCAGGAGG + Exonic
1023997749 7:45172285-45172307 TGTAGAGCCTGTACTCCAGTGGG - Intronic
1024045160 7:45580766-45580788 TGCTGAGTGTGGCCACCAGGAGG + Intronic
1024509791 7:50194764-50194786 TGGCGAGCGTGTACAGAAGGTGG + Intergenic
1030585611 7:111414903-111414925 TTCAGAGTGTGTGCACCAGTGGG - Intronic
1030650339 7:112110526-112110548 TGAAGATCGTGTTCACCATGTGG - Intronic
1031552933 7:123137252-123137274 TACAAGGCATGTACACCAGGAGG - Intronic
1034566778 7:151921749-151921771 TGCAGAGCGAGTGAGCCAGGAGG + Intergenic
1034919939 7:155071334-155071356 TGCGGAGCGTGTATTCCATGTGG - Exonic
1037137158 8:15476788-15476810 TGCATGGGGTGTACACCAAGTGG - Intronic
1037949049 8:23007019-23007041 CGCAGAGCGGGTCCTCCAGGAGG - Exonic
1042334964 8:67620390-67620412 TTCAGGGCATGTACACCAGAGGG + Intronic
1044566369 8:93665119-93665141 CACAGTGGGTGTACACCAGGTGG + Intergenic
1044706266 8:95011580-95011602 TCAAAAGAGTGTACACCAGGAGG - Intronic
1045034283 8:98165330-98165352 TGCACACTGTATACACCAGGTGG + Intergenic
1045607148 8:103789585-103789607 ACCAGGGTGTGTACACCAGGTGG + Intronic
1046773225 8:118137162-118137184 TGCATAGAGTGAACACCAAGTGG - Intergenic
1047523610 8:125614657-125614679 TGCAGAGCATGCACGCTAGGAGG + Intergenic
1047750057 8:127873662-127873684 TGCATACTGTGTACACCAAGAGG - Intergenic
1048441741 8:134464494-134464516 TGCAGGGCGAGTACTCCAGGGGG - Intergenic
1049247765 8:141571838-141571860 AGCAGAGCGTGGGCTCCAGGAGG - Intergenic
1049553636 8:143271871-143271893 TGCAGAGCGGGGAGACCAGGCGG + Intronic
1051473609 9:17477758-17477780 TTCACAGCGTTTTCACCAGGAGG - Intronic
1052569550 9:30201836-30201858 TGCAGAGAATATATACCAGGGGG - Intergenic
1052659031 9:31404314-31404336 TGCAGGGCATATACACCATGGGG + Intergenic
1055553807 9:77455490-77455512 TGCAGGACGTGTACACCAGGGGG + Intronic
1056078787 9:83068305-83068327 TGCAGAGCATGTACACCAAGGGG - Intergenic
1062416554 9:136454153-136454175 TGCAGAGGTGGCACACCAGGTGG + Exonic
1189569807 X:42284491-42284513 TATAGGGCATGTACACCAGGAGG + Intergenic
1197229641 X:123990212-123990234 TGCATGGGGTGTACACCAAGTGG - Intronic
1198208485 X:134492759-134492781 TTCTGTGTGTGTACACCAGGAGG + Intronic
1198309508 X:135416600-135416622 TCAAGAGCGTGGACACCAGCTGG - Intergenic
1198509026 X:137330577-137330599 TGCAGGGCTTGTATCCCAGGGGG + Intergenic
1199545859 X:149006818-149006840 TGCAGGGTGTGCATACCAGGGGG + Intergenic
1200953215 Y:8920590-8920612 TTCAGATCCTGTAAACCAGGAGG - Intergenic