ID: 975705787

View in Genome Browser
Species Human (GRCh38)
Location 4:77110847-77110869
Sequence GCCACTGTGAGAAAAGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975705787_975705794 19 Left 975705787 4:77110847-77110869 CCCCGCCCTTTTCTCACAGTGGC No data
Right 975705794 4:77110889-77110911 TCTTTCTTAAGAATTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975705787 Original CRISPR GCCACTGTGAGAAAAGGGCG GGG (reversed) Intergenic
No off target data available for this crispr