ID: 975698371

View in Genome Browser
Species Human (GRCh38)
Location 4:77037384-77037406
Sequence AGGCTATGTAGAGCACAGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 167}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975698371_975698380 23 Left 975698371 4:77037384-77037406 CCTGCCTGTGCTCTACATAGCCT 0: 1
1: 0
2: 0
3: 5
4: 167
Right 975698380 4:77037430-77037452 GAGGGCCCTTGATTCTGGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 128
975698371_975698379 18 Left 975698371 4:77037384-77037406 CCTGCCTGTGCTCTACATAGCCT 0: 1
1: 0
2: 0
3: 5
4: 167
Right 975698379 4:77037425-77037447 GCTCAGAGGGCCCTTGATTCTGG 0: 1
1: 0
2: 0
3: 11
4: 116
975698371_975698377 4 Left 975698371 4:77037384-77037406 CCTGCCTGTGCTCTACATAGCCT 0: 1
1: 0
2: 0
3: 5
4: 167
Right 975698377 4:77037411-77037433 GGCATCATTGGATAGCTCAGAGG 0: 1
1: 0
2: 2
3: 9
4: 110
975698371_975698375 -8 Left 975698371 4:77037384-77037406 CCTGCCTGTGCTCTACATAGCCT 0: 1
1: 0
2: 0
3: 5
4: 167
Right 975698375 4:77037399-77037421 CATAGCCTCATGGGCATCATTGG 0: 1
1: 0
2: 0
3: 5
4: 92
975698371_975698378 5 Left 975698371 4:77037384-77037406 CCTGCCTGTGCTCTACATAGCCT 0: 1
1: 0
2: 0
3: 5
4: 167
Right 975698378 4:77037412-77037434 GCATCATTGGATAGCTCAGAGGG 0: 1
1: 0
2: 0
3: 20
4: 671

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975698371 Original CRISPR AGGCTATGTAGAGCACAGGC AGG (reversed) Exonic
901218129 1:7566157-7566179 AGTCTCTAGAGAGCACAGGCAGG - Intronic
902033674 1:13440760-13440782 TGGCTCTGTAGAGTGCAGGCTGG - Intergenic
904342830 1:29848687-29848709 AGTCTACTTGGAGCACAGGCTGG + Intergenic
906284871 1:44580701-44580723 AGGCTTTATAGAGAACAGTCTGG + Intronic
906344719 1:45008004-45008026 GGGCTATTGACAGCACAGGCAGG - Intronic
908563671 1:65332255-65332277 AGGATATGTAGACTACAGGAAGG + Intronic
910262078 1:85302684-85302706 AGGCCATGGGGAGCACAGCCAGG - Intergenic
912809018 1:112779677-112779699 AGGCTGTGTAGTGCACAGTGAGG - Intergenic
913213035 1:116597500-116597522 AGGCTAGGAAGAGCAAAGGTGGG - Intronic
917510219 1:175663381-175663403 AGAATTTGTAGTGCACAGGCAGG + Intronic
917868799 1:179223764-179223786 ATGCTATGGAAAGCACAGGAAGG - Intronic
918510064 1:185302658-185302680 AGGCTATTTTGAGAAAAGGCAGG + Intronic
922507704 1:226136033-226136055 AGGCAATGGAGAGCACCGGGTGG + Intergenic
924101686 1:240609899-240609921 AGGGTATGTAAAGCTCTGGCTGG + Intronic
924911855 1:248522027-248522049 TGGCTATGTAGCGCAGTGGCCGG - Exonic
1067495643 10:46757793-46757815 AGGCTATGAAAAGGACAGGAAGG - Intergenic
1067745239 10:48930584-48930606 AGGCTATGGAGAACACATGGAGG + Intronic
1067948673 10:50709180-50709202 AGGCTATGAAAAGGACAGGAAGG + Intergenic
1071650547 10:87390477-87390499 AGGCTATGAAAAGGACAGGAAGG + Intergenic
1073674138 10:105626430-105626452 AGGCTAAGTATAGCACAGCTGGG + Intergenic
1075251163 10:120875399-120875421 ATGCTATGGACAGCACAGGTAGG - Intronic
1075281229 10:121140409-121140431 AGGCTATGTGGAGCAGGGGTTGG - Intergenic
1075480988 10:122781675-122781697 AGGCTGTGTAGGGGACAGCCAGG - Intergenic
1076499334 10:130924082-130924104 GGCCTTTGTACAGCACAGGCTGG - Intergenic
1076676214 10:132149022-132149044 AGCCTCTGGAGAACACAGGCTGG - Intronic
1077420218 11:2446483-2446505 AGGCTCAGTAGAGAACTGGCTGG + Intronic
1077729177 11:4710240-4710262 AGGCAATGCAGAGCACAGAGCGG - Intronic
1078774611 11:14382856-14382878 AGGCTATGTATAGCACACTTTGG + Intergenic
1079093719 11:17497697-17497719 AGATTATGTAGTGCACAGCCTGG + Intronic
1079233384 11:18669308-18669330 ATACTATGTAGAGCAGAGACTGG + Intergenic
1082634173 11:55576649-55576671 AGGTTATGTATAAAACAGGCAGG - Intergenic
1082831934 11:57624838-57624860 AGGATCTGTAGAGACCAGGCTGG - Intergenic
1083294856 11:61709866-61709888 TGGCCATCTAGGGCACAGGCTGG - Intronic
1083806767 11:65079052-65079074 TGGCTATGTACAGGACAGGAGGG + Exonic
1084237112 11:67795351-67795373 TGGCTTTGTATAGCCCAGGCTGG - Intergenic
1084378151 11:68792504-68792526 AGGCCATGGACAGCACAGCCTGG + Intronic
1085175838 11:74487386-74487408 AGGCTGTGTGAGGCACAGGCTGG - Intergenic
1087905244 11:103688324-103688346 GGGCTGTGTAGATCACAGGATGG + Intergenic
1088814309 11:113410828-113410850 AGGCGCTGTACAGGACAGGCGGG + Exonic
1089125938 11:116176635-116176657 AGTCTCTGCAGAACACAGGCTGG + Intergenic
1089461275 11:118655776-118655798 AGCCTCTGTAGAGGGCAGGCTGG - Intronic
1091911250 12:4232347-4232369 AGGCTGTTTAGGGCCCAGGCTGG + Intergenic
1096415885 12:51412581-51412603 AGGCTAGGAAGAGCAGGGGCAGG - Intronic
1096729643 12:53597954-53597976 AGGCTATGTAAATCCCAGGATGG - Intronic
1097686269 12:62693869-62693891 GGGCTATGTGGAGCGAAGGCGGG + Intronic
1102475051 12:113183356-113183378 AGGTAATGAACAGCACAGGCGGG - Intronic
1103296761 12:119893548-119893570 AGGCTATGGAGGGCATATGCTGG - Intergenic
1106435799 13:29722016-29722038 AGGCTATTCGCAGCACAGGCTGG + Intergenic
1109800823 13:67376203-67376225 AGGGTATGCAGAACAGAGGCAGG + Intergenic
1117752586 14:58939169-58939191 AGGCTAGGTACAGCACAGCAAGG + Intergenic
1118747951 14:68787265-68787287 AAGGAATGAAGAGCACAGGCTGG + Intergenic
1119274515 14:73341597-73341619 AGGCTAAGTACAGTACAGGTAGG + Intronic
1119804734 14:77475379-77475401 AGGGTATGTAGGGCCCAGGGTGG - Exonic
1119811059 14:77519686-77519708 AGGATCTGTATAGCCCAGGCTGG - Intronic
1119965045 14:78905190-78905212 ATCCTCTGTAGAACACAGGCTGG - Intronic
1120195051 14:81472159-81472181 AGGCTAAGTGGTGAACAGGCAGG + Exonic
1122205824 14:100147509-100147531 TGTCTGTGTAGAGCAAAGGCTGG - Intronic
1122685364 14:103502128-103502150 AGCCTAAGTAGAGCCCAGGCCGG - Intronic
1126693091 15:51302964-51302986 AGGCTGTGAGGAGCTCAGGCTGG + Intronic
1129570376 15:76676396-76676418 TGACTATGTAGAACAGAGGCAGG - Intronic
1129604495 15:77018263-77018285 AGGCCATGGGGAGCGCAGGCAGG + Intronic
1130371174 15:83285795-83285817 TGGCTATGGAAGGCACAGGCAGG + Intergenic
1131178501 15:90224824-90224846 TGGCTCTGTAGAGCACTGCCAGG + Intronic
1132789197 16:1675628-1675650 AGCCACTGTAGACCACAGGCAGG + Exonic
1134774359 16:16838923-16838945 ATAGTATGTAGAGAACAGGCAGG - Intergenic
1137954404 16:52814479-52814501 AGGGAATGTAGAGCAAAGCCAGG - Intergenic
1139555274 16:67704919-67704941 AGGCATTGTGGAGCAGAGGCAGG - Intronic
1140150422 16:72358010-72358032 TGACTCAGTAGAGCACAGGCAGG + Intergenic
1142410380 16:89912976-89912998 AGCCTGTGGGGAGCACAGGCTGG + Intronic
1143719020 17:8797542-8797564 AGGCCTGGTAGAGCACAGCCAGG + Exonic
1146312037 17:31776654-31776676 AGGCCAAGCAGAGCACAGGGTGG + Intergenic
1146508426 17:33425378-33425400 AGTCTCTGTAGAGTACAGACAGG + Intronic
1148079518 17:44960044-44960066 AGGCGGTGTTGAGCACGGGCCGG + Exonic
1148738028 17:49875757-49875779 TGGCTATGAAGAGCAGGGGCGGG + Intergenic
1148862860 17:50613582-50613604 AGACAATGTAGAGGAGAGGCTGG - Intronic
1149413717 17:56436074-56436096 CAGCTATGTAAATCACAGGCTGG - Intronic
1157264897 18:46210114-46210136 CTGCTATGTAGAGAACAGGTTGG + Intronic
1159304044 18:66616451-66616473 AGTCTCTGTAGAGCATGGGCGGG - Intergenic
1159918841 18:74209411-74209433 AGGATATGTAGAGCAGAAGGAGG - Intergenic
1161422679 19:4184482-4184504 AAGCTAGGCAGGGCACAGGCCGG - Intronic
1162873617 19:13604191-13604213 AGGCTATCTGTAGCCCAGGCTGG - Intronic
1166641333 19:44497634-44497656 AGGCCATGTTGGGCACAAGCTGG - Intronic
925576180 2:5362776-5362798 AGGCTTTCAGGAGCACAGGCAGG + Intergenic
927340703 2:21980782-21980804 AGACTATGTAGAGCTGCGGCGGG + Intergenic
927955320 2:27203801-27203823 AGGCAATGAAGAGCCCTGGCAGG + Exonic
927990447 2:27443297-27443319 AGGCTTTGTAGACCACAAGAAGG - Intronic
929942747 2:46347311-46347333 AGGCTGTGGAGAACACGGGCTGG + Intronic
930421088 2:51153439-51153461 ATGCTGAGGAGAGCACAGGCTGG + Intergenic
931962032 2:67492946-67492968 AGGCTGGGGAGAGGACAGGCAGG + Intergenic
934298048 2:91758610-91758632 AGGCTAGGAAGAGCAAAGGTGGG + Intergenic
935274996 2:101468389-101468411 AGGCTGTGTAAGACACAGGCAGG - Intronic
935578564 2:104735997-104736019 AGACTTTGTAGAGGCCAGGCAGG + Intergenic
935691685 2:105737611-105737633 AGGCAATGCAGACCACAGACAGG + Intergenic
945681284 2:212917150-212917172 GGGCTGTGTAGAGCACAGACAGG + Intergenic
946460681 2:219865806-219865828 AGGCTGTGTAGAGAACAGATTGG - Intergenic
947845210 2:233238188-233238210 AGGCTATGGAGTCCACAGGCTGG + Intronic
948304504 2:236936494-236936516 AGGGTATGGAGAGCCCATGCAGG + Intergenic
1169345782 20:4827193-4827215 AGGCTATGCAGAGAACTGGGAGG + Intergenic
1172588758 20:36103054-36103076 AGGCTTTGTAGGACATAGGCTGG - Intronic
1172882058 20:38208526-38208548 AGGCTTTGTAGATCACAGAAAGG + Intergenic
1173057666 20:39631772-39631794 AGGCTGTGTACAGGACAGGCAGG - Intergenic
1176003970 20:62849417-62849439 AGGCTTTGAAGAGATCAGGCCGG - Intronic
1176930987 21:14809915-14809937 AGGCTATCTAGTCCCCAGGCAGG - Intergenic
1178112045 21:29378439-29378461 AGGCTGTGCAGAGAACAGGATGG - Intronic
1181289467 22:21780415-21780437 AGTCTCTGTAGAGGACAGTCTGG - Intronic
1183722675 22:39571609-39571631 AGGCTCAGAAGAGCACAGGGGGG - Intronic
1183996137 22:41634105-41634127 AGGCCAGCTAGAGCTCAGGCAGG + Intronic
1184053443 22:42026866-42026888 AGGCTCTGTATCCCACAGGCGGG - Exonic
950149907 3:10678797-10678819 AGGGTATGTACACCATAGGCTGG - Intronic
950996402 3:17502092-17502114 AGGCAGTGTAGAGCAAAGACAGG - Intronic
951615160 3:24533973-24533995 AAGGTAGGTAGAACACAGGCTGG + Intergenic
955410766 3:58654034-58654056 GGGCTAAGTGGAGCCCAGGCAGG - Intronic
957492835 3:80951736-80951758 AGTCTCTGTAGAGCCCATGCAGG - Intergenic
959502721 3:107125003-107125025 GGGCCATCTGGAGCACAGGCTGG + Intergenic
960293634 3:115916196-115916218 AGGCTTTGAAGAGAAAAGGCAGG - Intronic
960632316 3:119744494-119744516 TTGCTGTGTGGAGCACAGGCTGG + Intronic
961490958 3:127256519-127256541 AGACTATGTAGAGCCAAGCCAGG - Intergenic
962410088 3:135133325-135133347 AGGATTTGTTGAGCTCAGGCTGG - Intronic
968044462 3:195616282-195616304 AGGCCACGGTGAGCACAGGCAGG - Intergenic
968060251 3:195722333-195722355 AGGCCACGGTGAGCACAGGCAGG - Intronic
973797976 4:54448390-54448412 AGGCAATGCAGAGCACAGGTGGG + Intergenic
975042232 4:69760546-69760568 AGGCAATGGGGAGCACAGGAAGG + Exonic
975698371 4:77037384-77037406 AGGCTATGTAGAGCACAGGCAGG - Exonic
976070944 4:81239078-81239100 AGGGTATGTACAGCAATGGCTGG - Intergenic
976245693 4:83004099-83004121 AGAGTATGTAGAAAACAGGCCGG + Intronic
976408369 4:84684818-84684840 AGGTTAGGTAGAGCCCAGCCTGG - Intronic
977666456 4:99650979-99651001 AGACAATCTTGAGCACAGGCAGG + Exonic
977909693 4:102518813-102518835 AGACCATGTGGAGCACAGACAGG - Intronic
978690393 4:111502389-111502411 AAAGTATTTAGAGCACAGGCAGG - Intergenic
981172787 4:141644208-141644230 CTGCTATGTTGAGAACAGGCTGG - Intronic
982436815 4:155389647-155389669 AGCCTTTGTACATCACAGGCAGG - Intergenic
985193057 4:187398681-187398703 AGGCTGTGTAGACTACAGGGTGG + Intergenic
985923328 5:2996531-2996553 GGGCTATGCAGAGCTGAGGCTGG - Intergenic
986349295 5:6862443-6862465 AGGCTTTGTTGATCACATGCTGG + Intergenic
990566487 5:57034758-57034780 AGGCCAGGTAGAGCAGAGACTGG - Intergenic
991511898 5:67387304-67387326 ATGCTATGTAGAGCACTGTAGGG + Intergenic
995199549 5:109410726-109410748 AGGCTATACAGAGGAAAGGCAGG - Intergenic
997456106 5:134018672-134018694 AGGATATTTAGGGCAGAGGCTGG + Intergenic
998954743 5:147427617-147427639 TGGTGATGTAGAGCACAGCCTGG - Intronic
1007395725 6:41576594-41576616 AGGCTATGTTGGGGAGAGGCTGG + Intronic
1007581159 6:42960941-42960963 AGGCTACGTCGAGCACCCGCTGG - Exonic
1007854797 6:44844962-44844984 AGGATTTGTACATCACAGGCAGG + Intronic
1008563412 6:52744144-52744166 AGGCTTTGAAGAGCACAGAAAGG - Intergenic
1012625614 6:101400711-101400733 AGGCTTTGTAGAACAAAGGTAGG + Intronic
1014574038 6:123047668-123047690 ATTCTATTTAGAGCACAAGCAGG - Intronic
1015349334 6:132198367-132198389 GGGGTATGTAAAGAACAGGCAGG - Intergenic
1017183786 6:151579567-151579589 AGGCTCTGTAGAGCACCCTCAGG + Intronic
1018711188 6:166499116-166499138 AGGGTGTGGAGAGCACAGACAGG + Intronic
1018940247 6:168304765-168304787 AGGCTATGAGGAGGCCAGGCGGG + Intronic
1020815018 7:12894415-12894437 AGTCAATGTAGAGCAGAGGAAGG + Intergenic
1022624430 7:32020074-32020096 AGGCCATGGAGAGCCCATGCCGG + Intronic
1024044705 7:45578710-45578732 AGGCAATGCAGGGCACAGGGTGG - Intronic
1028404856 7:90464283-90464305 GGCCAATGTAGAGCTCAGGCTGG + Intronic
1034326896 7:150244724-150244746 AGGCTGGGAAGAGCAGAGGCAGG - Intronic
1034326899 7:150244740-150244762 AGGCTGGGAAGAGCAGAGGCTGG - Intronic
1034391411 7:150790512-150790534 CCTCTATGTAAAGCACAGGCTGG + Intergenic
1034766308 7:153724711-153724733 AGGCTGGGAAGAGCAGAGGCTGG + Intergenic
1034766311 7:153724727-153724749 AGGCTGGGAAGAGCAGAGGCAGG + Intergenic
1034995066 7:155571824-155571846 AGGCCCTGCAGGGCACAGGCTGG + Intergenic
1035583928 8:757620-757642 AGGCTGTGTGGTCCACAGGCGGG + Intergenic
1044243778 8:89917369-89917391 AGGATATGAAGATCACAGCCTGG - Intronic
1045019347 8:98028053-98028075 AGGCTAAGCTGACCACAGGCGGG + Intronic
1046456239 8:114466484-114466506 AAGCTATTTATATCACAGGCAGG - Intergenic
1047458990 8:125044167-125044189 ATGCTATGCAGAACAGAGGCTGG + Intronic
1048407470 8:134138091-134138113 AGCCCATGGAGAGCACAGGAAGG + Intergenic
1048964343 8:139604488-139604510 ACGCCATGGAGAGCACAAGCCGG + Intronic
1049613183 8:143565281-143565303 AGGCTGTGTGCAGCGCAGGCGGG - Intergenic
1049966596 9:785653-785675 AGGCCATGGAGAACACAGACAGG + Intergenic
1055647417 9:78374194-78374216 GGGCTATGTAGAAGGCAGGCAGG - Intergenic
1060775016 9:126366825-126366847 GTGCTACGGAGAGCACAGGCTGG - Intronic
1061414588 9:130439523-130439545 AGGGGATGGTGAGCACAGGCAGG + Intergenic
1061980182 9:134098324-134098346 AGACTATTTAAAGCGCAGGCTGG - Intergenic
1200937898 Y:8754308-8754330 AGGGAATGGGGAGCACAGGCAGG + Intergenic