ID: 975706763

View in Genome Browser
Species Human (GRCh38)
Location 4:77119716-77119738
Sequence GCATTCTATATAATTTCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975706760_975706763 11 Left 975706760 4:77119682-77119704 CCCTTTTCATATCTTCCATCATT No data
Right 975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG No data
975706762_975706763 -4 Left 975706762 4:77119697-77119719 CCATCATTTTGACTATGCTGCAT No data
Right 975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG No data
975706761_975706763 10 Left 975706761 4:77119683-77119705 CCTTTTCATATCTTCCATCATTT No data
Right 975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG No data
975706758_975706763 25 Left 975706758 4:77119668-77119690 CCATTTTGTTTAACCCCTTTTCA No data
Right 975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG No data
975706757_975706763 28 Left 975706757 4:77119665-77119687 CCTCCATTTTGTTTAACCCCTTT No data
Right 975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG No data
975706759_975706763 12 Left 975706759 4:77119681-77119703 CCCCTTTTCATATCTTCCATCAT No data
Right 975706763 4:77119716-77119738 GCATTCTATATAATTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975706763 Original CRISPR GCATTCTATATAATTTCCTC AGG Intergenic
No off target data available for this crispr