ID: 975706100

View in Genome Browser
Species Human (GRCh38)
Location 4:77113279-77113301
Sequence TCGCGCGGTGCCGGAGTCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975706091_975706100 19 Left 975706091 4:77113237-77113259 CCAGGGGCCTGGGCTGGGGCCGG 0: 1
1: 1
2: 24
3: 206
4: 1277
Right 975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG 0: 1
1: 0
2: 1
3: 0
4: 31
975706093_975706100 12 Left 975706093 4:77113244-77113266 CCTGGGCTGGGGCCGGCTGCAGG 0: 1
1: 0
2: 23
3: 83
4: 664
Right 975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG 0: 1
1: 0
2: 1
3: 0
4: 31
975706096_975706100 0 Left 975706096 4:77113256-77113278 CCGGCTGCAGGCTGCAGGCTGCC 0: 1
1: 0
2: 13
3: 98
4: 594
Right 975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG 0: 1
1: 0
2: 1
3: 0
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975706100 Original CRISPR TCGCGCGGTGCCGGAGTCCT CGG Intergenic
908544016 1:65147525-65147547 TCGCGCGGAGCCGGTCTCCCGGG + Intergenic
910478786 1:87636301-87636323 TCGGGCTGTGCAGGAGTCCATGG + Intergenic
918414934 1:184296877-184296899 TAGAGCGGTGCTGGAGTCATGGG + Intergenic
919981294 1:202644098-202644120 CCGCGGGCTGCCGGAGCCCTCGG - Intronic
920512467 1:206561089-206561111 TGGGCCGGTGCCAGAGTCCTGGG - Intronic
1067563082 10:47317568-47317590 TTGCATGGTGCAGGAGTCCTAGG + Intergenic
1085207633 11:74746152-74746174 TCGCGCGGAGGCGGAGGCTTGGG - Intergenic
1101427416 12:104599358-104599380 CCGCGCGGTCCCGGAGCCATGGG + Intronic
1103412975 12:120725820-120725842 GCGCGCTGTTCCGGAGTGCTGGG - Exonic
1124496996 15:30192833-30192855 CCGCGGGCTGCCGGAGCCCTCGG - Intergenic
1124746580 15:32345814-32345836 CCGCGGGCTGCCGGAGCCCTCGG + Intergenic
1132349689 15:101132179-101132201 TCGCAGGGGGCTGGAGTCCTGGG + Intergenic
1135572285 16:23558055-23558077 TCGTGCGGCGCCGGAGTCCTCGG - Exonic
1143539710 17:7561847-7561869 TCCCGTGGCGCCGGCGTCCTCGG + Intergenic
1147648796 17:42050431-42050453 GCGCGCGGTGACAGAGCCCTCGG + Intronic
1152852886 17:82648145-82648167 TCGGGCGGGGCCGGGGTCCCGGG + Intronic
1155284206 18:24271874-24271896 GGGCGCGGCGCGGGAGTCCTGGG - Intronic
937394348 2:121521471-121521493 TAGCTCGGAGCCGGAGTCTTGGG - Intronic
946351871 2:219160596-219160618 GCGCGCGCTGCCGGGGTCCAGGG - Intronic
946391375 2:219418640-219418662 TCGGGCGGGGCCGGGGGCCTGGG + Exonic
1169143882 20:3240182-3240204 CCGCGCTGGGACGGAGTCCTCGG + Intergenic
1174494587 20:50930845-50930867 GCGCGCGGGGCCGGCGTGCTCGG + Exonic
950656316 3:14439124-14439146 TTGCTCGGTGCCGGAGGCCCAGG + Intronic
952929744 3:38349836-38349858 TCACTCGGTGCAGGAGTGCTTGG + Intronic
966362968 3:179149055-179149077 GCTGGCGGGGCCGGAGTCCTCGG - Intronic
970637104 4:18021668-18021690 CCGCTCAGTGCCGGAGCCCTCGG - Exonic
975706100 4:77113279-77113301 TCGCGCGGTGCCGGAGTCCTCGG + Intergenic
1002046153 5:176542929-176542951 GCTCGCGGTGCCGGACGCCTGGG + Intronic
1015403732 6:132814591-132814613 TCGCGCGGAGGCGGAGGCTTGGG + Exonic
1027592539 7:80134701-80134723 TGGCGCGGCGCCGGGGTCCGGGG + Intronic
1049815379 8:144596715-144596737 GCGCGCACTGCCGGGGTCCTCGG + Intronic
1054891793 9:70259317-70259339 CCGCGCGCTGCCGGAGCCCCGGG - Intronic
1188137050 X:26504155-26504177 TGGGTCGGTCCCGGAGTCCTTGG - Intergenic