ID: 975695597

View in Genome Browser
Species Human (GRCh38)
Location 4:77009701-77009723
Sequence ATATTTGGACTACTATTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975695594_975695597 14 Left 975695594 4:77009664-77009686 CCAGAGGCAAGAAGGGAAACTAA 0: 1
1: 0
2: 2
3: 24
4: 289
Right 975695597 4:77009701-77009723 ATATTTGGACTACTATTGAGAGG 0: 1
1: 0
2: 1
3: 2
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975695597 Original CRISPR ATATTTGGACTACTATTGAG AGG Intronic
907638619 1:56161758-56161780 GTATTTACACTACTATTGATTGG - Intergenic
908608784 1:65832111-65832133 ATCTTTGGACTCCTAATGATAGG + Intronic
911300505 1:96166942-96166964 ATATTTCGACTACATTTGAAAGG + Intergenic
911314729 1:96342022-96342044 TTATTTGGAGTAATAATGAGAGG - Intergenic
912037243 1:105333816-105333838 ACATTTGGAATACTATTATGAGG + Intergenic
916956813 1:169846188-169846210 TTTTTTGGCCCACTATTGAGAGG - Intronic
918760711 1:188402125-188402147 ATATTTTGACTACTTTTTATTGG - Intergenic
923992202 1:239451253-239451275 AAATTTAGACTACTATAGTGTGG - Intronic
1063745828 10:8879975-8879997 ATTTTTGGCCTACTATTTAATGG + Intergenic
1073762007 10:106639463-106639485 ATATGTGGATTAGTTTTGAGGGG + Intronic
1077931610 11:6738714-6738736 ATATTTGGACAAACATTGTGTGG + Intergenic
1081422374 11:42884629-42884651 ATATATGGACTACTGTTCAATGG + Intergenic
1086425099 11:86675057-86675079 ATATTTAGACTTCTAGTTAGTGG - Intergenic
1087232419 11:95681282-95681304 ATATTTGGGATCCTATTGATAGG + Intergenic
1087503244 11:98986858-98986880 ATATTTTGACCACTTTTGATTGG - Intergenic
1095180222 12:39138707-39138729 TTATCTGGACTATTTTTGAGAGG - Intergenic
1096942517 12:55362800-55362822 CAATTTGGACTATTATTTAGTGG + Intergenic
1107775596 13:43837494-43837516 ATATTTTGACTACTCTAAAGAGG + Intronic
1112314528 13:98349832-98349854 ATAGTGGGACTGCTTTTGAGGGG + Intronic
1115463491 14:33687873-33687895 ATTTTTTGACTCCTATTGGGAGG - Intronic
1117116913 14:52523314-52523336 ATATTTGGTCAAGAATTGAGTGG + Intronic
1121787801 14:96675588-96675610 ATATTTGAACTTCTAGTGATTGG - Intergenic
1124344349 15:28912105-28912127 ATATTTTGACTTCTATTAAATGG + Intronic
1125353561 15:38792666-38792688 ATATTTGACCTACAACTGAGAGG - Intergenic
1126905608 15:53361259-53361281 ATATTAGGAAAAATATTGAGGGG + Intergenic
1127038867 15:54951190-54951212 ATATGTGAAATGCTATTGAGTGG + Intergenic
1127510109 15:59632297-59632319 ATTTTTGGAATAATATCGAGTGG - Intronic
1130243060 15:82215417-82215439 ATATTAGGAACACTAATGAGAGG + Intronic
1130260751 15:82352652-82352674 GGATTTGGACAACTATGGAGAGG - Intergenic
1130280486 15:82516355-82516377 GGATTTGGACAACTATGGAGAGG + Intergenic
1130457388 15:84125874-84125896 ATATTAGGAACACTAATGAGAGG - Intergenic
1130471857 15:84232538-84232560 GGATTTGGACAACTATGGAGAGG + Intergenic
1130479351 15:84347109-84347131 GGATTTGGACAACTATGGAGAGG + Intergenic
1130492419 15:84441020-84441042 GGATTTGGACAACTATGGAGAGG - Intergenic
1130594155 15:85237175-85237197 GGATTTGGACAACTATGGAGAGG + Intergenic
1138898440 16:61239173-61239195 ATATTTATACTACTATAAAGAGG + Intergenic
1153026173 18:674999-675021 AAGTTTGGACTACAATTGTGTGG - Intronic
1155753580 18:29460923-29460945 TTATTTTGACTACCATTCAGAGG + Intergenic
1158044058 18:53133782-53133804 TTATCTGGACTTCTCTTGAGTGG - Intronic
1158627052 18:59080554-59080576 ATACTTGGAGTACTATTTATAGG + Intergenic
1159329832 18:66977846-66977868 AGATTTGGAAGACCATTGAGAGG + Intergenic
929730805 2:44489618-44489640 ATACTTGGATTACAATTGACAGG + Intronic
932945212 2:76221841-76221863 ATATTTGGAATAAAAATGAGGGG + Intergenic
936839577 2:116753834-116753856 ATCTTAGGCCTGCTATTGAGAGG - Intergenic
936860725 2:117015920-117015942 ATATATTTACTACTCTTGAGAGG - Intergenic
939881215 2:147633489-147633511 ATATGTTGACTACTATTGAGAGG - Intergenic
946548276 2:220770580-220770602 ATATATAGACTAATATGGAGGGG + Intergenic
1173211428 20:41035760-41035782 ACATTTGGACTTCTACTAAGGGG - Intronic
1175456462 20:59118757-59118779 ACATTTGGATAACTATTGAAAGG - Intergenic
1176921467 21:14692660-14692682 ATATTTTTACTATTATGGAGAGG - Intergenic
1178082297 21:29077676-29077698 CTGTTTGGGCTGCTATTGAGAGG - Intronic
949968030 3:9375908-9375930 ATATTTGGTCCACCATTGATTGG + Intronic
951036453 3:17938215-17938237 ATATTTCTATTACTTTTGAGTGG + Intronic
951230263 3:20170416-20170438 ATATTTCGACTAAAATTAAGAGG + Intronic
951604143 3:24413492-24413514 ATATTAAGACTGTTATTGAGTGG - Intronic
953178592 3:40575263-40575285 AAATTTTCACTTCTATTGAGAGG - Intergenic
956086575 3:65617538-65617560 ATATCTAGACTACAATTAAGAGG + Intronic
956385460 3:68713247-68713269 ATTTTTGGAGTAATTTTGAGTGG - Intergenic
959199802 3:103232426-103232448 ATATTTGGAAAACTGTGGAGTGG - Intergenic
959441474 3:106381528-106381550 ATATTTAGACTACGATACAGAGG - Intergenic
959986430 3:112577774-112577796 ATGCTTGTACTACTACTGAGTGG - Intronic
960797063 3:121498632-121498654 AGGATTGGACTACTATTGATTGG - Exonic
961337899 3:126195218-126195240 ATATTTGGTCTAATATAGACAGG - Intronic
963671420 3:148256767-148256789 ATGTTTTGATTACTAGTGAGTGG + Intergenic
964316377 3:155448852-155448874 ATAATTGGAAGTCTATTGAGAGG + Intronic
965889480 3:173493298-173493320 ATATTTTGCCTACTAGTGAAGGG + Intronic
966475228 3:180336846-180336868 ATTATTTGACTACTATTGAATGG - Intergenic
971565655 4:28137491-28137513 ATATTTGAACTGCCATTTAGTGG - Intergenic
974279189 4:59768840-59768862 CTATTTTCACTAATATTGAGTGG + Intergenic
975695597 4:77009701-77009723 ATATTTGGACTACTATTGAGAGG + Intronic
976476585 4:85490888-85490910 ATATTTGGAATTATATTGAGTGG - Intronic
976576280 4:86675950-86675972 ATATTTAGACTACAAATTAGTGG - Intronic
977675235 4:99740204-99740226 ACATTTGGCCAAATATTGAGAGG + Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
979327038 4:119392136-119392158 ATATTTCGGATCCTATTGAGGGG - Intergenic
979649282 4:123111589-123111611 ATATTTGATCTACTATTAAAGGG - Intronic
980576740 4:134692727-134692749 ATATTTGAACTGCTTTTGTGTGG + Intergenic
983244917 4:165276828-165276850 ATATTTTGGATCCTATTGAGGGG - Intronic
984162800 4:176274787-176274809 ATATTTGAAAGACTATTGAAAGG + Intronic
991050870 5:62271796-62271818 ATTTTTGGATTATTCTTGAGGGG - Intergenic
994308820 5:98241990-98242012 ATATTTAGACTACTGTTTATGGG + Intergenic
995725551 5:115178278-115178300 ATAAATGGACTACTCTTGATAGG - Intronic
998485825 5:142501206-142501228 ATATAGGGACTAATATGGAGAGG - Intergenic
1007888828 6:45265168-45265190 ATATTAGGTGTCCTATTGAGAGG - Intronic
1010103061 6:72132458-72132480 ATTTTTGGACTAATATTTATTGG + Intronic
1015330551 6:131973872-131973894 ATATTTGGGCTACTTTTCTGAGG - Intergenic
1015454358 6:133408836-133408858 AATTTGGGACTAATATTGAGTGG + Intronic
1015758296 6:136630408-136630430 ATTTTTGGACAGCTATTGAATGG - Intronic
1018561910 6:165108592-165108614 ATATTTGGACTGCATTTGAAAGG - Intergenic
1022064032 7:26832351-26832373 TTATTTGGACTACCTTTGACTGG + Intronic
1024275330 7:47672511-47672533 ATATTTGGAAAACAAATGAGTGG + Intergenic
1025796356 7:64741187-64741209 ATATTTTTACTTCTATTGATAGG + Intergenic
1026439109 7:70427660-70427682 ATATTTGCACTTCTAATGGGTGG + Intronic
1028610459 7:92704611-92704633 ATATTAGCAATAATATTGAGGGG - Intronic
1030640424 7:111999330-111999352 ATATATTTACTACTATTGAATGG - Intronic
1030888032 7:114963206-114963228 ATATTTGGAAGACTATTGCTGGG + Intronic
1031204497 7:118739016-118739038 ATCTTTATACTACAATTGAGTGG - Intergenic
1032315528 7:130835160-130835182 ATATTTTGAGTGCTTTTGAGAGG - Intergenic
1035950382 8:4013407-4013429 ATATTTGGACCTCTAATGAACGG - Intronic
1037096037 8:14989153-14989175 GTCTGTGGACTACTTTTGAGTGG + Intronic
1044097922 8:88091641-88091663 ACCTTTGGACTACTAATAAGAGG - Intronic
1044667751 8:94648395-94648417 ATTTTATGACTACTATTCAGAGG + Intronic
1045660493 8:104432497-104432519 ATGTTTGGCCTCCTATTTAGTGG - Intronic
1046231711 8:111366607-111366629 ATATTTGCTTTAATATTGAGAGG - Intergenic
1048636607 8:136302959-136302981 ATATGTGGACTACTGTTGATCGG - Intergenic
1050642441 9:7682737-7682759 AAATGTGAACTAGTATTGAGTGG + Intergenic
1050698346 9:8305313-8305335 ATTTTTGGATTAATATTGATAGG + Intergenic
1051413596 9:16815716-16815738 AGATTTGTACTACTATTTATTGG + Intronic
1052509104 9:29391187-29391209 ATTTTTGGACTTGTATTGTGGGG + Intergenic
1058515400 9:105767605-105767627 ATTTTTGGAGTACTATTTTGTGG + Intronic
1187557664 X:20367408-20367430 TTATTTGTTCTACTGTTGAGAGG - Intergenic
1188490148 X:30729860-30729882 ATATTTTGGATCCTATTGAGGGG + Exonic
1194419796 X:93659871-93659893 ATTTTTGTACTCCTATTCAGAGG - Intergenic
1195123149 X:101777740-101777762 ATATTTTGGATCCTATTGAGGGG - Intergenic
1195825655 X:108997668-108997690 ATCTCAGGACTACTATGGAGTGG - Intergenic
1200342621 X:155414478-155414500 ATATTAGGAGTACAATTGATAGG - Intergenic