ID: 975699973

View in Genome Browser
Species Human (GRCh38)
Location 4:77055204-77055226
Sequence CTCCATTTCCAGACTAACCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975699972_975699973 -5 Left 975699972 4:77055186-77055208 CCAATCAGGAATGAGTTTCTCCA 0: 1
1: 0
2: 2
3: 24
4: 147
Right 975699973 4:77055204-77055226 CTCCATTTCCAGACTAACCATGG 0: 1
1: 0
2: 1
3: 14
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975699973 Original CRISPR CTCCATTTCCAGACTAACCA TGG Exonic
900542975 1:3213222-3213244 CTCCATTTCCCCCCTCACCACGG - Intronic
905609802 1:39340533-39340555 CTCCAGCTCCTGACTGACCAAGG - Intronic
905652571 1:39666308-39666330 CTCCATGTCCTCACTACCCAGGG - Intronic
906821301 1:48933150-48933172 TTTCATTTTCAGAATAACCATGG - Intronic
907055828 1:51367112-51367134 CTCCGTTTCCAGATTCACCCAGG - Intronic
908741927 1:67337772-67337794 CTCCATTCCTAGACTTATCATGG - Intronic
909011074 1:70335496-70335518 CTCACTTTCCAGAATAACCGGGG + Intronic
910293564 1:85622329-85622351 TTCTATTTCCAGAGTAGCCAGGG - Intergenic
912309063 1:108601057-108601079 CTCCATTTTCAGGAAAACCAGGG + Intronic
912372743 1:109186455-109186477 CTCCCTTTCCTAACTAAGCATGG + Intronic
913472788 1:119206276-119206298 CTCCATTTCCATACAAACGATGG + Intergenic
913605765 1:120464364-120464386 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
913643183 1:120831976-120831998 CTCCTTTTCCAGGCTCAGCAGGG + Exonic
913643484 1:120834618-120834640 CTCCTTTTCCAGGCTCAGCAGGG + Intronic
913643950 1:120838733-120838755 CTCCTTTTCCAGGCTCAGCAGGG + Intronic
914082784 1:144424852-144424874 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914177698 1:145293366-145293388 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914178243 1:145298124-145298146 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914178788 1:145302886-145302908 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914179166 1:145306055-145306077 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914179542 1:145309238-145309260 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914180086 1:145313994-145314016 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914180631 1:145318766-145318788 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914181174 1:145323528-145323550 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914181717 1:145328276-145328298 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914182262 1:145333043-145333065 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914182807 1:145337799-145337821 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914183352 1:145342549-145342571 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914183896 1:145347307-145347329 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914184440 1:145352079-145352101 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914184984 1:145356841-145356863 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914185529 1:145361588-145361610 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914186075 1:145366342-145366364 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914186621 1:145371102-145371124 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914187165 1:145375850-145375872 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914187708 1:145380602-145380624 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914188253 1:145385356-145385378 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914188796 1:145390106-145390128 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914210656 1:145575809-145575831 CTCCTTTTCCAGGCTCAGCAGGG - Intergenic
914269948 1:146071309-146071331 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914270489 1:146076031-146076053 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914271025 1:146080767-146080789 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914271563 1:146085503-146085525 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914272098 1:146090224-146090246 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914272634 1:146094942-146094964 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914273172 1:146099664-146099686 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914273711 1:146104386-146104408 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914274249 1:146109104-146109126 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914274785 1:146113814-146113836 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914275319 1:146118532-146118554 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914275854 1:146123268-146123290 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914366975 1:146987942-146987964 CTCCTTTTCCAGGCTCAGCAGGG + Exonic
914367511 1:146992700-146992722 CTCCTTTTCCAGGCTCAGCAGGG + Exonic
914485474 1:148105518-148105540 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914532787 1:148537996-148538018 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914533321 1:148542716-148542738 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914533856 1:148547430-148547452 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914534392 1:148552138-148552160 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914534928 1:148556852-148556874 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914535463 1:148561569-148561591 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914536000 1:148566305-148566327 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914536534 1:148571027-148571049 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914536895 1:148574215-148574237 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914585440 1:149057497-149057519 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914585806 1:149060685-149060707 CTCCTTTTCCAGGCTCAGCAGGG - Exonic
914629027 1:149491127-149491149 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914629560 1:149495890-149495912 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914630095 1:149500645-149500667 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914630629 1:149505406-149505428 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914631160 1:149510167-149510189 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914631693 1:149514924-149514946 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914632229 1:149519676-149519698 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914632766 1:149524433-149524455 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914633300 1:149529162-149529184 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914633836 1:149533913-149533935 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914634372 1:149538664-149538686 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914634905 1:149543401-149543423 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914635440 1:149548138-149548160 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
914635975 1:149552875-149552897 CTCCTTTTCCAGGCTCAGCAGGG + Intergenic
915038356 1:152947244-152947266 CTACCTTTCCAGACTTACCAAGG - Intergenic
915094180 1:153447794-153447816 CAGGACTTCCAGACTAACCAGGG - Intergenic
915262390 1:154686478-154686500 CTCCAATCCCAGACTAAGCAGGG + Intergenic
917520874 1:175747631-175747653 CTCAATTCCTAGACTAACCTAGG + Intergenic
919942712 1:202299306-202299328 CTCCATTGCCAGAGTCACCAAGG + Intronic
1063138701 10:3238404-3238426 CTCCACTTCCAGACTAGCACAGG - Intergenic
1065154059 10:22851743-22851765 ATCCATCTCCACACTAACCCAGG - Intergenic
1065990306 10:31003072-31003094 CCACATTTCCAGACTCCCCATGG - Intronic
1066619037 10:37324731-37324753 TTCTATTTCCAGAATCACCAGGG - Intronic
1067551377 10:47238692-47238714 CTCCAATTCCACACTAAGGATGG + Intergenic
1067656220 10:48193798-48193820 CTCCATTTCAAGGATATCCATGG + Intronic
1070403167 10:76071116-76071138 CTTCATTTCCAGATTCGCCAAGG - Intronic
1073456841 10:103642103-103642125 GTCCATTTCCAGACTTATGATGG - Intronic
1073691947 10:105819208-105819230 CTCCATCTCCCAACTAGCCAAGG - Intergenic
1073773244 10:106758523-106758545 CTCCATTTCCAGGATAAACTAGG + Intronic
1074124200 10:110515380-110515402 TTGCATTTCAAGAGTAACCAAGG + Intergenic
1074258711 10:111830351-111830373 CTCAATTTCCAGACTATGCAAGG + Intergenic
1076337462 10:129717962-129717984 TTCCATTTCCAAAATCACCAAGG - Intronic
1082212591 11:49523402-49523424 CTGGAGTTCCAGACTAACCCAGG - Intergenic
1082729557 11:56778626-56778648 CTCTAGTTCCATACTAAGCAAGG + Intergenic
1084698171 11:70768729-70768751 CTCCATCTCCAGGCTCCCCATGG - Intronic
1089698217 11:120228722-120228744 CTCCATTTCCAAGCTTGCCATGG - Intronic
1090956327 11:131515873-131515895 CTCGTTTTCCAGCCTTACCATGG - Intronic
1091675773 12:2488318-2488340 CACCATTTTCTGACTATCCAGGG - Intronic
1096715636 12:53489620-53489642 AATCATTTCCAGACTAACCCAGG - Intronic
1102614739 12:114143698-114143720 CTCCATTTCTAGACTCCCGAAGG + Intergenic
1105267413 13:18834290-18834312 CCCCATTTTCAGACTAAAGAGGG - Intergenic
1107359616 13:39603781-39603803 CTGCCTTTCCAGACGAGCCAGGG + Intergenic
1107959606 13:45546358-45546380 CTCCTTCTCCAGACGAACCCAGG - Intronic
1108306987 13:49147255-49147277 TTCCATTTGCAGCCTGACCAGGG + Intronic
1112489941 13:99853404-99853426 CTACATTTTCAGAGTAAACAGGG + Intronic
1113659797 13:112098120-112098142 ATTCATTACGAGACTAACCAAGG - Intergenic
1118049627 14:62012769-62012791 CACCATTTGCAGAATAGCCAAGG - Intronic
1119228284 14:72960712-72960734 CTCCATTTCCAGCCTCATGATGG + Intergenic
1122240468 14:100362562-100362584 ATACATTTCCAGACTACCCAAGG - Intronic
1122456755 14:101859507-101859529 CTCCAGATCCAGACAAACAAGGG - Intronic
1123230097 15:17098444-17098466 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123230580 15:17106962-17106984 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123230900 15:17112771-17112793 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123232500 15:17140714-17140736 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123232756 15:17145155-17145177 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123233010 15:17149600-17149622 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123233265 15:17154041-17154063 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123233515 15:17158297-17158319 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123236477 15:17209512-17209534 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123236732 15:17213952-17213974 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123236988 15:17218392-17218414 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123238704 15:17248160-17248182 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123238961 15:17252600-17252622 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123239465 15:17261295-17261317 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123241606 15:17298074-17298096 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123244665 15:17350805-17350827 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123244917 15:17355245-17355267 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123245415 15:17363934-17363956 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123245925 15:17372811-17372833 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123246154 15:17376743-17376765 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123248134 15:17411395-17411417 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123248387 15:17415834-17415856 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123248694 15:17421306-17421328 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123249186 15:17429824-17429846 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123249676 15:17438356-17438378 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123249913 15:17442621-17442643 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1123252082 15:17480434-17480456 CTCTTTTTGCAGAATAACCAGGG + Intergenic
1124681281 15:31733331-31733353 CTCCTTTACCAGACTCACCGTGG + Intronic
1127239501 15:57097200-57097222 CACCATTTTCAGACTATCAAAGG + Intronic
1127530136 15:59835593-59835615 CTCCATCTACAGAATGACCAGGG + Intergenic
1128484797 15:68074139-68074161 CTTTATTTCCAGCCTAACCTTGG - Intronic
1128817478 15:70623843-70623865 CTCTATGACCAGTCTAACCAGGG + Intergenic
1128966315 15:72061729-72061751 CAGCATTTCCAGACTCACCCTGG + Intronic
1129187005 15:73914378-73914400 CTCCATTGTCAGACTCAGCAAGG - Intergenic
1130895122 15:88164117-88164139 CTCCATTTCCAGAGGAATCCAGG + Intronic
1134183201 16:12063854-12063876 CTGCATTTCTAGACCATCCATGG + Intronic
1135229979 16:20697668-20697690 CTCCTTTTCCATACCTACCAGGG - Intronic
1137322206 16:47396660-47396682 CTCCATTTCCCTCCTATCCATGG - Intronic
1138008292 16:53356989-53357011 CACCATTTCCAGACTCAGCAGGG + Intergenic
1138060630 16:53886261-53886283 ATCTATTTCCAGAGTCACCATGG + Intronic
1140791363 16:78394718-78394740 ATCCATTTCCATACTATCTATGG - Intronic
1140984463 16:80144686-80144708 TTCAAATTCCAGACCAACCATGG + Intergenic
1142738230 17:1915193-1915215 CTCTATTTCCATACTAATCCTGG - Intergenic
1145397451 17:22506754-22506776 CTCCTCATCCAGACTCACCAGGG - Intergenic
1147205890 17:38837107-38837129 CTCCATTTCTAGCCTCATCATGG - Intronic
1147320053 17:39640587-39640609 AGCCGTTTCCAGACTAACCTTGG + Intronic
1152203412 17:78960276-78960298 CTCCATTTTGAGACTAGCTAGGG + Intergenic
1153247567 18:3088096-3088118 ATCCATTTCCAGACTGCCCTTGG + Intronic
1153300270 18:3586111-3586133 CTCCCTGTCCAGTCTAACCATGG - Intronic
1157909332 18:51600535-51600557 ATTCATTTCCTGACCAACCACGG + Intergenic
1161802405 19:6423759-6423781 CTCCATTTGCAGCCTCCCCATGG - Intronic
1166380423 19:42352633-42352655 CCCCATTTCCATGGTAACCAGGG - Intronic
1166662021 19:44653700-44653722 CTCCATGTCCCCACTGACCAAGG + Intronic
1167987270 19:53329206-53329228 CTCCATTGCGAGACCAGCCAGGG - Intergenic
1168422325 19:56212789-56212811 CTCCATTCCCAGTCTAAAGAAGG + Intergenic
1202676067 1_KI270711v1_random:7979-8001 CTCCTTTTCCAGGCTCAGCAGGG - Intergenic
931477463 2:62603777-62603799 CACCATTTCTAGAGTAAGCAAGG + Intergenic
932670057 2:73729112-73729134 CTCCCTCTCCATACTTACCATGG - Intronic
934593190 2:95577459-95577481 CTCCAGGTACAGACTGACCATGG + Intergenic
935246168 2:101220311-101220333 CTCCATTTACACATTATCCAGGG + Intronic
936999652 2:118454012-118454034 CACCCTTTCCAGACTAAACCAGG - Intergenic
940483326 2:154264331-154264353 CACCACATCCAGACTATCCATGG - Intronic
947109955 2:226707964-226707986 CTCCATTTCCACACAAACTCAGG + Intergenic
1169595427 20:7193092-7193114 CTCCATTTCCAGTCTAGACAAGG + Intergenic
1173015229 20:39219575-39219597 CTCCTTTTCCAGATAAACCTGGG + Intergenic
1176852462 21:13932736-13932758 CCCCATTTTCAGACTAAAGAGGG - Intergenic
1184591207 22:45484594-45484616 CTCCTTTTCCAGCCCCACCATGG + Intergenic
1185368466 22:50447610-50447632 CTGCATTTCCAGCAGAACCAGGG + Intronic
951532444 3:23710370-23710392 CTTCAGTTCCAGGCAAACCAGGG + Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
954018219 3:47714418-47714440 CACCAATTCCAGAAAAACCATGG - Exonic
954336963 3:49924330-49924352 CTCCCTTTCCACACTGAGCAGGG + Intronic
956450014 3:69364584-69364606 CACTATCTCCAGAATAACCATGG + Intronic
957547302 3:81656253-81656275 CTCCATTTCCAGATTCTGCAGGG + Intronic
957736759 3:84213586-84213608 TTCCATTTCCAGCCAAACTAAGG + Intergenic
959732843 3:109623555-109623577 ATCTATTTCCAAACTAAGCATGG - Intergenic
960333008 3:116385958-116385980 CACCATTTACAGAGTAACCATGG + Intronic
961779534 3:129313627-129313649 CACCATCTCCACACTAGCCAGGG + Intergenic
962378907 3:134880993-134881015 CACCATTTCCACACTCACCTTGG + Intronic
965013071 3:163122285-163122307 CACCTTTTCAAGACTAAGCAGGG - Intergenic
966846933 3:184138028-184138050 CTCCATTTTCAGAAGACCCAGGG + Exonic
968351478 3:198057337-198057359 CCCCATTTTCAGACTAATGAGGG - Intergenic
969891246 4:10262035-10262057 CTCCATTTTCAGATTATTCAAGG + Intergenic
970229185 4:13891409-13891431 CACCATTTCCAGACTTCTCAGGG - Intergenic
971672584 4:29581964-29581986 CTCCTTTTCCAGACTACTGATGG + Intergenic
974458469 4:62159115-62159137 CTACATTTGCAGATTAAGCATGG - Intergenic
974823797 4:67101410-67101432 CTCCATTTCAGGACTAAGCCAGG - Intergenic
975699973 4:77055204-77055226 CTCCATTTCCAGACTAACCATGG + Exonic
976028096 4:80715921-80715943 CTTCATTTTAAGAATAACCATGG + Intronic
978914943 4:114113127-114113149 TTCCTTAACCAGACTAACCATGG - Intergenic
979312386 4:119218620-119218642 CTCCATTTCTAGAGTGACAATGG + Intronic
982210516 4:153031310-153031332 CTCAATTTCCTGAGTAACAATGG - Intergenic
982265631 4:153536091-153536113 CTCCATCCCCAGACAAAGCACGG - Intronic
983274654 4:165602850-165602872 ATCCATGTCCAGACTAAACTGGG + Intergenic
986225824 5:5811431-5811453 TTCCATTTCCAGACTAAGTCAGG + Intergenic
987878035 5:23706353-23706375 CTCCAGTTCCAGACTACCCATGG + Intergenic
988117800 5:26919764-26919786 CCCCATTTCCAGACACACCCTGG + Intronic
989190167 5:38662957-38662979 CGCCACTTCCAGAATAACCAAGG - Intergenic
990731942 5:58818590-58818612 TGCCATTTGCAGAGTAACCATGG + Intronic
996398073 5:123033008-123033030 TTCCATTTCCAAAGTAACTAGGG + Intronic
996463378 5:123772410-123772432 CAGCATTTCCAGACTCACCCTGG - Intergenic
997629989 5:135360212-135360234 CTCCTCCTCCAGACTAACCAAGG + Intronic
999475092 5:151891067-151891089 CTCAAGTTCAAGACTAAACAAGG - Intronic
1001175874 5:169468533-169468555 TTCCATTCCCAGACTAAAGAGGG + Intergenic
1001439157 5:171725481-171725503 CTCCTTTTCCAGATTAAAGAAGG - Intergenic
1001884389 5:175276012-175276034 CTCCTTATCCAGGCAAACCAGGG - Intergenic
1004105292 6:12661597-12661619 CTCCTTTTCCTAACCAACCAGGG + Intergenic
1007534449 6:42573004-42573026 CTCCATTTCCAGCTCAACCTGGG - Intronic
1015169204 6:130232213-130232235 TTCCATTTCCAGCCTATCCTGGG - Intronic
1016966984 6:149728283-149728305 TTTTATTTCCAGTCTAACCAAGG + Intronic
1017692218 6:156978203-156978225 CTCCATTTCCAGACTCTGCCTGG + Intronic
1018359752 6:163055199-163055221 CTCCATTTCCACACTGTCCCCGG - Intronic
1020848583 7:13319798-13319820 CTCCATTTCCAGTCAAAGGAAGG - Intergenic
1021459501 7:20870053-20870075 CTCCATTTCCAAAAAAAACAAGG + Intergenic
1022466108 7:30654077-30654099 CTCCCCTGCCTGACTAACCATGG + Intronic
1032896498 7:136256860-136256882 CTCCATCTACAGAGGAACCAGGG - Intergenic
1033815062 7:145061063-145061085 CTCCATTTCAAGATCAACAATGG - Intergenic
1037452548 8:19030779-19030801 CTCCATTTCTAGATCATCCAAGG + Intronic
1040033146 8:42843984-42844006 CTCGAGTTCCAGACTGACCTGGG - Intergenic
1043111741 8:76193174-76193196 CTAAATTTCCAGATTAGCCAAGG + Intergenic
1046315386 8:112494612-112494634 CTACATTTCCAGAGTTAGCAGGG - Intronic
1048574553 8:135680464-135680486 CTCCACTTCCAGACAACTCAAGG + Intergenic
1051216186 9:14800281-14800303 CTCCTTTGCCAGGCTAGCCAAGG - Intronic
1051221346 9:14851512-14851534 ATCCACTTCCAGAATAAACACGG + Exonic
1051867028 9:21695042-21695064 CTCCATTTACAGCCTCCCCATGG + Intergenic
1052874820 9:33549963-33549985 CCCCATTTTCAGACTAATGAGGG + Intronic
1052951530 9:34217170-34217192 CTCCATTCTCTGACTGACCAAGG - Intronic
1053501204 9:38594349-38594371 CCCCATTTTCAGACTAATGAGGG - Intergenic
1057680598 9:97178862-97178884 CCCCATTTTCAGACTAATGAGGG - Intergenic
1059844916 9:118264381-118264403 TTTCACTTCCATACTAACCAGGG + Intergenic
1060441244 9:123641559-123641581 GTCCTTTTCTAGACTAGCCAAGG + Intronic
1060590394 9:124812632-124812654 CTCCTCTTCCAGACTCACCAGGG + Exonic
1061568092 9:131457652-131457674 CTCCTTTTCCAGACCATCCATGG + Intronic
1061959959 9:133982882-133982904 CTCCGTTTACAGACCACCCAGGG + Intronic
1062722074 9:138049830-138049852 CTCCATTTCCAGCCACAGCAGGG - Intronic
1203393930 Un_KI270512v1:4354-4376 CTCTTTTTGCAGAATAACCAGGG - Intergenic
1185744531 X:2561647-2561669 CCTCATTTCCAGAGTAAGCAGGG + Intergenic
1195692228 X:107636326-107636348 CCCCATTTCAAGACCAACCTTGG - Intronic
1197090054 X:122525211-122525233 CTTTATTTCCAGACTATTCAAGG - Intergenic
1197633690 X:128890907-128890929 CACCATTTCCTGTTTAACCAGGG - Intergenic
1200337107 X:155362377-155362399 CTCCACTTCCAGAGTTACCTTGG - Intergenic
1200349363 X:155478850-155478872 CTCCACTTCCAGAGTTACCTTGG + Intergenic