ID: 975694391

View in Genome Browser
Species Human (GRCh38)
Location 4:76997435-76997457
Sequence TGTCAGTTATGGAAGTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975694384_975694391 -7 Left 975694384 4:76997419-76997441 CCACCATTTGCTTATTTGTCAGT 0: 1
1: 0
2: 1
3: 26
4: 365
Right 975694391 4:76997435-76997457 TGTCAGTTATGGAAGTTGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 184
975694385_975694391 -10 Left 975694385 4:76997422-76997444 CCATTTGCTTATTTGTCAGTTAT 0: 1
1: 0
2: 5
3: 60
4: 629
Right 975694391 4:76997435-76997457 TGTCAGTTATGGAAGTTGGGGGG 0: 1
1: 0
2: 1
3: 10
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975694391 Original CRISPR TGTCAGTTATGGAAGTTGGG GGG Intronic
901303933 1:8218612-8218634 CCTCCTTTATGGAAGTTGGGTGG - Intergenic
908916990 1:69139777-69139799 TCTCAATTAAGGAAGTTGGTTGG - Intergenic
909848024 1:80422222-80422244 TCACAGTTATGGAGGCTGGGAGG + Intergenic
911667835 1:100574223-100574245 TGTCTTTTGTGGAAGATGGGTGG + Intergenic
915027225 1:152842475-152842497 TGACAGTCATGGATGATGGGTGG + Intergenic
916911965 1:169360493-169360515 TGAGACTTATGGAACTTGGGAGG - Intronic
917201619 1:172522902-172522924 TGACAGTTCTGGAGGCTGGGAGG - Intergenic
918678336 1:187318976-187318998 TGACAGTTCTGGAAGTTGGGAGG + Intergenic
1062968717 10:1629687-1629709 TGTCAGGGATGGCAGTTTGGGGG - Intronic
1068823240 10:61402549-61402571 TGGCAGTTATGTGTGTTGGGGGG + Intergenic
1070363425 10:75712810-75712832 TGTCAGTGAATGTAGTTGGGGGG - Intronic
1070939793 10:80334521-80334543 TTACAGTTTTGGAGGTTGGGAGG + Intergenic
1074894793 10:117765939-117765961 TGTACTTTATGGGAGTTGGGAGG + Intergenic
1078054331 11:7994965-7994987 GGTCAACTATGGAAGTTGGTTGG - Exonic
1079479096 11:20862462-20862484 TGTAAATTATGGACTTTGGGTGG - Intronic
1079620873 11:22552432-22552454 TCACAGTTCTGGAGGTTGGGAGG - Intergenic
1079781483 11:24611541-24611563 TGGCAATTATGGAACTAGGGTGG + Intronic
1080943290 11:36943507-36943529 TGTCAGATATGGCAGTGGGATGG + Intergenic
1081865952 11:46360864-46360886 TGTCAGGACTGGGAGTTGGGGGG + Intronic
1083288263 11:61674909-61674931 TGACAGTGATGGCAGTTTGGTGG - Intergenic
1083333335 11:61909219-61909241 TATCAGTGAGGGAAGTTGGGGGG + Intronic
1083430949 11:62613229-62613251 TGTCAGGGATGGAAGCTGGCTGG - Exonic
1083554628 11:63616261-63616283 TGGCAGTTACGGCGGTTGGGGGG - Intronic
1083630203 11:64091385-64091407 TGCCAGGTAGGGAGGTTGGGGGG + Intronic
1083840039 11:65299160-65299182 TGTCAGTGACGGAGGGTGGGAGG + Intronic
1085643478 11:78207954-78207976 TCTCAGTTTTGGAAGCTGGGAGG + Intronic
1086322212 11:85663404-85663426 TTTCTGTTTTGGAAGGTGGGAGG - Exonic
1087716538 11:101614803-101614825 TGGCAATCATGGAAGATGGGGGG + Intronic
1088696371 11:112369696-112369718 TCACAGTTCTGGAGGTTGGGAGG + Intergenic
1090589521 11:128250482-128250504 TATCAGCTATGGAAGTGGGATGG - Intergenic
1090603739 11:128399731-128399753 TGTCTGTTATGGAGTTAGGGTGG - Intergenic
1092619258 12:10245703-10245725 TGACTGTCATGGAAGTTGGCAGG - Intergenic
1095136073 12:38605690-38605712 TGACAGTTATGGAGGCTGAGAGG + Intergenic
1095322941 12:40851774-40851796 TATGAGTTAGGGAAGTGGGGTGG + Intronic
1096755335 12:53794625-53794647 GCTCAATTTTGGAAGTTGGGTGG + Intergenic
1097447134 12:59685109-59685131 TGTCACTTATGGAAGATGACCGG - Intronic
1098972953 12:76875048-76875070 TGTCAGATATGGGAGTTTTGAGG - Intronic
1099516556 12:83603676-83603698 TGTTAATTACAGAAGTTGGGTGG + Intergenic
1099817261 12:87666157-87666179 TGTCACTTATATTAGTTGGGTGG - Intergenic
1102572076 12:113832948-113832970 ATTAAGTTATGGAAGTGGGGAGG + Intronic
1102720959 12:115015523-115015545 TTTTAGTTATGGAACTTTGGGGG - Intergenic
1104958381 12:132476826-132476848 GGACAGTGATGGAAGCTGGGGGG - Intergenic
1106866589 13:33970910-33970932 TGTCAGTCCTGGGAGTTGGAAGG + Intergenic
1106889839 13:34233079-34233101 TATCAGTTCTGGAAGTTTTGGGG + Intergenic
1107877586 13:44804304-44804326 TTACAGTTCTGGAGGTTGGGAGG + Intergenic
1107905111 13:45054455-45054477 TGTCAGTGGTGGAACTTGTGGGG - Intergenic
1108447223 13:50521596-50521618 TGTGAGTGATGTAAGATGGGAGG - Intronic
1108558322 13:51618782-51618804 TCTCAGTTCTAGAAGATGGGAGG + Intronic
1110163623 13:72409741-72409763 TGTCAGAAATGGAAGTCTGGTGG - Intergenic
1111487493 13:88923221-88923243 TGTCATTTATGAAAGTATGGTGG - Intergenic
1111654341 13:91133086-91133108 TGTGAGTTATGGAAGTCTAGAGG - Intergenic
1113144860 13:107197194-107197216 TGACAGTTTTGGAGGCTGGGAGG - Intronic
1113942444 13:114025361-114025383 TGTGAGATGGGGAAGTTGGGGGG - Intronic
1116259795 14:42610063-42610085 TTTCAGTTCTGGAAGTTTTGAGG + Intergenic
1117078098 14:52124489-52124511 GGTCAGATATCGAAGTTAGGTGG + Intergenic
1117310335 14:54515486-54515508 TATCAGTTATTGAAGTTGTGGGG + Intronic
1117817355 14:59611640-59611662 TGTCTGTTTTGCAATTTGGGGGG + Intronic
1117983658 14:61366488-61366510 TGTCACGTATGGAAGTTCAGTGG + Intronic
1118365722 14:65094117-65094139 TGTCACATAAGCAAGTTGGGGGG - Intronic
1118506014 14:66412692-66412714 TGTCTTTAATGGAATTTGGGTGG + Intergenic
1118813241 14:69290828-69290850 TGTCAGTCATGGAACCTGGATGG - Intronic
1119188361 14:72661142-72661164 TGTCACTTGTGGGAGTTGGTTGG + Exonic
1121995155 14:98596706-98596728 TCTCAGTCATGGAAGTTGACTGG - Intergenic
1122306630 14:100770686-100770708 TCTCAGACATGGAAGGTGGGAGG + Intergenic
1123106798 14:105845558-105845580 TGACAGTCACGGACGTTGGGTGG + Intergenic
1124589552 15:31041026-31041048 GGACAGTGATAGAAGTTGGGGGG + Intronic
1124604776 15:31161950-31161972 TGTCGGCTGTGGAAGTTTGGAGG + Intergenic
1127569071 15:60223284-60223306 TGTCAGTGTTGGAAGGAGGGAGG - Intergenic
1129385435 15:75193592-75193614 TGTTGGTTATGAAAGCTGGGAGG + Intergenic
1129820229 15:78595951-78595973 TCTCAGTTTTGGAGGTTGGGAGG - Exonic
1133034098 16:3025439-3025461 TGTCAGTTGAGGAAGCTGGCAGG + Intronic
1139727925 16:68916915-68916937 TGTAAACTATGGACGTTGGGTGG - Intronic
1140085106 16:71788567-71788589 TTTCAGTTAAGGAAATTAGGTGG - Intronic
1140504973 16:75465612-75465634 TCACAGTTCTGGAAGCTGGGAGG + Intergenic
1142032155 16:87844006-87844028 TGTCAGGTGTGGAGGCTGGGTGG - Intronic
1143692370 17:8579918-8579940 TGTCAGTCATTGATATTGGGAGG - Intronic
1144320702 17:14116678-14116700 TGTTAGCTGTGGAAGTTGTGAGG + Intronic
1148260531 17:46179156-46179178 TGTCAAATATGGGAGCTGGGGGG + Intronic
1150876241 17:68973570-68973592 TGTCTGTTTTTGAAGATGGGAGG - Intergenic
1151085941 17:71380665-71380687 TATCAGCTATGAATGTTGGGTGG - Intergenic
1151754059 17:76061319-76061341 TGCCAGTTATGGTAGTTGGTAGG - Intronic
1152145502 17:78566124-78566146 TCTCAGTTCTGGAGGCTGGGAGG - Intronic
1152489358 17:80619215-80619237 TCTCAGTTGTTGATGTTGGGAGG + Intronic
1159358572 18:67370035-67370057 TGTCAGATATAGAACTTCGGTGG + Intergenic
1159760294 18:72417321-72417343 TGTGAGTTACTGAAATTGGGTGG + Intergenic
1160113987 18:76059744-76059766 TCACAGTTCTGGAAGCTGGGAGG - Intergenic
1161778619 19:6277632-6277654 TGTCACTTATGTAAGTGGGATGG - Intronic
1162784650 19:13026960-13026982 TGCCTGTTTGGGAAGTTGGGAGG + Intronic
1165023380 19:32941725-32941747 TCTCAGTTAGGGAAGGTGGTAGG - Intronic
925225619 2:2182018-2182040 TGTTACATATGGGAGTTGGGAGG - Intronic
926821386 2:16855098-16855120 AGTCAGTGATGGATGTTGCGAGG - Intergenic
928702161 2:33909994-33910016 GGCCAGTGATTGAAGTTGGGTGG + Intergenic
931031867 2:58185425-58185447 TGTCAGATATGCTAGTTGGATGG - Intronic
931622716 2:64227384-64227406 TCTCCATTATGGAAGTGGGGTGG + Intergenic
933421336 2:82049230-82049252 TGTCATTTATGGATGTTGCATGG + Intergenic
936475337 2:112834783-112834805 GGTCAGTTGTGCAGGTTGGGAGG - Intronic
939259903 2:139793561-139793583 TGTCAGTTATGTCATTTGGTTGG - Intergenic
943314314 2:186367430-186367452 TGTCAATTAGGGAAGGTTGGGGG - Intergenic
944904315 2:204247272-204247294 GCTCAGTTATGGGAGTGGGGTGG + Intergenic
947181763 2:227417488-227417510 TCACAGTTCTGGAGGTTGGGAGG - Intergenic
947202614 2:227628435-227628457 TCACAGTTCTGGAAGCTGGGAGG + Exonic
948524536 2:238562716-238562738 TGCCAGTTCTGGAAGCTGGGAGG - Intergenic
1168956224 20:1836337-1836359 TGTCATTTATGCAGGTGGGGAGG - Intergenic
1169217849 20:3803748-3803770 TGGCAGTAATGGATGTGGGGTGG - Intronic
1170273597 20:14556431-14556453 TGGCAGTTCTGGCAGTTTGGAGG - Intronic
1172043328 20:32061567-32061589 AGACAGTGATGGGAGTTGGGGGG + Intronic
1173121875 20:40300264-40300286 TGTCTGTTCTTGAATTTGGGTGG - Intergenic
1175659311 20:60798430-60798452 TGTCAGTCATAAAAGTTAGGTGG + Intergenic
1177545644 21:22554713-22554735 TGTCAGTTAAGAAAGCTGGTTGG + Intergenic
1177593854 21:23210208-23210230 TGTCAGAAATGGGATTTGGGGGG + Intergenic
1181532547 22:23525118-23525140 TTTAAGTTATGGATCTTGGGAGG + Intergenic
1182483469 22:30625251-30625273 TAACAGTTCTGGAGGTTGGGTGG + Intronic
1182801482 22:33035121-33035143 TGTCACTAAAGGAAGCTGGGCGG + Intronic
1183428727 22:37752981-37753003 TGTCTGAGATGGAAGCTGGGTGG - Intronic
1184536987 22:45094169-45094191 TGTCATTCATGGAACTTGGGAGG - Intergenic
949521157 3:4855277-4855299 TGTTAGATAAGGGAGTTGGGTGG - Intronic
949752615 3:7372098-7372120 TCTAAGTTATGGAAGTAGGGCGG + Intronic
951902868 3:27674225-27674247 TGTCATTTATGTAAGGTTGGTGG - Intergenic
953439810 3:42907527-42907549 TCTCAGTTCTGGAACTTTGGGGG + Intronic
953934751 3:47031239-47031261 TGTAAATTATGGACTTTGGGTGG + Intronic
954957570 3:54535487-54535509 TGTCAGTTTTGGACTTTGTGAGG + Intronic
956179347 3:66502541-66502563 TGTGTTTTATGGAAGTGGGGTGG + Intergenic
956547101 3:70416990-70417012 TGTCTGTCATGGAAGTTGGAGGG - Intergenic
957935912 3:86942340-86942362 TGTCAGTTATTGAAGACGGAAGG - Exonic
958055005 3:88398655-88398677 TGTCAGATATGAAAGTCAGGAGG + Intergenic
961148834 3:124618725-124618747 TGCCAGATATGGAGCTTGGGAGG + Intronic
961336833 3:126185406-126185428 TGGCAGATATGAAAGGTGGGAGG + Intronic
961449573 3:126996416-126996438 TGTAAGTTCTGGAAGTTGAGTGG + Intronic
962613068 3:137097354-137097376 TTTTAGCTATGGAGGTTGGGTGG - Intergenic
964178512 3:153855781-153855803 TGAGGGTTATGGAAGTTGAGGGG + Intergenic
964585679 3:158297633-158297655 TGTGAGTTATAGAATCTGGGTGG + Intronic
967306966 3:188068759-188068781 TGTGAGAAATGGAAGTTAGGAGG - Intergenic
969329836 4:6467952-6467974 AGTCAGTTCTGGAGGTTGAGTGG - Intronic
970448411 4:16142927-16142949 TTCCAGTTTGGGAAGTTGGGTGG - Intergenic
971060040 4:22957548-22957570 TTGCAGTTAGGGAGGTTGGGAGG - Intergenic
972590008 4:40476673-40476695 TGTCAGTTCAGGCAATTGGGAGG + Intronic
973777861 4:54259789-54259811 GGTCATATATTGAAGTTGGGTGG + Intronic
975694391 4:76997435-76997457 TGTCAGTTATGGAAGTTGGGGGG + Intronic
977595763 4:98877846-98877868 AGTCAGTTGGGGAAGTTTGGAGG - Intronic
979284429 4:118905697-118905719 TGTCTGATAAGGAAGTTGTGTGG - Intronic
979848386 4:125545683-125545705 TCACAGTTCTGGAAGCTGGGAGG - Intergenic
980349622 4:131668720-131668742 AGTCAGTGAAGGAAGATGGGCGG - Intergenic
982213072 4:153056731-153056753 TTTCAGTAATTGAAGTTGGATGG + Intergenic
984464707 4:180083704-180083726 TGTCACTTATGCAGATTGGGAGG + Intergenic
984760831 4:183361259-183361281 TGACAGGTATGGCATTTGGGAGG + Intergenic
986414196 5:7511814-7511836 TGGCAGTGATGGGAGTTGGTAGG + Intronic
989362341 5:40616894-40616916 TGTCTGCTATGGAAGTTAGATGG - Intergenic
991962220 5:72056543-72056565 TCTCAGTTATGGAAATTGCAAGG - Intergenic
993136121 5:83966642-83966664 TCTCAGATCAGGAAGTTGGGAGG - Intronic
998175098 5:139896903-139896925 TGCCAGGTAAGGAAGGTGGGCGG - Intronic
1001323386 5:170701137-170701159 TGTGGGGTAGGGAAGTTGGGAGG - Intronic
1002717679 5:181238440-181238462 AGTGATTTATGTAAGTTGGGAGG - Intronic
1004494707 6:16152814-16152836 TGCCAGGTAGGGAAGGTGGGTGG + Intergenic
1006335257 6:33417229-33417251 TGTGAGTCATAGGAGTTGGGGGG - Exonic
1007754533 6:44090378-44090400 TGACATTTATGGAAGGTGGCAGG - Intergenic
1008051527 6:46904777-46904799 GGTCAGTCATGGAAACTGGGTGG + Intronic
1009464778 6:63955315-63955337 TATCAGTTATGGTGGTTTGGAGG - Intronic
1010189363 6:73179213-73179235 TTACAGTTATGGAGGCTGGGAGG + Intronic
1013781527 6:113733747-113733769 TGTCAGTTATGCAAAGGGGGAGG + Intergenic
1013850222 6:114504882-114504904 TCTCACTGGTGGAAGTTGGGTGG + Intergenic
1013880530 6:114894151-114894173 TCAGAGTTGTGGAAGTTGGGAGG + Intergenic
1019759436 7:2799229-2799251 TGTCAGATATGGCAGATGTGTGG - Intronic
1023901536 7:44484795-44484817 TTTCAGTTATGTAGGATGGGAGG - Intronic
1026180621 7:68036317-68036339 TGCCAGTTCTGGAAGTTAAGGGG + Intergenic
1026635742 7:72080248-72080270 TGTGAGTTAGGCAAGTGGGGTGG - Intronic
1026899764 7:74030301-74030323 TGTCACTTATGCAAGTTCAGCGG + Intronic
1027684169 7:81261077-81261099 TGTAAACTATGGAAGTTGAGTGG - Intergenic
1028137679 7:87239397-87239419 TATCAGTGATGGAAGTTGAAAGG + Intergenic
1031627245 7:124005088-124005110 TGTCAGTTAGAGAGCTTGGGTGG + Intergenic
1032971714 7:137172340-137172362 TGTCATTCAGGGATGTTGGGCGG - Intergenic
1035145761 7:156814142-156814164 TGTAAGTTGTGGAATTTGTGAGG - Intronic
1036222774 8:6934539-6934561 TGTCACTCTTGGAAGTTGTGGGG + Intergenic
1039352063 8:36773711-36773733 TGGAAGTGATGGAAGTTGTGGGG + Intergenic
1045624465 8:104026959-104026981 GGTCATTTATCTAAGTTGGGAGG - Intronic
1047665040 8:127082319-127082341 CCTCACTTATGGAAGGTGGGAGG - Intergenic
1048718158 8:137291607-137291629 AGTGAGTCATGGAAATTGGGTGG - Intergenic
1050101249 9:2122420-2122442 TGCCAGTTATGAAGGTTTGGTGG + Intronic
1052095229 9:24375460-24375482 TGTCTCTTATGGATGTTTGGTGG + Intergenic
1056041903 9:82676920-82676942 TGCCAGATAGGGAAGTTGTGTGG + Intergenic
1057007645 9:91574747-91574769 CATCAGTTCTTGAAGTTGGGAGG - Intronic
1058195268 9:101966538-101966560 TGGCAGGAATGGAAGCTGGGGGG + Intergenic
1058999625 9:110335150-110335172 TGTCAGTTAGGGATCATGGGAGG - Intronic
1060127161 9:121059223-121059245 TTTCAGATAAGGAAGTAGGGAGG + Intergenic
1060482931 9:124028404-124028426 TGTCAGTTTCAGAAGATGGGTGG + Intronic
1061272598 9:129551818-129551840 GGTAAGTTCTGGAAGTGGGGAGG - Intergenic
1062701127 9:137904119-137904141 TGTCTTTTTTGGAAGTCGGGAGG + Intronic
1185794344 X:2952137-2952159 TGTTAGTTATGGAAGCTGACAGG + Intronic
1187426817 X:19185125-19185147 AGTAAGTAATGGAAATTGGGTGG + Intergenic
1189814079 X:44807204-44807226 TGATAATTATTGAAGTTGGGTGG - Intergenic
1194092002 X:89589614-89589636 TGGGAGTGATGGAAGATGGGTGG - Intergenic
1194896874 X:99453277-99453299 AGTCAGTTGTGGAACTTGTGAGG + Intergenic
1195328652 X:103778602-103778624 TGCCTGTTATGGAGGCTGGGTGG + Intronic
1196311564 X:114173644-114173666 TATCAGTTAGGGAAGTTGTTTGG - Intergenic
1198379208 X:136068397-136068419 TCTCAGTTGGGGAGGTTGGGGGG + Intergenic
1200444636 Y:3245678-3245700 TGGGAGTGATGGAAGATGGGTGG - Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic