ID: 975696786

View in Genome Browser
Species Human (GRCh38)
Location 4:77021606-77021628
Sequence CAGGTGGTGTGAGGTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 273}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975696782_975696786 7 Left 975696782 4:77021576-77021598 CCAAGCTGTTTCTTAATGGGGAT 0: 1
1: 0
2: 0
3: 7
4: 129
Right 975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 19
4: 273
975696773_975696786 23 Left 975696773 4:77021560-77021582 CCACCGCGCCTGGCCCCCAAGCT 0: 1
1: 5
2: 119
3: 803
4: 4208
Right 975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 19
4: 273
975696774_975696786 20 Left 975696774 4:77021563-77021585 CCGCGCCTGGCCCCCAAGCTGTT 0: 1
1: 2
2: 14
3: 112
4: 894
Right 975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 19
4: 273
975696777_975696786 10 Left 975696777 4:77021573-77021595 CCCCCAAGCTGTTTCTTAATGGG 0: 1
1: 0
2: 0
3: 9
4: 174
Right 975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 19
4: 273
975696775_975696786 15 Left 975696775 4:77021568-77021590 CCTGGCCCCCAAGCTGTTTCTTA 0: 1
1: 0
2: 2
3: 36
4: 422
Right 975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 19
4: 273
975696781_975696786 8 Left 975696781 4:77021575-77021597 CCCAAGCTGTTTCTTAATGGGGA 0: 1
1: 0
2: 1
3: 17
4: 151
Right 975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 19
4: 273
975696779_975696786 9 Left 975696779 4:77021574-77021596 CCCCAAGCTGTTTCTTAATGGGG 0: 1
1: 0
2: 0
3: 10
4: 140
Right 975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG 0: 1
1: 0
2: 3
3: 19
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975696786 Original CRISPR CAGGTGGTGTGAGGTGTGTC TGG Intronic
900118720 1:1039664-1039686 CTGGTGATGGGACGTGTGTCAGG + Intronic
900190997 1:1352164-1352186 CAGGCGGTGGGAGGAGTGGCGGG - Intergenic
900683236 1:3930496-3930518 TATGTGGTGTGTGGTGTGTGTGG - Intergenic
901235138 1:7663673-7663695 CCGGTGGTCACAGGTGTGTCCGG + Exonic
902208306 1:14886017-14886039 CAGGTGTTGTGGGGTGGGGCGGG - Intronic
903045550 1:20561910-20561932 GAGAAGGTGGGAGGTGTGTCTGG + Intergenic
903213514 1:21831188-21831210 CAGGTGGTGTGTGGGGTGTGGGG + Intronic
904382364 1:30119959-30119981 CAGGTAGGGGGTGGTGTGTCGGG + Intergenic
904788622 1:33000960-33000982 CAGTTGGTGCTAGGTGTGGCAGG + Intergenic
906117708 1:43367183-43367205 GAGGTGTTGCGTGGTGTGTCAGG - Intronic
906781199 1:48574677-48574699 CAGGAGGTGGGAGTTGTGGCTGG - Intronic
908662273 1:66449707-66449729 CAGGTGGTAAGAGTTGTCTCAGG + Intergenic
913606758 1:120474519-120474541 AAGGTGGTGAGAGGCGTGTTTGG - Intergenic
914209673 1:145565622-145565644 AAGGTGGTGAGAGGCGTGTTTGG + Intergenic
914268590 1:146057991-146058013 AAGGTGGTGAGAGGCGTGTTTGG + Intergenic
914368500 1:147002872-147002894 AAGGTGGTGAGAGGCGTGTTTGG - Intergenic
914584435 1:149047317-149047339 AAGGTGGTGAGAGGCGTGTTTGG + Intronic
915567386 1:156723166-156723188 CAGGTGTTGTGTCCTGTGTCTGG - Exonic
915901634 1:159850853-159850875 CAGGAGGTGTGGGGTGTGCATGG - Intronic
915951794 1:160194216-160194238 CATGTGGTGTGTGATGTGTGTGG - Intronic
919714420 1:200760888-200760910 CAGGTGGTTTGATGTGTTCCTGG - Exonic
920214322 1:204351184-204351206 CAGGGGGAGTGGGGTGTGGCGGG + Intronic
920732033 1:208496608-208496630 CAGGATGGGTGAGGTGTTTCAGG + Intergenic
921771231 1:219042259-219042281 CAGGTGGAGTCAGTTGTGTCTGG - Intergenic
921948306 1:220904241-220904263 CAGGTGGTGGGAGGTGGCTGAGG - Intergenic
922221025 1:223558752-223558774 CATATGGTGTGTGGTGTGTTTGG + Intronic
923026462 1:230208467-230208489 TAGGTGGTGGGATATGTGTCTGG + Intronic
923687195 1:236161474-236161496 GAGGAGGTGTGAAGTGTGTGTGG - Intronic
1062967146 10:1616463-1616485 AGGGTGGTGTGGAGTGTGTCTGG - Intronic
1063079540 10:2752481-2752503 CAGGTGGTGGGAGGTAGGTGGGG - Intergenic
1063120254 10:3100918-3100940 CAGGTGCTGTAAGGGGTGACTGG + Intronic
1064035206 10:11908833-11908855 CAGGTGGGGTGAGGGGACTCGGG - Intergenic
1070443795 10:76474188-76474210 TAGATGGTGTGAGGTGTATATGG - Intronic
1070962532 10:80509228-80509250 CAGGTGGGGTTATGTGTGTGGGG + Intronic
1072608590 10:97002421-97002443 CAGGTGGGGCGGGCTGTGTCAGG - Intronic
1072637629 10:97187786-97187808 CAGGTGCTGGGGTGTGTGTCTGG - Intronic
1073116919 10:101096485-101096507 TAGGTGATGTAAGGTGTGTGGGG - Intronic
1073136122 10:101221499-101221521 CAGGGTGTGTGAGGTGTGCAGGG - Intergenic
1073327634 10:102651600-102651622 CCTGTGGTGTGAGATGTGTGGGG + Intronic
1075060931 10:119256281-119256303 CTGGTGCTGTGAGGTGTGTGGGG - Intronic
1076104650 10:127811690-127811712 AAGGTGGTGTGAAGTGTGTGTGG + Intergenic
1076509156 10:130999891-130999913 CAGGTGGTGTGAGAGGTGGTGGG - Intergenic
1076546195 10:131246951-131246973 CTGGTGGGGTGAGATGTGTAGGG + Intronic
1076546216 10:131247039-131247061 CTGGTGGGGTGAGATGTGTAGGG + Intronic
1076838329 10:133032364-133032386 CAGGTGGCGGGAGGCGTGTGGGG + Intergenic
1076901229 10:133339033-133339055 TGTGTGGTGTGAGGTGTGTGTGG - Intronic
1077372147 11:2187837-2187859 TATGTGGTGTGTGGTGTGTGTGG - Intergenic
1079129540 11:17739173-17739195 CCGCTGGTGTGAGGAGTCTCGGG - Intronic
1079164334 11:18024849-18024871 AAGGTGGTGCTTGGTGTGTCTGG - Intronic
1080304021 11:30817458-30817480 GAGGCGATGTTAGGTGTGTCAGG - Intergenic
1080819464 11:35791437-35791459 CAGGAGGTGAGAAGGGTGTCAGG - Intronic
1081994836 11:47357008-47357030 GACTTGGTGTGAGGTGTGTGAGG - Intronic
1083662481 11:64258213-64258235 GAGGTGGTGTGAGCTGTGCCAGG + Intronic
1083681339 11:64353228-64353250 CACGCAGTGTGAGGTGTGGCTGG + Exonic
1087025433 11:93644819-93644841 CAGTTGCTGTGGGGCGTGTCTGG + Intergenic
1087558993 11:99760169-99760191 CAGGTGGTGTGAAGTGTCAGAGG + Intronic
1089197728 11:116704565-116704587 CAGGTGGGCATAGGTGTGTCAGG - Intergenic
1091397780 12:164257-164279 GAGGTGGTGAGAGGTGGTTCAGG - Intronic
1091691730 12:2601782-2601804 GGGGTGGTGTGAGGGGTCTCTGG + Intronic
1091755599 12:3049435-3049457 CAGGTGCTGTGAGCTGTATATGG - Intergenic
1093854068 12:24077263-24077285 AAGGGGCTGTGTGGTGTGTCGGG - Intergenic
1094224813 12:28033187-28033209 CAGCTGGTGTGGGGTGTGTGGGG - Intergenic
1095969976 12:47894868-47894890 CAGGTGGAGGCAGGTGTGGCAGG - Intronic
1097122946 12:56749962-56749984 CAGGGGGTGGGAGGAGTGGCAGG + Intronic
1098188756 12:67925931-67925953 TAGGTGGTGTGAGGAATATCAGG - Intergenic
1101718544 12:107331890-107331912 CAGGTGGGGAGAGGTGGGGCGGG - Intronic
1102028543 12:109727107-109727129 GAGGGGGTGTAAGGTGTGGCAGG - Intronic
1102662953 12:114545654-114545676 CAGGTGTTGTCAGGTGTAACGGG + Intergenic
1104114256 12:125734277-125734299 CTGGTGGTGGGAGGGGCGTCAGG + Intergenic
1106135893 13:26973435-26973457 TATGTGGTGTGTGGTGTGTGTGG - Intergenic
1106183558 13:27388349-27388371 CAAGGGCTGTGAGGTGTGGCAGG - Intergenic
1108894091 13:55301094-55301116 CAGAAGGTGTGATGTGTCTCTGG - Intergenic
1113960769 13:114124669-114124691 CAGGCGGAGTGAGTTGTGGCTGG - Intronic
1114254676 14:20991339-20991361 CAGGTACTGTGAGGTGTGCAGGG - Intronic
1114517452 14:23308977-23308999 CAGGTGGGGCTAGGTGTGGCTGG + Exonic
1117464806 14:55982544-55982566 CAGGTGGTCTCAGGTGGGCCAGG - Intergenic
1121335770 14:93076786-93076808 AAGGTGGTTTGAGGAGTGGCTGG - Intronic
1122305401 14:100762968-100762990 CAGATGGGGTGAGGTGGGTGGGG + Intergenic
1122929986 14:104928683-104928705 CAGGTGATGTGAGGTGGGCTGGG + Intronic
1123157242 14:106239958-106239980 CAGGTGGTCTGAGGTGCTGCAGG + Intergenic
1124344821 15:28915151-28915173 TATGTGGTGTGTGGTGTGTATGG - Intronic
1129167162 15:73785162-73785184 GAGGAGGTGTCAAGTGTGTCTGG + Intergenic
1129187844 15:73921365-73921387 GAGGTGGTGTGGGGTGAGACTGG - Intergenic
1129261851 15:74373154-74373176 AAAGGGGTGCGAGGTGTGTCAGG - Intergenic
1130436563 15:83905442-83905464 AAGGTGGTCTGAGGTGGGTGAGG + Intronic
1131593795 15:93775951-93775973 CAGGCTGTGTGAGGTGTTTTAGG + Intergenic
1131641775 15:94300924-94300946 TTTGTGGTGTGATGTGTGTCTGG + Intronic
1132039211 15:98511199-98511221 CAGGTGGTGAGTGAAGTGTCAGG + Intronic
1132499468 16:278923-278945 CAGGTGGGGTGAGGTGGCCCAGG + Intronic
1133200353 16:4200430-4200452 CAGGAGGTGGGAGGTGAGCCTGG + Intronic
1134357040 16:13492059-13492081 CAGGAGGAGTGAGGTGGGTAGGG - Intergenic
1135843371 16:25896208-25896230 CAGGTGGAGTGATGTGTCTTGGG + Intronic
1135967619 16:27049020-27049042 AAGGTGGTGAGAGGTGAGGCTGG - Intergenic
1136115166 16:28089835-28089857 TATGTGGTGTGAGGGGTGTGTGG - Intergenic
1136865822 16:33752282-33752304 CAGGTGGTGAGGGGTGGGGCTGG + Intergenic
1138473607 16:57257654-57257676 CTGGTGGTGTGAAGGGTGACAGG + Intronic
1141236311 16:82220801-82220823 TATGTGGTGTGGGGTGTGTGTGG + Intergenic
1142343052 16:89536595-89536617 CAGGTGAGGTGAGGTGGGTGAGG + Intronic
1203106332 16_KI270728v1_random:1363821-1363843 CAGGTGGTGAGGGGTGGGGCTGG - Intergenic
1203127182 16_KI270728v1_random:1598547-1598569 CAGGTGGTGAGGGGTGGGGCTGG + Intergenic
1142499246 17:323204-323226 TGGGTGGTGTGTGGTGTTTCAGG + Intronic
1143583275 17:7838586-7838608 GAGGGTGTGTGAGGGGTGTCTGG - Intergenic
1146285769 17:31573303-31573325 CACGTGGGGTAAGGTGTGCCAGG + Intronic
1147543607 17:41381377-41381399 CTCGTGGTGTTAGGTGAGTCAGG - Intronic
1148092522 17:45031161-45031183 GAATTGGTGTGATGTGTGTCTGG - Intronic
1148750726 17:49944456-49944478 GAGGTGGAGGGAGGTGGGTCAGG - Intergenic
1151534808 17:74732782-74732804 TGTGTGGTGTGAGGTGTGTGTGG + Intronic
1151557046 17:74851911-74851933 CAGCTAGTGGGAGGTGTGGCTGG + Intronic
1154080098 18:11247987-11248009 TGTGTGGTGTGAGGTGTGTGTGG - Intergenic
1154253895 18:12766655-12766677 CGGGTGCTGCGTGGTGTGTCGGG - Intergenic
1155663779 18:28282468-28282490 CAGGTGGGGTGAGGTGGGTTGGG - Intergenic
1156018825 18:32576764-32576786 TAGGTGGTGTGAGATGCTTCCGG + Intergenic
1158664358 18:59419318-59419340 CAGGTGGAGAGAGGTGTGGGAGG - Intergenic
1158994051 18:62899140-62899162 CATGTGATGTGAGCTGTGTATGG + Intronic
1159833555 18:73308106-73308128 CAGGTGAGTTCAGGTGTGTCAGG + Intergenic
1160536729 18:79598426-79598448 CAGGAGGTGGGGGGTGTGGCTGG - Intergenic
1160715848 19:576206-576228 GAGGTGGGGTGAGGTGAGTCAGG + Intronic
1160799928 19:963057-963079 AGGGTGGTGGGAGGTGTTTCTGG + Intronic
1161046830 19:2139588-2139610 CAGGTGGGGTGGGTTGTCTCTGG - Intronic
1161080255 19:2307001-2307023 CAGAAGGTGTGAGGTGTGAGTGG - Intronic
1161673811 19:5630867-5630889 CATGTGGTGTGAGGTAGGTAGGG + Intronic
1163849479 19:19655125-19655147 CTGGTGGTGCGCGGTGTGGCCGG - Exonic
1164977295 19:32582594-32582616 CAGGTGCTGTGCGCTGTGTTGGG - Intronic
1165178147 19:33945204-33945226 CTGGTGGTGTGAGGACCGTCTGG + Intergenic
1165579455 19:36849921-36849943 CTGGTGGGATGAGGGGTGTCTGG - Intronic
1167154356 19:47729308-47729330 GAGGTGGTGTGGGCTGTGTCCGG + Intronic
1167622509 19:50567670-50567692 CAGGTTGTGGGGGGTGCGTCCGG - Intronic
1202708648 1_KI270714v1_random:4267-4289 AAGGTGGTGAGAGGCGTGTTTGG - Intergenic
925290939 2:2748380-2748402 AAGATGGTGTGTGGTGTGTGTGG + Intergenic
925761040 2:7184733-7184755 CAGGTGTTGTGAGGTGGTTGTGG - Intergenic
927151277 2:20197880-20197902 CTGGTGGTGGGAGGTGGGTGTGG + Intergenic
928195975 2:29216763-29216785 TAGGATGTGTGAGGTGTGTGTGG + Intronic
928545032 2:32321771-32321793 CTGTTGCTGTCAGGTGTGTCAGG - Intergenic
929376546 2:41293677-41293699 CAGATGCTGTGAGGGGTATCTGG - Intergenic
929906100 2:46048098-46048120 CAGGGGGTGGGAGGGGTGGCAGG - Intronic
930673837 2:54179229-54179251 TAGGTGGTGTGAGGGGTGGGTGG + Intronic
932456464 2:71852683-71852705 CTAGTGGTGTGAGCTGTGCCTGG + Intergenic
932745367 2:74329634-74329656 GAGGTGGTGTGAGGTGTAAATGG + Intronic
933678095 2:85075865-85075887 CAGGAGGCGTGAGGTGAGCCTGG - Intergenic
934655675 2:96115882-96115904 CACGTGGTGCGAGGTGTACCTGG - Exonic
936008526 2:108910273-108910295 CAGGTGGTGTGAGGAGCCTGTGG - Intronic
936078682 2:109417938-109417960 AAGGTGGTGTGAGGCCAGTCTGG + Intronic
936456034 2:112675060-112675082 CAGGTGGTGTCTGGTGTTTCAGG + Intergenic
936578079 2:113671905-113671927 CATCTGGTGTCAAGTGTGTCAGG + Intergenic
938836853 2:135112586-135112608 CAGCTGGTGGGAGAAGTGTCTGG - Intronic
939598949 2:144164315-144164337 AGGGTGGTGTGAGATGTGTAAGG + Intronic
940987085 2:160061490-160061512 CAGGCGGGGTGCGGTGGGTCAGG + Intronic
941020712 2:160405893-160405915 CAGGTAGAGTGAGGTGGGTGGGG + Intronic
942136588 2:172931948-172931970 CAAGGGGTGTGAGGAGTGGCGGG - Intronic
942318481 2:174715272-174715294 AAAGTGGTGTGAGGTGGGCCAGG + Intergenic
946021778 2:216645200-216645222 ACAGTGGTGGGAGGTGTGTCAGG + Intronic
947176578 2:227373231-227373253 CAGATGGAGTGAGGTTTGTTAGG - Intronic
947221991 2:227802673-227802695 CAGGTCATTTGGGGTGTGTCTGG + Intergenic
947340189 2:229130227-229130249 CAGGTGGGCTGAGGGCTGTCTGG - Intronic
948654331 2:239467108-239467130 CAGGTGATGCTTGGTGTGTCAGG + Intergenic
948809941 2:240469325-240469347 CTGGTGGTCTGAGGTGTGGCCGG - Intergenic
948965039 2:241372694-241372716 CTGGTGGCGAGAGGTGTGCCAGG + Intronic
1169010263 20:2244496-2244518 GAGGTGGTGTGTGGTGGGTGCGG - Intergenic
1169982683 20:11404183-11404205 CAAGTAGAGTGGGGTGTGTCAGG + Intergenic
1170846167 20:19963744-19963766 GAGGTGGTGTGAGGGCTGGCTGG + Intronic
1171265319 20:23766886-23766908 CAGGTGGTGAGAGGAGGGTGTGG + Intergenic
1172480694 20:35269721-35269743 GAGGGGGAGAGAGGTGTGTCAGG - Intronic
1173302865 20:41819168-41819190 CAGGAGGTCAGAGGTGTGACAGG - Intergenic
1174321054 20:49741950-49741972 CAGGGGCTGGGAGGCGTGTCAGG - Intergenic
1176049347 20:63108417-63108439 CAGGAGGTGAGAGGTCAGTCTGG - Intergenic
1178264709 21:31132340-31132362 CAGATGCTGTGAGGTGTGAAGGG - Intronic
1178742730 21:35217683-35217705 CAGGTGGGATGAGGTATGCCAGG + Intronic
1179620936 21:42615471-42615493 TATGTGGTGTGTGGTGTGTGTGG - Intergenic
1179620959 21:42615745-42615767 TATGTGGTGTGTGGTGTGTGTGG - Intergenic
1179751045 21:43467825-43467847 TATGTGGTGTGTGGTGTGTGTGG - Intergenic
1179769650 21:43605290-43605312 CAGCTGGTGTGTTGTGTGTGGGG - Intronic
1179886033 21:44314602-44314624 CTGGTGGGGAGGGGTGTGTCTGG + Intronic
1179937575 21:44614957-44614979 CAGGTGGGGTGAGGTGCCTGGGG - Intronic
1181058825 22:20272397-20272419 CAGGTGGTGGGAGGTGCGCATGG - Intronic
1181134077 22:20751987-20752009 CAGTTGGTGTCAGGTTTGTCTGG - Intronic
1181776008 22:25160693-25160715 CAGGTGTAGTCAGGTGTGGCTGG - Intronic
1182210739 22:28675216-28675238 TGTGTGGTGTGAGGTGTGTGTGG - Intronic
1182424816 22:30266413-30266435 GAAGTGGTGTGAGGTGTGGAGGG - Intronic
1182696963 22:32204427-32204449 CCGGTGGTGGGAGGCGTGTTAGG - Intergenic
1183311330 22:37111345-37111367 CGTATGGTGTGAGGTGTGTATGG + Intergenic
1183618955 22:38961698-38961720 CAGGTGGGGTGGGGTGGGTGGGG + Intronic
1183624158 22:38991643-38991665 CAGGTGGGGTGGGGTGGGTGGGG + Intronic
1184217461 22:43077204-43077226 AAGGTGGTGTGAGGTGTACCTGG - Intronic
1184457240 22:44618155-44618177 CATGAGGTGTGTGGTGTGTGTGG - Intergenic
1184688683 22:46107779-46107801 CACGTGTTGTGGGGTGTGTGCGG - Intronic
1185056858 22:48585391-48585413 TATGTGGTGTGTGGTGTGTGTGG - Intronic
1185351075 22:50339075-50339097 TATGTGGTGTGTGGTGTGTGTGG + Intergenic
1185351137 22:50339749-50339771 GTGGTGGTGTGTGGTGTGTGTGG + Intergenic
1185391508 22:50563833-50563855 CAGGGGGTCTAAGGTTTGTCAGG - Intergenic
950447859 3:13048477-13048499 CAGGTGGGGAGAAGTGTGTGAGG - Intronic
951162453 3:19441214-19441236 CAGGAGCTGTGTGGAGTGTCAGG - Intronic
954436295 3:50498173-50498195 CAGGTGGGCTGAGCTCTGTCTGG - Intronic
954932272 3:54294556-54294578 CTGGTGGTGTGGGGAGTGTGTGG + Intronic
955353421 3:58210716-58210738 GAGAGGGTGTGAGGGGTGTCTGG + Intronic
955877522 3:63508445-63508467 CAGGTGATGTAAGGTGACTCTGG + Intronic
958044538 3:88267429-88267451 CATGTAGTGTGTGGTGTGGCGGG - Intergenic
958486595 3:94719712-94719734 CAGTAGCTGTGAGGTGTGTTGGG - Intergenic
961451582 3:127004646-127004668 CACGTCCTGTGAGCTGTGTCTGG + Exonic
961465652 3:127079454-127079476 CAGGTGCTGAGAGGGGTTTCTGG + Intergenic
961606770 3:128101455-128101477 CAGAGGGTGTGGGGTGTGTGGGG - Intronic
962230786 3:133663706-133663728 CAGGAGCAGTGTGGTGTGTCAGG - Intergenic
963277099 3:143342784-143342806 CAGGTGGGGTATGGTGTATCTGG + Intronic
963710978 3:148747105-148747127 CACGTGGTGAGAGATGTGGCTGG - Intergenic
963921844 3:150913224-150913246 CAGATGGTGTGAGGGGAGACAGG - Intronic
965356661 3:167682766-167682788 CAGGTGATTTGAGGCATGTCTGG + Intergenic
966925204 3:184640116-184640138 CAGGTTGGGTGAGGGGTGTGTGG + Intronic
967884653 3:194325016-194325038 TATGTGGTGTGTGGTGTGTGTGG - Intergenic
968001587 3:195210190-195210212 CAGGTGCTGTCAGTTCTGTCAGG - Intronic
968194496 3:196695303-196695325 GATGTGGTGTGTGGGGTGTCTGG - Intronic
968668476 4:1834523-1834545 CTGATGGTGTGAGGTGTGGGTGG - Intronic
968963449 4:3757505-3757527 CAGGTGGTGTGTGGCGTCTGTGG + Intergenic
969683041 4:8653653-8653675 CAGGTGGTGGGGGGTGTGACGGG + Intergenic
971651372 4:29279601-29279623 CAGGAGGTGGGAGGTGGGTATGG + Intergenic
975696786 4:77021606-77021628 CAGGTGGTGTGAGGTGTGTCTGG + Intronic
976053449 4:81033937-81033959 CAGGTGGTGTGCTGTGTATGGGG + Intronic
976219192 4:82742346-82742368 GAGCTGGTGTGAGGTCTGACCGG + Intronic
977526812 4:98156088-98156110 CAGGTAGTGTCAGGTGTGTCTGG - Intergenic
977837949 4:101667198-101667220 CATATGGTTTGAGGTGTGTGTGG + Intronic
978104177 4:104881719-104881741 CAGGTGGTGTGAATTCTGGCAGG - Intergenic
980209395 4:129766226-129766248 GAGGTGGGGTGAGGTGGGGCTGG + Intergenic
981844517 4:149152292-149152314 CAGGTGGTCTAAGGTCTGTAGGG + Intergenic
981937428 4:150251383-150251405 TGGGGGGTGTGAGGTGTGTGGGG - Intronic
982301248 4:153881355-153881377 CAGCTGGTGTGAGGTGTCTGAGG - Intergenic
985069209 4:186151504-186151526 CAGGTGTGCTTAGGTGTGTCAGG + Intronic
985754334 5:1704237-1704259 CAGTTTGTGTGGGGTGTGCCTGG + Intergenic
985963627 5:3322887-3322909 CATGTGGTGTGTGATGTGCCTGG + Intergenic
987672065 5:21022760-21022782 CAGCTGGTGAGAGCTGTGGCTGG - Intergenic
989123780 5:38031393-38031415 CAGATGGTTTGAGGTGTGTCAGG + Intergenic
991700613 5:69313211-69313233 CAGGGGGTGGGAGGTCTGTTTGG + Intronic
998103190 5:139451188-139451210 TATGTGGTGTGGGGTGTGTGTGG + Intronic
1001397871 5:171429618-171429640 CAGGTGGTGTGGAATGTGGCTGG + Intronic
1002435449 5:179228353-179228375 CTGGTGGAGTGAGCTGAGTCAGG - Intronic
1003463386 6:6353042-6353064 CAGGTGGTGTGCGGTGTGTGTGG - Intergenic
1004953563 6:20702155-20702177 CAGGGCGTGTGATGTGTGTGTGG + Intronic
1005434048 6:25788675-25788697 CAGGAGGTGTGGCCTGTGTCAGG + Intronic
1006626549 6:35401969-35401991 CATGTAGTGTGAGGGGTCTCAGG + Intronic
1006735588 6:36270487-36270509 GAGATGGAGTGAGGGGTGTCCGG - Exonic
1007296003 6:40821020-40821042 GAGGTGGTGTCAGGTGTGCAAGG + Intergenic
1008226608 6:48926402-48926424 CAGGAGGTGTGGGGTGTGGATGG + Intergenic
1010196576 6:73245752-73245774 TGGGTGGTGGGGGGTGTGTCTGG - Intronic
1010602314 6:77844935-77844957 CAGCTTGTGTGAGGGGTGTAGGG + Intronic
1011328158 6:86173554-86173576 TAGGAGGGGTCAGGTGTGTCAGG - Intergenic
1014632316 6:123803089-123803111 CAGGTGCTGGGCGGTGCGTCCGG + Intergenic
1017470213 6:154731955-154731977 AAGGTGGTGTGAGCTGCGGCAGG + Intergenic
1018794666 6:167176524-167176546 CAGGTGGGAGGAGGTGTGTTAGG - Intronic
1018821654 6:167378543-167378565 CAGGTGGGAGGAGGTGTGTTAGG + Intronic
1023565184 7:41517062-41517084 CAGGAGGTGTGAGGTGAGAAGGG - Intergenic
1027318329 7:76997735-76997757 GTGGTGGTGTGTGGGGTGTCTGG + Intergenic
1028891362 7:95991831-95991853 AAGCTGGTGTGGGGTGTGGCAGG - Intronic
1029436862 7:100568505-100568527 CAGGTGGTGTGGTGTGGGGCGGG - Intergenic
1029908730 7:104121007-104121029 CAGGTGGTGTGTGGTCTTACAGG - Intergenic
1031058210 7:117017882-117017904 CAGAGGGTGTGATTTGTGTCCGG + Intronic
1031341539 7:120608757-120608779 CAGGTGTTTTGAGGTGTTTGAGG - Intronic
1032285897 7:130538292-130538314 GAGGTGGTGTGATGTGAGTGGGG + Intronic
1033137676 7:138798346-138798368 CAGGGGGTGGGAGGTGGGGCTGG + Intronic
1035032507 7:155870604-155870626 CAGGTGCTGTGTGGTGTTTCAGG - Intergenic
1035233587 7:157482354-157482376 CGTGTGGTGTGTGGTGTGTGTGG + Intergenic
1035577873 8:719493-719515 CAGGTGCTGTGAGGTCTGCTGGG + Intronic
1035621114 8:1036373-1036395 CGTGTGGTGTGAGGTGGGGCTGG + Intergenic
1035685694 8:1522075-1522097 CAGGTGATTTGGGGTGTCTCTGG + Intronic
1035736318 8:1889834-1889856 TAGGTGGGGTGAGGTTTGTGAGG + Intronic
1036960384 8:13238919-13238941 CAGATGGTGTGGGGGGTGTAGGG + Intronic
1037299123 8:17432922-17432944 CAGGTGGTATTAGGTGAGTCAGG + Intergenic
1040301161 8:46188699-46188721 AAGGTGGTGTGGGCGGTGTCAGG - Intergenic
1040520751 8:48174137-48174159 ATGGTGGTGTGTGGTGTGTGTGG + Intergenic
1041369175 8:57142150-57142172 CAGGCGGTGGGAGGTGGGCCTGG - Intergenic
1044511446 8:93085009-93085031 CAGGAGGTGGGCGGTGTGTGAGG - Intergenic
1045414473 8:101952495-101952517 CAGGAGGGCTGAGATGTGTCTGG - Intronic
1048321645 8:133404924-133404946 GGGGTGGTGTGTGGTGTGTGTGG - Intergenic
1053173419 9:35906565-35906587 GAGGTGGTGAGGGGTGTGGCGGG - Exonic
1053285548 9:36847657-36847679 CAGGAGCTGTGAGGTGTGCCAGG + Intronic
1053790573 9:41683505-41683527 CAGATGATGTGAGGTGGGTGGGG - Intergenic
1054154587 9:61631296-61631318 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1054178918 9:61895204-61895226 CAGATGATGTGAGGTGGGTGGGG - Intergenic
1054474361 9:65562372-65562394 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1054658619 9:67685627-67685649 CAGATGATGTGAGGTGGGTGGGG + Intergenic
1055796824 9:79983456-79983478 AAGGTGGTTTGAATTGTGTCAGG + Intergenic
1056580554 9:87886056-87886078 CAGGGGGTGAGAGGTGGGCCTGG - Exonic
1056740829 9:89253749-89253771 TATGTGGTGTGTGGTGTGTGTGG + Intergenic
1056756201 9:89383454-89383476 CTGGTGTTTTGTGGTGTGTCTGG - Intronic
1056852913 9:90099008-90099030 TGGGTGGTGTGATGTGTGTGTGG - Intergenic
1057407420 9:94785674-94785696 CCAGTGGTGTGAGGGGTTTCTGG + Intronic
1061995873 9:134182934-134182956 CATGTGGTGTGTGGTGTGTGTGG + Intergenic
1062280399 9:135749302-135749324 CAGGTGGGGTGAGGTGGGGTGGG - Intronic
1062383108 9:136297158-136297180 CAGGTGGCGTGAGCTGTGGGTGG + Intronic
1062448568 9:136606066-136606088 CTGGGGGTTTGAGGTCTGTCTGG + Intergenic
1062475091 9:136722734-136722756 CAGGAGGCGGGAGGTCTGTCTGG + Intronic
1186480012 X:9889580-9889602 CAGATGTGATGAGGTGTGTCTGG - Intronic
1188734313 X:33693658-33693680 CAGATGCAGTGAGGTGTGTGTGG - Intergenic
1191933823 X:66404805-66404827 CAGTTGGGGTGAGGTGATTCAGG + Intergenic
1192152362 X:68720168-68720190 CAGGTGGGGTGAGGGGGGTAAGG - Intronic
1194895093 X:99430740-99430762 CAGGTGGAGTGTGGTGGTTCTGG - Intergenic
1196368983 X:114954172-114954194 CAGCTGCTGTGGGGTGTGTTGGG + Intergenic
1196686361 X:118513830-118513852 CAGGTGCTCTGAAGTGTGCCTGG - Intronic
1200236639 X:154470879-154470901 CAGGTGGTGAGAGCGGTGACAGG + Intronic
1202050496 Y:20775696-20775718 CAGGTGGGGTGCGGTGGCTCGGG - Intronic